CN104530195A - Antigen mimic epitope mimicking ochratoxin A and application thereof - Google Patents
Antigen mimic epitope mimicking ochratoxin A and application thereof Download PDFInfo
- Publication number
- CN104530195A CN104530195A CN201410550651.8A CN201410550651A CN104530195A CN 104530195 A CN104530195 A CN 104530195A CN 201410550651 A CN201410550651 A CN 201410550651A CN 104530195 A CN104530195 A CN 104530195A
- Authority
- CN
- China
- Prior art keywords
- ota
- antigenic epitope
- ochratoxin
- phage
- antigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of biology, and relates to an antigen mimic epitope mimicking ochratoxin A, which has an amino acid sequence of DGFQLHTPFSAK. The OTA antigen mimic epitope of the invention can substitute OTA standards which are high in price and strong in toxicity, can be used as a competition antigen or a solid phase coating antigen in OTA immunological detection, has similar immunoreaction characteristics to natural OTA molecules, and has very good effect. The antigen mimic epitope of the invention decreases harm to human health caused by OTA, saves the cost, and has very high application value.
Description
Technical field
The invention belongs to biological technical field, be specifically related to ochratoxin A antigenic epitope and application thereof.
Background technology
Ochratoxin A (Ochratoxin A, OTA) is a kind of common mycotoxins, is the secondary metabolite that some bacterial classification of Aspergillus and Penicillium produces.Research shows that OTA easily accumulates in tissue, and the first target organs of its effect is kidney, liver, belongs to strong kidney and hepatotoxin, and experiment shows that animal is taken in by after the feed of this endotoxin contamination, and acute or chronic poisoning disease can occur.In addition, according to reported in literature, OTA also has carcinogenic, teratogenesis and mutagenicity.The toxigenic bacterium strain of OTA is present in occurring in nature widely, the pollution of OTA can be detected in the tissue, blood of various farm crop, food, feed and the mankind and animal.OTA is polluted and carries out effective means that timely detection is its harm of prevention and corntrol.
At present, the method detecting OTA in food mainly contains the methods such as high performance liquid chromatography, gas-chromatography, thin-layer chromatography and immunology detection, and the advantages such as immunological detection method is highly sensitive with it, easy to detect, with low cost are widely used in the detection of OTA.But, in the process setting up immunological detection method, OTA standard substance must be used to prepare for raw material and to compete antigen or solid-phase coating antigen, OTA is not only expensive but also have extremely strong carinogenicity, great threat is caused to the health of testing staff and environment, thus constrains application and the popularization of immunological detection method to a certain extent.In view of this, people start to adopt antiidiotypic antibody and antigenic epitope technology to realize substituting of harmful small-molecule substance standard substance, and make some progress.The principal feature of phage display peptide library technology effectively to filter out the phage-displayed polypeptides with target target body specific combination, this technology exploring the interphase interaction binding site of acceptor and part, seek the bioactive ligand molecular of high-affinity, explore agnoprotein matter space structure epi-position, be widely used in the development of new generation vaccine etc.
The present invention is by using phage display peptide library technology, filter out from peptide storehouse can with the polypeptide (antigenic epitope) of target molecule (anti-OTA monoclonal antibody) specific binding, this antigenic epitope has the immune response characteristic with natural OTA molecular mimicry, by the OTA antigenic epitope obtained, to replace the OTA standard substance of expensive and strong toxicity, and be applied to the immunology detection of OTA as competition antigen or solid-phase coating antigen.
Summary of the invention
The present invention for target molecule with anti-OTA monoclonal antibody, by target molecule solid-phase coating on enzyme plate, drops into phage random and shows dodecapeptide storehouse, carry out affine elutriation, obtain the antigenic epitope of four kinds of OTA.Their aminoacid sequence is as follows: KLGFQLHQPSWP, FNLHQPIHNWPL, AQFFQLHSQAYS or DGFQLHTPFSAK.
