CN116655740B - Antigen mimic peptide of ochratoxin A, encoding nucleic acid molecule and application - Google Patents

Abstract

The invention discloses an antigen mimic peptide of ochratoxin A, a coded nucleic acid molecule and application thereof, and belongs to the technical field of biological detection. The invention screens OTA antigen mimic peptide by taking an anti-OTA nanobody Nb28 as a target molecule, and the amino acid sequence of the antigen mimic peptide is shown in SEQ ID No. 1-SEQ ID No.3. The OTA antigen mimic peptide can be used for detecting OTA, and the invention establishes a direct competition ELISA method for OTA detection, and the IC of the 3 antigen mimic peptides ₅₀ The values are respectively 0.400 ng/mL, 1.308 ng/mL and 0.609ng/mL, and the sensitivity is high.

Description

Antigen mimic peptide of ochratoxin A, encoding nucleic acid molecule and application

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to an antigen mimic peptide of ochratoxin A, a coding nucleic acid molecule and application thereof.

Background

Ochratoxin a (OchratoxinA, OTA) is a mycotoxin contaminant present in various food products and feeds, particularly rice, wheat, corn, coffee, beer, wine, and the like in foods, susceptible to contamination by OTA. OTA contaminated feed can lead to accumulation of OTA in animal products or meat products, and its metabolites can produce nephrotoxicity, hepatotoxicity, immunotoxicity, teratogenicity, carcinogenicity and genotoxicity to spinal organisms after ingestion of OTA contaminated food. Furthermore, OTA has a relative stability, which results in incomplete removal of the food during processing. Therefore, in order to prevent OTA-contaminated food from jeopardizing human health, OTA in the food must be monitored.

In order to meet the requirements of OTA limiting standards in foods, detection of OTA in foods still depends on high sensitivity chromatographic and mass spectrometry methods such as HPLC, LC/MS, GC/MS, etc., but these methods require expensive equipment and complicated pretreatment processes, and require specialized personnel to perform operations to obtain reliable results. An alternative method of high sensitivity is immunoassays, which require only a simple colorimetric assay to achieve quantitative detection of OTA without the need for expensive equipment and skilled technicians. However, the immunoassay of small molecule mycotoxins inevitably introduces chemically coupled competing antigens, especially the standard is required to be an OTA antigen, which may cause injury to the detection personnel, so that the green immunoassay method which uses non-toxic mimetic peptides as toxic antigen substitutes can avoid the harm of mycotoxins to the health of operators in the synthesis process of toxic antigens. Currently, most antigen mimetic peptides are panning with monoclonal antibodies as target molecules, while nanobody-based mimetic peptides have been less studied.

Disclosure of Invention

The invention aims to provide an antigen mimic peptide of ochratoxin A, a coding nucleic acid molecule and application, wherein an anti-OTA nano antibody is used as a target molecule to screen the OTA antigen mimic peptide, so that an OTA chemical coupling antigen substitute with safety and economy is obtained.

The invention provides an antigen mimic peptide of ochratoxin A, which comprises any one of the following components:

(1) The amino acid sequence is shown as SEQ ID No. 1;

(2) The amino acid sequence is shown as SEQ ID No. 2;

(3) The amino acid sequence is shown as SEQ ID No.3.

The invention also provides a nucleic acid molecule encoding the antigen mimic peptide.

Preferably, the nucleic acid molecule comprises any one of the following:

(1) The nucleotide sequence is shown as SEQ ID No. 4;

(2) The nucleotide sequence is shown as SEQ ID No. 5;

(3) The nucleotide sequence is shown as SEQ ID No. 6.

The invention also provides application of the antigen mimic peptide or the nucleic acid molecule in detection of ochratoxin A.

Preferably, the detection comprises amplifying phage to obtain phage particles displaying the antigen mimetic peptides described above for direct use in analytical detection;

or the antigen mimic peptide is chemically synthesized or expressed in fusion with other proteins for immunological detection.

The invention also provides a method for detecting ochratoxin A by direct competition ELISA, which takes phage particles displaying the antigen mimic peptide as a standard substance.

The beneficial effects are that: the invention takes the anti-OTA nanobody Nb28 as a target molecule, and passes through His-tag and Ni of the target molecule ²⁺ Target molecules are adsorbed on Ni-IDA agarose magnetic beads, phage random display annular octapeptide library is added for affinity screening, and 3 OTA antigen mimic peptides are obtained after three rounds of screening: SEQ ID No.1 to SEQ ID No.3.