The invention still further relates to the nucleotide sequence of above-mentioned antigenic epitope aminoacid sequence of encoding, correspond to respectively:
AAGCTTGGGTTTCAGTTGCATCAGCCTAGTTGGCCG、TTTAATTTGCATCAGCCGATTCATAATTGGCCGCTG、GCTCAGTTTTTTTAGCTGCATTCGCAGGCGTATTCG、GATGGTTTTCAGTTGCATACTCCTTTTTCTGCTAAG
In above-mentioned antigenic epitope (polypeptide) structure, capitalization English letter represents the one of 21 kinds of known natural L-form amino-acid residues or its D-type isomer respectively, namely C represents cysteine residues, D represents asparagicacid residue, P represents proline residue, R represents arginine residues, K represents lysine residue, H represents histidine residues, I represents isoleucine residues, V represents valine residue, Y represents tyrosine residues, S represents serine residue, F represents phenylalanine residue, E represents glutaminic acid residue, M represents methionine residues, G represents glycine residue, L represents leucine residue, Q represents glutamine residue, W representative color histidine residue, N represents asparagine residue, A represents alanine residue, T represents threonine residues.
The OTA antigenic epitope (polypeptide) that the present invention mentions is prepared in a large number by the mode that Phage amplification, chemosynthesis or genetically engineered are recombinant expressed.Phage amplification refers to phage displaying being had OTA antigenic epitope (polypeptide), the mode increased by biology, and amount reproduction production displaying has the bacteriophage particles of OTA antigenic epitope (polypeptide).Chemosynthesis refers to the aminoacid sequence according to OTA antigenic epitope, carries out Peptide systhesis by the mode of chemically synthesized polypeptide.The recombinant expressed mode of genetically engineered refers to the gene of coding OTA antigenic epitope, by being cloned into expression vector, carries out a large amount of preparations of OTA antigenic epitope with the form of polypeptide-fusion rotein.
The invention still further relates to the application of described OTA antigenic epitope in immunology detection is analyzed.The type of immunology detection comprises the immune analysis type of detection based on Ag-Ab specific reaction such as MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization.
OTA antigenic epitope (KLGFQLHQPSWP, FNLHQPIHNWPL, AQFFQLHSQAYS or DGFQLHTPFSAK) of the present invention is when applying, the mimic epitopes of synthesis can be used for immunology detection analysis, the bacteriophage particles of OTA antigenic epitope (polypeptide) displaying obtained by Phage amplification is had to be directly used in analyzing and testing, certainly, also OTA antigenic epitope can be scaled off replacement OTA standard substance to carry out immunology detection analysis from phage.
Also relate to the application in immunology detection is analyzed with solid phase antigen or competition antigen of OTA antigenic epitope.
Also relate to OTA antigenic epitope and detect the application in analyzing as solid phase antigen at colloidal gold immunochromatographimethod.
Aforementioned OTA antigenic epitope can replace the expensive and OTA standard substance of strong toxicity, and the immunology detection of OTA is applied to as competition antigen or solid-phase coating antigen, this antigenic epitope has the immune response characteristic with natural OTA molecular mimicry, and effect is very good.
The invention has the beneficial effects as follows: OTA antigenic epitope of the present invention can replace the expensive and OTA standard substance of strong toxicity, and the immunology detection of OTA is applied to as competition antigen or solid-phase coating antigen, this antigenic epitope has the immune response characteristic with natural OTA molecular mimicry, and effect is very good.Decrease the harm of OTA to HUMAN HEALTH, saved cost, there is very high using value.
Accompanying drawing explanation
The indirect competitive ELISA typical curve that Fig. 1 sets up with OTA antigenic epitope.OTA antigenic epitope Ph-1(KLGFQLHQPSWP), Ph-7(FNLHQPIHNWPL), Ph-18(AQFFQLHSQAYS), the IC of Ph-5 (DGFQLHTPFSAK) and anti-OTA antibody
50value is respectively 553,495,509 pg/ml and 1.03 ng/ml.
Embodiment
The affine elutriation of embodiment 1. OTA antigenic epitope and qualification thereof
1) the affine elutriation of OTA antigenic epitope: concrete grammar is: dilute anti-OTA monoclonal antibody with 10 mM PBS (pH 7.4), and wrap by 96 hole enzyme plates with final concentration 100 μ g/mL, 4 DEG C of overnight incubation.Within second day, with after TBST (50 mM NaCl, pH 7.5 comprise 0.1% Tween-20 (v/v)) washing 10 times, add 300 μ l confining liquid (3% BSA-PBS) 4 DEG C and hatch 2 hours.Abandon confining liquid after 2 hours, wash 5 times with TBST, every hole adds 100 μ l phage peptide libraries, and (phage stoste, purchased from NEB company, is diluted with TBS 10 times, about 1.0 × 10 in phage display dodecapeptide storehouse
11pfu), 22-26 DEG C of oscillatory reaction 1 hour.Discard unconjugated phage, wash 10 times with TBST, in conjunction with on phage 0.2 M Glycine-HCl (pH 2.2) wash-out, and use immediately 15 μ l 1 M Tris-HCl (pH 9.1) neutralization.Get 10 μ l wash-out bacteriophages survey titres, remaining for infect 20 mL grow to logarithm early stage
e. colieR2738 bacterial strain increases.3rd day with PEG/NaCl deposition and purification phage, and the titre of phage after measuring amplification.
In the panning process that second, third is taken turns, the anti-OTA MAb concentration of bag quilt is respectively 75 μ g/mL and 50 μ g/mL, and TBST concentration used is 0.25% and 0.5%, and all the other steps are the same.
2) qualification of positive phage clones: measure random picking 20 phage spots the flat board of phage titre after third round elutriation, carry out the amplification of phage, adopt Immunofluorescent antibody detection method (Indirect Enzyme Linked immunoasorbent assay, I-ELISA) qualification of positive phage clones is carried out, concrete grammar is: first, anti-OTA monoclonal antibody is diluted with 10 mM PBS (pH 7.4), 10 μ g/mL wrap by 96 hole enzyme plates, 4 DEG C of overnight incubation.Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with the PBS containing 3% skim-milk, hatch 1 hour for 37 DEG C; Drop into 100 μ l phage spot amplification liquid (1.0 × 10
11pfu), using naive phage peptide storehouse as negative control, hatch 1 hour for 37 DEG C; Add the HRP that 1:5000 doubly dilutes and mark the anti-100 μ l of anti-M13 phage two, hatch 1 hour for 37 DEG C; Add 100 μ l tmb substrate liquid, lucifuge colour developing 5min, microplate reader (Thermo Scientific Multiskan FC) reads the absorption value at 450 nm places.Choose OD
450the phage clone being greater than negative control 2 times is positive colony.
3) qualification of OTA antigenic epitope: adopt the method for indirect competitive ELISA to carry out the qualification of OTA antigenic epitope, concrete grammar is: dilute anti-OTA monoclonal antibody with 10 mM PBS (pH 7.4), 10 μ g/mL coated elisa plates, 4 DEG C of overnight incubation; Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with the PBS containing 3% skim-milk, hatch 1 hour for 37 DEG C; Drop into 50 μ l and be accredited as positive phage clone (1.0 × 10 through indirect ELISA
11pfu) and 50 μ l OTA standard substance (concentration range is 0-20 ng/ml), hatch 1 hour for 37 DEG C; Add the anti-100 μ l of anti-M13 phage two that 1:5000 dilutes HRP mark, hatch 1 hour for 37 DEG C; Add 100 μ l tmb substrate liquid, lucifuge colour developing 5min, reads OD
450, can in conjunction with anti-OTA monoclonal antibody, and can the phage that blocks by OTA standard substance, be accredited as the antigenic epitope of OTA.
The order-checking of embodiment 2. OTA antigenic epitope encoding gene and the determination of aminoacid sequence thereof
Show have the phage of OTA antigenic epitope to increase by through indirect competitive ELISA qualification, extract the DNA sequencing template of phage.Simplified process is as follows: carry out Phage amplification, after the first step is centrifugal, 800 μ l is proceeded to a new centrifuge tube containing phage supernatant.Add 200 μ l PEG/NaCl precipitating phage.After centrifugal, precipitation is resuspended in 100 μ l iodide damping fluid (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI), add 250 μ l dehydrated alcohol precipitation DNA, again by 70% washing with alcohol precipitation (DNA sequencing template) after centrifugal.Precipitation is finally resuspended in 20 μ l aqua sterilisas, gets 2 μ l and carries out agarose gel electrophoresis analysis; Get 5 μ L phage templates and carry out DNA sequencing, its-96 gIII sequencing primer is: 5 '-
hOcCC TCA TAG TTA GCG TAA CG-3 '.The aminoacid sequence of OTA antigenic epitope can be obtained according to DNA sequencing result and password sublist.Their aminoacid sequence is as follows: KLGFQLHQPSWP, FNLHQPIHNWPL, AQFFQLHSQAYS or DGFQLHTPFSAK.
Embodiment 3. OTA antigenic epitope is as the application of competition antigen in ELISA
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter of 60 %, 200 rpm vibrate 5 minutes; After extracting solution whatman No. 1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.