The invention can amplify phage to obtain phage particles with the OTA antigen mimic peptide, which can be directly used for analysis and detection, or can chemically synthesize the mimic peptide or carry out immunological detection and analysis by fusion expression with other proteins. The invention also establishes a direct competition ELISA method for OTA detection by replacing OTA artificial synthetic antigen with phage particles displaying OTA antigen mimic peptide. The OTA analog peptide can replace an OTA standard product with high price and strong toxicity for immunological detection of OTA, and effectively reduces the harm of OTA to human health in the detection process. Compared with the traditional antibody, the antigen mimic peptide takes the anti-OTA nanobody Nb28 as a target molecule, has higher solubility and more stable property, is suitable for prokaryotic expression and eukaryotic expression systems, and has low preparation cost and economy.

Drawings

FIG. 1 is a direct competition ELISA standard curve established by using the OTA antigen mimetic peptide of the invention, wherein the amino acid sequence of C8-1 is SEQ ID No.1, the amino acid sequence of C8-2 is SEQ ID No.2, and the amino acid sequence of C8-3 is SEQ ID No.3.

Detailed Description

The invention provides an antigen mimic peptide of ochratoxin A, which comprises any one of the following components:

(1) The amino acid sequence is shown as SEQ ID No. 1: CGPFALLEEC;

(2) The amino acid sequence is shown in SEQ ID No. 2: CGAFSFYGEC;

(3) The amino acid sequence is shown as SEQ ID No. 3: CGMALFALEC.

The invention preferably uses the anti-OTA nanobody as a target molecule to screen the OTA antigen mimic peptide, in the specific embodiment, uses the anti-OTA nanobody Nb28 as the target molecule, and passes through His-tag and Ni of the target molecule ²⁺ Target molecules are adsorbed on Ni-IDA agarose magnetic beads, phage random display annular octapeptide library is added for affinity screening, and after three rounds of screening, the 3 OTA antigen mimic peptides are obtained. In the present invention, in the molecular structure of the above antigen-mimetic peptide, capital letters represent a known natural L-type amino acid or one of D-type isomers thereof, respectively, i.e., L represents a leucine residue, T represents a threonine residue, F represents a phenylalanine residue, P represents a proline residue, G represents a glycine residue, K represents a lysine residue, E represents a glutamic acid residue, M represents a methionine residue, N represents an asparagine residue, H represents a histidine residue, and S represents a serine residue. The N-terminal and the C-terminal of the OTA antigen mimic peptide of the invention each comprise a cysteine residue (C) and form a cyclic structure through intramolecular disulfide bonds.

The invention also provides a nucleic acid molecule encoding the antigen mimic peptide.

The nucleic acid molecules of the invention preferably comprise any one of the following:

(1) The nucleotide sequence is shown as SEQ ID No. 4: TGTGGGCCGTTTGCGTTGTTGGAGGAGTGT;

(2) The nucleotide sequence is shown as SEQ ID No. 5: TGTGGTGCGTTTAGTTTTTATGGTGAGTGT;

(3) The nucleotide sequence is shown as SEQ ID No. 6: TGTGGGATGGCGTTGTTTGCGCTTGAGTGT.

The invention also provides application of the antigen mimic peptide or the nucleic acid molecule in detection of ochratoxin A.

The detection of the invention preferably comprises amplifying phage to obtain phage particles displaying the antigen mimetic peptides described above for direct use in analytical detection; or the antigen mimic peptide is chemically synthesized or expressed in fusion with other proteins for immunological detection.

The invention also provides a method for detecting ochratoxin A by direct competition ELISA, which takes phage particles displaying the antigen mimic peptide as a standard substance.

The invention establishes a direct competition ELISA standard curve by using OTA antigen mimic peptide, and IC of SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3 and anti-OTA nano antibody ₅₀ The values were 0.400, 1.308, 0.609ng/mL, respectively.

For further explanation of the present invention, the antigen mimetic peptides of ochratoxin a, and the encoding nucleic acid molecules and applications provided in the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Affinity panning and identification of OTA mimotopes

The invention uses an anti-OTA nanobody Nb28 (Liu, X.; xu, Y.; xiong, Y.; tu, Z.; li, Y.; P.; he, Z.; y.; qia, Y.; fu, J.; H.; gee, S.J.; hammack, B.D.; VHH phase-Based Competitive Real-Time immune-Polymerase Chain Reaction for Ultrasensitive Detection of Ochratoxin A in ceramic Chemistry 2014,86 (15), 7471-7477.) as a target molecule, and the His-tag and Ni of the target molecule pass through the target molecule ²⁺ Nb28 was adsorbed on Ni-IDA agarose beads and phage random display circular octapeptide library was added for liquid affinity panning, which was performed three rounds in total. The specific method comprises the following steps:

1) Panning of OTA antigen mimetic peptides: mu.LNi-IDA agarose beads (10% v/v) were taken into 1.5mL centrifuge tubes, washed 3 times with PBS (10 mM, pH 7.4), placed in a magnetic field for 30s, and the supernatant discarded. Nanobody Nb2 was conjugated with Equilibration Buffer (10mM PBS,10mM imidazole,pH 7.4)8 diluted to a final concentration of 100. Mu.g/mL and added to the washed beads, and placed on a rotary mixer and shaken at room temperature for 1h. PBST (10mM,pH 7.4,0.1%Tween-20) was washed 3 times and resuspended in 300. Mu.L PBS. Will be 3X 10 ¹¹ phage random display circular octapeptide library of pfu was added to the resuspended Ni-IDA agarose beads and gently shaken at room temperature for 40min. The supernatant was separated in a magnetic field for 30s, washed 10 times with PBST, 1mL of Elutionbuffer (0.2M Gly-HCl,1mg/mL BSA, pH=2.2) was added, and the mixture was gently shaken at room temperature for 10min. The eluate was transferred to another 1.5mL centrifuge tube containing 150 μl of 1m tris-HCl (ph=9.1) and the eluate was subjected to magnetic field separation for 1 min. The eluted phage was used to infect E.coli ER2738 for amplification and titer determination, and the amplified phage was used for the next round of screening. During the second and third rounds of panning, anti-OTA nanobody Nb28 was added at concentrations of 10 μg/mL and 5 μg/mL, respectively, and PBST was used at concentrations of 0.25% and 0.5% Tween-20, respectively. In the eluting mode, the second round and the third round adopt standard substance competition elution, the concentration of the standard substance is 100ng/mL and 10ng/mL respectively, and the rest steps are the same as the above.

2) Amplification of phages: inoculating E.coli ER2738 in 3mL 2 XYT tube, culturing at 37deg.C and 250rpm to OD ₆₀₀ =0.5. The eluted phage was added to 3mL ER2738 (OD ₆₀₀ =0.5), the incubation was allowed to stand in an incubator at 37 ℃ for 30min. The infected cells were transferred to 47mL of 2 XYT medium (containing 50. Mu.g/mLAMP, 20. Mu.g/mL tetracycline and 20mM glucose), and incubated at 37℃at 250rpm to OD ₆₀₀ =0.5. M13KO7 helper phage (multiplicity of infection MOI > 20) was added and incubated at room temperature for 30min. The cells were resuspended in 50mL 2 XYT medium (containing 50. Mu.g/mLAmp, 50. Mu.g/mL Kan and 0.1mM IPTG) at 37℃and incubated overnight at 250rpm after centrifugation at 6000g for 15min at 4 ℃. Centrifuge for 15min at 4 ℃,10000g, transfer the supernatant to another clean centrifuge tube. The above steps are repeated. Adding 1/5 volume of PEG/NaCl [20% (w/v) PEG8000,2.5M NaCl]Incubate on ice for 4h. Centrifuge at 12000g for 20min at 4℃and discard supernatant, pellet was resuspended in 1mL PBS (containing 50% glycerol), -store at 80 ℃. Titers were determined on LB/Amp plates.

3) Amplification of phage clones: single colonies were randomly picked from the plates of the third round of titer assay into 1mL of 2 XYT/Amp medium and incubated overnight at 37℃with shaking at 220 rpm. Phage clones were amplified by the method described above, with 1% inoculum size inoculated in 2 XYT/Amp medium. The amplified Phage cultures were centrifuged at 10000rpm for 10min at 4℃and the supernatants were collected for Phage-ELISA identification.

4) Phage-ELISA identification of specific phages: 100. Mu.L BS diluted 2. Mu.g/mL anti-OTA nanobody Nb28 was added to the ELISA plate and incubated overnight at 4 ℃. PBST [10mM PBS,pH 7.4,0.05%Tween-20 (v/v)]Washed 3 times, and blocked with 300. Mu.L of 3% nonfat dry milk at 37℃for 1h. The blocking solution was discarded and washed 3 times with PBST. 50. Mu.L phage clones and 50. Mu.L 10% methanol-PBS were added to the negative wells, 50. Mu.L phage clones and 50. Mu.L OTA standard (100 ng/mL) were added to the positive wells, incubated for 1h at 37℃and PBST washed 5 times. 100. Mu.L of 0.1. Mu.g/mL HRP-labeled anti-M13 phage antibody was added and incubated for 1h at 37 ℃. PBST was washed 5 times, 100. Mu.L of TMB substrate solution was added thereto, developed at 37℃for 10min in the absence of light, and 50. Mu.L/well 2M H was added thereto ₂ SO ₄ The reaction is stopped, and the absorption value at 450nm is read by an enzyme-labeled instrument, so that the phage which can be combined with the anti-OTA nanobody Nb28 and can be inhibited by an OTA standard product is identified as the OTA mimic peptide. After further amplification of the specific phage clone, DNA sequencing was performed with primer 5 (SEQ ID No. 7) '-TAGTCCTCAAAGCCTCTGTA-3'. Their amino acid sequences are CGPFALLEEC, CGAFSFYGEC and CGMALFALEC.