(2) wrap by and close
Anti-OTA monoclonal antibody is diluted, 10 μ g/mL coated elisa plates, 4 DEG C of overnight incubation with 10 mM PBS (pH 7.4).Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with containing the PBS of 3% skim-milk, 37 DEG C hatch 1 hour after, wash plate 6 times with PBST stand-by.
(3) foundation of typical curve
Take out the lath handled well through step (2), every hole is dropped into 50 μ l respectively and is shown the phage (1.0 × 10 having OTA antigenic epitope
11pfu) and 50 μ l OTA standard substance of a series of different concns, 1 hour is hatched for 37 DEG C.The anti-M13 phage two adding 1:5000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read
450.With OTA log concentration for X-coordinate, combination rate (adds the OD in the hole of OTA
450/ do not add the OD in the hole of OTA
450× 100%) be ordinate zou, set up indirect competition typical curve.Result display typical curve is S-type, and linear dependence better (Fig. 1).As Fig. 1, the indirect competitive ELISA typical curve set up with OTA antigenic epitope.OTA antigenic epitope Ph-1(KLGFQLHQPSWP), Ph-7(FNLHQPIHNWPL), Ph-18(AQFFQLHSQAYS), the IC50 value of Ph-5 (DGFQLHTPFSAK) and anti-OTA antibody is respectively 553,495,509 pg/ml and 1.03 ng/ml.
(4) detection of sample
Take out the lath handled well through step (2), every hole is dropped into 50 μ l respectively and is shown the phage (1.0 × 10 having OTA antigenic epitope
11pfu) and testing sample extracting solution, 1 hour is hatched for 37 DEG C.The anti-M13 phage two adding 1:5000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read
450, calculations incorporated rate, and according to typical curve, the content of OTA in sample of retrodicting out.
Embodiment 4. OTA antigenic epitope is as the application of solid phase antigen in ELISA
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter of 60 %, 200 rpm vibrate 5 minutes; After extracting solution whatman No. 1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.
(2) wrap by and close
The phage (2.0 × 10 having OTA antigenic epitope is shown with 10 mM PBS (pH 7.4) dilution
11pfu), 100 microlitres are coated in enzyme plate, 4 DEG C of overnight incubation.Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with containing the PBS of 3% skim-milk, 37 DEG C hatch 1 hour after, wash plate 6 times with PBST stand-by.
(3) foundation of typical curve
Take out the lath handled well through step (2), 50 μ l OTA standard substance of 50 μ l anti-OTA monoclonal antibody (0.5 ng/ml) and a series of different concns are dropped in every hole respectively, hatch 1 hour for 37 DEG C.The sheep anti-mouse igg two adding 1:2000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read
450.With OTA log concentration for X-coordinate, combination rate (adds the OD in the hole of OTA
450/ do not add the OD in the hole of OTA
450× 100%) be ordinate zou, set up indirect competition typical curve.
(4) detection of sample
Take out the lath handled well through step (2), 50 μ l OTA standard substance of 50 μ l anti-OTA monoclonal antibody (0.5 ng/ml) and a series of different concns are dropped in every hole respectively, hatch 1 hour for 37 DEG C.The sheep anti-mouse igg two adding 1:2000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read
450.With OTA log concentration for X-coordinate, combination rate (adds the OD in the hole of OTA
450/ do not add the OD in the hole of OTA
450× 100%) be ordinate zou, set up indirect competition typical curve.
Embodiment 5. OTA antigenic epitope is as the application of solid phase antigen in highly-pathogenic avian influenza
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter of 60 %, 200 rpm vibrate 5 minutes; After extracting solution whatman No. 1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.
(2) dot matrix of phage and control line
The phage (2.0 × 10 having OTA antigenic epitope is shown with 10 mM PBS (pH 7.4) dilution
11pfu), phage is lined (aperture 0.2-0.45 micron) on nitrocellulose filter, as detection line with dot matrix instrument or micropipet; The sheep anti-mouse igg two that the HRP of 0.5 mg/ml marks is resisted, lines (be positioned at the top of detection line, distance is greater than 5 millimeters) on same nitrocellulose filter, as control line with dot matrix instrument or micropipette.
(3) colloid gold label OTA antibody
OTA antibody is dropwise added in colloidal gold solution (pH=8.2), drip while stir, after 30 minutes, getting 1% PEG adds in above-mentioned solution, continue stirring adds 1/10th volumes 10% BSA solution after 15 minutes, stir after 15 minutes, leave standstill 30 minutes, remove supernatant after centrifugal, obtain the OTA antibody-solutions of colloid gold label.
(4) assembling of colloidal-gold detecting-card
The OTA antibody point of colloid gold label is sprayed on glue gold pad upper (1.0 mcg/ml), by sample pad, glue gold pad, nitrocellulose filter and the blotter of dot matrix detection line and control line are assembled, and are cut into test strip, load in test card stand-by.
(5) detection of sample
Added by sample extracting solution in sample pad, leave standstill 10 minutes, if exceed the detection threshold of colloidal gold test containing OTA in sample, then do not develop the color in detection line region, and the colour developing of control line region; If not containing OTA and lower than the detection threshold of colloidal gold test in sample, then detection line region colour developing, also develops the color in control line region.If do not develop the color in control line region, show that test strip lost efficacy.
A large amount of preparations of embodiment 6 OTA antigenic epitope
(1) in the mode of Phage amplification
Displaying being had the phage of OTA antigenic epitope to be added to 20 ml inoculations has in the culture of ER 2738,37 degree of 220 rpm shaking culture 4.5 h.Proceeded to by culture in another centrifuge tube, 4 DEG C of 10000 centrifugal 10 min of rpm, proceeds to top 80 % of supernatant in a fresh tube, adds the PEG/NaCl of 1/6 volume, leaves standstill 120 min at 4 DEG C.4 DEG C of 10000 centrifugal PEG/NaCL of rpm leaves standstill solution 15 min.Abandon supernatant, of short duration centrifugal after suck residual supernatant liquor.Adding 1mL TBS carries out resuspended, is Phage amplification liquid.
(2) be prepared in the mode of OTA antigenic epitope-fusion rotein
A. the external source encoding gene of pcr amplification OTA antigenic epitope
PCR reaction system: (50 μ L)
10 × Pyrobest Buffer (Mg2+ plus) 5 μL
dNTP Mixture (each for 2.5 mM) 4 μL
M13KE insert extension primer (10 mM） 1 μL
-96 gIII sequencing primer (10 mM) 1 μL
Phage DNA template 1 μ L
Pyrobest DNA Polymerase 0.5 μL
Sterilizing ddH2O 37.5 μ L
PCR reaction conditions: 95 DEG C of 5 min, then 95 DEG C of 30 sec, 55 DEG C of 30 sec, 72 DEG C of 40sec, 72 DEG C of 10 min totally 30 cycles
Adopt PCR product to reclaim kits PCR product, trace dna quantitative instrument is quantitative.The coding gene sequence of OTA antigenic epitope of the present invention corresponds to respectively:
AAGCTTGGGTTTCAGTTGCATCAGCCTAGTTGGCCG、TTTAATTTGCATCAGCCGATTCATAATTGGCCGCTG、GCTCAGTTTTTTTAGCTGCATTCGCAGGCGTATTCG、GATGGTTTTCAGTTGCATACTCCTTTTTCTGCTAAG
B. the double digestion of external source encoding gene and expression vector
ACC65I and the Eag external source code gene of I enzyme and expression vector (MBP fusion rotein can be expressed by pMAl-pIII, NEB company) is adopted to carry out double digestion respectively.
C. enzyme cuts connection and the conversion of after product
By plasmid pMal-PIII and object fragment with 1: 10(mol ratio) mixing, connect 12 h in 16 DEG C of water-baths, get 10 μ L and connect products and add in 100 μ L competent cell TB1, fully mix.After ice bath 30 min, 42 DEG C of water-bath heat shock 90 s, 600 μ L LB liquid mediums are added immediately after ice bath 5 min, 37 DEG C, 200 rpm cultivate 1 h, centrifugal 2 min of 10000 rpm, suck supernatant and leave and take about 200 μ L, coat in LB-A solid (Ampr) substratum, 37 DEG C of incubated overnight, obtain positive colony.