Example 2

Application of OTA mimic peptide as competitive antigen in ELISA

1) Coating and sealing: anti-OTA nanobody heptamer Nb28-C4bp alpha was diluted with PBS (10 mM, pH 7.4) to a final concentration of 0.125. Mu.g/mL, 100. Mu.L/Kong Baobei at 96-well ELISA plate, and incubated overnight at 4 ℃. After 3 times of washing with PBST [10mM PBS,pH 7.4,0.05%Tween-20 (v/v) ] on the next day, blocking was performed with 3% skimmed milk powder at 37℃for 1 hour. The blocking solution was discarded and PBST was washed 3 times for use.

2) Labeling and extracting a sample: three LC-MS/MS verified OTA negative cereal samples (barley, oat and rice) were selected for sample labeling and recovery experiments. 1g of the powdered cereal sample without or with different concentrations of OTA was transferred to a 10mL centrifuge tube, 5mL of extract (50% -methanol PBS) was added and mixed by shaking. After 15min of ultrasonic-assisted extraction, 10000 Xg of the extract was centrifuged for 15min, and the supernatant was filtered through a 0.45 μm nylon filter membrane and diluted 10-fold with PBS for detection.

3) Establishment of a standard curve: the ELISA plate treated in 1) was removed, 50. Mu.L of phage displaying the OTA mimetic peptide and 50. Mu.L of 5% methanol-PBS diluted OTA standard at different concentrations were added to each well, and incubated at 37℃for 30min. After 5 washes of PBST, 100. Mu.L of 0.1. Mu.g/mL HRP-labeled anti-M13 phage antibody was added and incubated for 1h at 37 ℃. PBST was washed 5 times. 100 mu LTMB substrate solution is added, color development is carried out at 37 ℃ for 10min in a dark place, and an absorption value at 450nm is read by an enzyme-labeled instrument. Binding rate (OD of wells with OTA addition) on the log of OTA concentration ₄₅₀ OD of wells without OTA added ₄₅₀ X 100%) is on the ordinate, and a direct competition standard curve as shown in fig. 1 is established.

4) And (3) detecting a marked sample: taking out the ELISA plate treated by 1), adding 50 mu L phage displaying OTA antigen mimic peptide and 50 mu L3) treated sample into each well, and incubating at 37 ℃ for 30min. PBST was washed 5 times, 100. Mu.L of 0.1. Mu.g/mL HRP-labeled anti-M13 phage antibody was added, and incubated at 37℃for 1h. PBST is washed 5 times, 100 mu L of TMB substrate solution is added, color development is carried out for 10min at 37 ℃ in dark, and an absorption value at 450nm is read by an enzyme-labeled instrument. The binding rate was calculated and OTA content in the samples was obtained according to the standard curve, and the results are shown in table 1.

TABLE 1 results of detection of labeled samples based on OTA antigen mimetic peptides as competitor antigens

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (6)

1. An antigen mimic peptide of ochratoxin a, comprising any one of the following:

(1) The amino acid sequence is shown as SEQ ID No. 1;

(2) The amino acid sequence is shown as SEQ ID No. 2;

(3) The amino acid sequence is shown as SEQ ID No.3.

2. A nucleic acid molecule encoding the antigen mimetic peptide of claim 1.

3. The nucleic acid molecule of claim 2, wherein the nucleic acid molecule comprises any one of:

(1) The nucleotide sequence is shown as SEQ ID No. 4;

(2) The nucleotide sequence is shown as SEQ ID No. 5;

(3) The nucleotide sequence is shown as SEQ ID No. 6.

4. Use of an antigen mimetic peptide of claim 1 or a nucleic acid molecule of claim 2 or 3 for the detection of ochratoxin a for non-diagnostic purposes.

5. The use according to claim 4, wherein the detection of non-diagnostic purposes comprises amplifying phage to obtain phage particles displaying the antigen mimetic peptide of claim 1 directly for analytical detection;

or the antigen mimic peptide is chemically synthesized or expressed in fusion with other proteins for immunological detection.

6. A method for detecting ochratoxin a by direct competition ELISA for non-diagnostic purposes, characterized in that phage particles displaying the antigen mimetic peptide of claim 1 are used as standard.