The expression of OTA antigenic epitope-MBP fusion rotein
By the positive colony of above-mentioned acquisition, a single colony inoculation is chosen in 5 mL LB-A from flat board, in 0.2% sucrose, 37 DEG C, 220 r/min, shaking culture is spent the night, overnight culture is inoculated in the LB-A of 50 mL by 1 % inoculum size (v/v), in 0.2 % sucrose medium, inoculate 3 bottles respectively, 37 DEG C, 220 r/min shaking culture, when culture bacterial concentration OD600 reaches 0.6, in three bottles of cultures, add IPTG to final concentration is 0.2 mmol/L, 220 r/min shaking culture, by inductor (PEG solution) in 4 DEG C, 4000 g, centrifugal 20 min collect bacterial sediment, abandon supernatant.Re-suspended cell in 400 mL 30 mM Tris-HCl, 20% sucrose, pH 8.0 (80 mL/g wet cell weight), add EDTA to 1 mM, under room temperature, shake 5-10 min, 8000 g, 4 DEG C, centrifugal 20 min, abandon supernatant, precipitation is resuspended in 5 mM MgSO4 of 400 ml precoolings, shakes 10 min on ice, 8000 g, 4 DEG C, centrifugal 20 min, retain supernatant, in supernatant liquor, add 8 mL 1 M Tris-HCl, pH 7.4, obtain OTA antigenic epitope-MBP fusion rotein.
SEQUENCE LISTING
<110> University Of Nanchang
<120> simulates antigenic epitope and the application thereof of ochratoxin A
<130> 1
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 12
<212> PRT
<213> artificial sequence
<400> 1
Lys Leu Gly Phe Gln Leu His Gln Pro Ser Trp Pro
1 5 10
<210> 2
<211> 12
<212> PRT
<213> artificial sequence
<400> 2
Phe Asn Leu His Gln Pro Ile His Asn Trp Pro Leu
1 5 10
<210> 3
<211> 12
<212> PRT
<213> artificial sequence
<400> 3
Ala Gln Phe Phe Gln Leu His Ser Gln Ala Tyr Ser
1 5 10
<210> 4
<211> 12
<212> PRT
<213> artificial sequence
<400> 4
Asp Gly Phe Gln Leu His Thr Pro Phe Ser Ala Lys
1 5 10
<210> 5
<211> 36
<212> DNA
<213> artificial sequence
<400> 5
aagcttgggt ttcagttgca tcagcctagt tggccg 36
<210> 6
<211> 36
<212> DNA
<213> artificial sequence
<400> 6
tttaatttgc atcagccgat tcataattgg ccgctg 36
<210> 7
<211> 36
<212> DNA
<213> artificial sequence
<400> 7
gctcagtttt tttagctgca ttcgcaggcg tattcg 36
<210> 8
<211> 36
<212> DNA
<213> artificial sequence
<400> 8
gatggttttc agttgcatac tcctttttct gctaag 36
Claims (7)
1. simulate the antigenic epitope of ochratoxin A, it is characterized in that aminoacid sequence is: DGFQLHTPFSAK.
2. the Nucleotide of antigenic epitope aminoacid sequence described in coding claim 1.
3. Nucleotide as claimed in claim 2, sequence pair should be: GATGGTTTTCAGTTGCATACTCCTTTTTCTGCTAAG.
4. the preparation method of antigenic epitope as claimed in claim 1, is characterized in that the mode by Phage amplification, chemosynthesis or genetically engineered are recombinant expressed is prepared in a large number; Described Phage amplification refers to will show the phage having ochratoxin A antigenic epitope, the mode increased by biology, and amount reproduction produces the bacteriophage particles shown and have ochratoxin A antigenic epitope; Described chemosynthesis refers to, according to mimic epitopes mimic epitopes aminoacid sequence, carry out Peptide systhesis by the mode of chemically synthesized polypeptide; The recombinant expressed mode of described genetically engineered refers to the gene of coding simulation epi-position, by being cloned into expression vector, carries out a large amount of preparations of ochratoxin A antigenic epitope with the form of polypeptide-fusion rotein.
5. antigenic epitope described in claim 1 is as the application in immunology detection analytical reagent.
6. apply as claimed in claim 5, it is characterized in that ochratoxin A antigenic epitope is using solid phase antigen or competition antigen forms as the application of immunology detection analytical reagent.
7., as applied as claimed in claim 5, it is characterized in that ochratoxin A antigenic epitope detects the application of analytical reagent using solid phase antigen form as colloidal gold immunochromatographimethod.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410550651.8A CN104530195B (en) | 2013-03-06 | 2013-03-06 | Simulate antigenic epitope and its application of ochratoxin A |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410550651.8A CN104530195B (en) | 2013-03-06 | 2013-03-06 | Simulate antigenic epitope and its application of ochratoxin A |
| CN201310071736.3A CN103145808B (en) | 2013-03-06 | 2013-03-06 | Antigen mimic epitope of ochratoxin A and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310071736.3A Division CN103145808B (en) | 2013-03-06 | 2013-03-06 | Antigen mimic epitope of ochratoxin A and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104530195A true CN104530195A (en) | 2015-04-22 |
| CN104530195B CN104530195B (en) | 2017-07-28 |
Family
ID=52845859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410550651.8A Expired - Fee Related CN104530195B (en) | 2013-03-06 | 2013-03-06 | Simulate antigenic epitope and its application of ochratoxin A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104530195B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116655740A (en) * | 2023-05-26 | 2023-08-29 | 海南大学 | Antigen mimic peptide of ochratoxin A, encoding nucleic acid molecule and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030166070A1 (en) * | 2000-08-31 | 2003-09-04 | Si Lok | Human phermone polypeptides |
| CN101633932A (en) * | 2009-05-31 | 2010-01-27 | 江西科技师范学院 | Preparation method and application of high-density molecular simulation epitope peptide of ochratoxin A |
-
2013
- 2013-03-06 CN CN201410550651.8A patent/CN104530195B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030166070A1 (en) * | 2000-08-31 | 2003-09-04 | Si Lok | Human phermone polypeptides |
| CN101633932A (en) * | 2009-05-31 | 2010-01-27 | 江西科技师范学院 | Preparation method and application of high-density molecular simulation epitope peptide of ochratoxin A |
Non-Patent Citations (3)
| Title |
|---|
| NEW ENGLAND BIOLABS TM: "《应用噬菌体表面展示肽库快速筛选肽配体使用手册》", 1 September 2002 * |
| 刘仁荣等: "随机肽库筛选赭曲霉毒素A模拟表位及其应用", 《中国公共卫生》 * |
| 裴亚峰等: "利用噬菌体随机肽库筛选抗原模拟表位的研究进展", 《河南农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116655740A (en) * | 2023-05-26 | 2023-08-29 | 海南大学 | Antigen mimic peptide of ochratoxin A, encoding nucleic acid molecule and application |
| CN116655740B (en) * | 2023-05-26 | 2023-12-08 | 海南大学 | Antigen mimic peptide of ochratoxin A, encoding nucleic acid molecule and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104530195B (en) | 2017-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104530194A (en) | Antigen mimotope against ochratoxin A and application thereof | |
| CN103145808B (en) | Antigen mimic epitope of ochratoxin A and application thereof | |
| CN103044527B (en) | Antigenic mimic epitope of gentamycin and application thereof | |
| CN104327166A (en) | Ochratoxin A (OTA) dodecapeptide antigen mimicking epitope and application thereof | |
| CN103848895A (en) | Mimic epitope of linear dodecapeptide antigen of aflatoxin B1 and application thereof | |
| CN104530195A (en) | Antigen mimic epitope mimicking ochratoxin A and application thereof | |
| CN103044526B (en) | Antigenic mimic epitope of vardenafil and application thereof | |
| CN103342739B (en) | Antigenic mimic epitope of fumonisin B1 and application thereof | |
| CN104311637A (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN103848898B (en) | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof | |
| CN103848897B (en) | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof | |
| CN104311634A (en) | Antigen mimic epitope AM-1 of aflatoxin B1 and application thereof | |
| CN103059101B (en) | Antigenic mimic epitope of aflatoxin (AF) B1 and application thereof | |
| CN103848896B (en) | The antigenic epitope Ph5 of bisphenol-A and application thereof | |
| CN103102391B (en) | Antigenic mimic epitope of norfloxacin and application thereof | |
| CN104311638A (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104311636A (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104356207A (en) | Dodecapeptide antigen mimotope of FB1 (fumonisins B1) and application of dodecapeptide antigen mimotope | |
| CN104804070A (en) | Polypeptide molecule capable of being specifically bound with ZEN (Zearalenone) and application of polypeptide molecule | |
| CN104356208A (en) | Dodecapeptide antigen mimic epitope for FB1 (fumonisins B1) and application of dodecapeptide antigen mimic epitope | |
| CN104311635A (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104119425B (en) | The antigenic epitope of simulation norfloxacin and application thereof | |
| CN103965290B (en) | The heptapeptide antigenic epitope of norfloxacin and application thereof | |
| CN103848899B (en) | The antigenic epitope Ph15 of bisphenol-A and application thereof | |
| CN108358996A (en) | A kind of epitope peptide, preparation method and the application of simulation diethylstilbestrol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170728 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |