CN104311637A

CN104311637A - Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope

Info

Publication number: CN104311637A
Application number: CN201410529789.XA
Authority: CN
Inventors: 何庆华; 许杨
Original assignee: Nanchang University
Current assignee: Nanchang University
Priority date: 2013-03-06
Filing date: 2013-03-06
Publication date: 2015-01-28
Anticipated expiration: 2033-03-06
Also published as: CN104311637B

Abstract

The invention belongs to the field of biotechnologies, and relates to an antigen mimic epitope capable of mimicking fumonisins B1. An amino acid sequence of the antigen mimic epitope is IHQELRYTKDSP. The antigen mimic epitope of FB1 is capable of replacing an FB1 standard substance which is high in price and strong in toxicity, and is applied to immunological detection of the FB1 as a competition antigen or solid-phase envelope antigen. The antigen mimic epitope has an immunoreaction characteristic similar to a natural FB1 molecule, and a good effect. The damage of the FB1 to the health of a human body is reduced, the cost is saved, and high application value is achieved.

Description

Simulation fumonisins B 1antigenic epitope and application thereof

Technical field

The invention belongs to biological technical field, be specifically related to fumonisins B ₁antigenic epitope and application thereof.

Background technology

Fumonisins B ₁(Fumonisins B ₁, FB ₁) be a kind of common mycotoxins, produce research primarily of fusarium moniliforme (Fusarium moniliforme) and show, FB ₁have stronger toxic action to the mankind and animal, comprise neurotoxicity, genotoxicity, embryotoxicity and teratogenesis carcinogenic etc., IARC is FB ₁be divided into 2B group, namely possible to mankind carcinogens.At present, majority state is to FB in cereal, grain and food ₁residual content set limit standard, as Food and Argriculture OrganizationFAO (FAO) specifies that FB is taken in maximum permission every day ₁, FB ₂, FB ₃total amount is 2 μ g/kg body weight; FB in Switzerland's regulation grain ₁and FB ₂total residual limitation is 1000 μ g/L.

At present, FB in food is detected ₁method mainly contain the methods such as high performance liquid chromatography, gas-chromatography, thin-layer chromatography and immunology detection, the advantages such as immunological detection method is highly sensitive with it, easy to detect, with low cost are at FB ₁detection in be widely used.But, in the process setting up immunological detection method, must FB be used ₁standard substance are that raw material prepares competition antigen or solid-phase coating antigen, FB ₁not only expensive but also there is extremely strong carinogenicity, great threat is caused to the health of testing staff and environment, thus constrains application and the popularization of immunological detection method to a certain extent.In view of this, people start to adopt antiidiotypic antibody and antigenic epitope technology to realize substituting of harmful small-molecule substance standard substance, and make some progress.The principal feature of phage display peptide library technology effectively to filter out the phage-displayed polypeptides with target target body specific combination, this technology exploring the interphase interaction binding site of acceptor and part, seek the bioactive ligand molecular of high-affinity, explore agnoprotein matter space structure epi-position, be widely used in the development of new generation vaccine etc.

The present invention by using phage display peptide library technology, filter out from peptide storehouse can with target molecule (anti-FB ₁monoclonal antibody) polypeptide (antigenic epitope) of specific binding, this antigenic epitope has and natural FB ₁the immune response characteristic of molecular mimicry, by the FB obtained ₁antigenic epitope, to replace the FB of expensive and strong toxicity ₁standard substance, and be applied to FB as competition antigen or solid-phase coating antigen ₁immunology detection.

Summary of the invention

The present invention is with anti-FB ₁monoclonal antibody is target molecule, by target molecule solid-phase coating on enzyme plate, drops into phage random and shows dodecapeptide storehouse, carry out affine elutriation, obtain seven kinds of FB ₁antigenic epitope.Their aminoacid sequence is as follows:

NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、GDGVHKSHDIRG、TTLQMRSEMADD、SMLNDYRDYTTH、TRDKSSMLERWP。

The invention still further relates to the nucleotide sequence of above-mentioned antigenic epitope aminoacid sequence of encoding, correspond to respectively:

AATAATGCGGCGATGTATTCGGAGATGGCTACTGA、TTTTATACTAGTCCGGGTCGGACGAGTCATTATATG 、ATTCATCAGGAGTTGCGTTATACTAAGGATTCTCCG、GGGGATGGGGTGCATAAGTCGCATGATATCCGTGGG、ACTACGCTTCAGATGCGTAGTGAGATGGCTGATGAT、TCGATGCTTAATGATTATCGTGATTATACTACTCAT、ACTCGGGATAAGTCGTCGATGTTGGAGCGTTGGCCG

In above-mentioned antigenic epitope (polypeptide) structure, capitalization English letter represents the one of 21 kinds of known natural L-form amino-acid residues or its D-type isomer respectively, C represents cysteine residues, D represents asparagicacid residue, P represents proline residue, R represents arginine residues, K represents lysine residue, H represents histidine residues, I represents isoleucine residues, V represents valine residue, Y represents tyrosine residues, S represents serine residue, F represents phenylalanine residue, E represents glutaminic acid residue, M represents methionine residues, G represents glycine residue, L represents leucine residue, Q represents glutamine residue, W representative color histidine residue, N represents asparagine residue, A represents alanine residue, T represents threonine residues.

The FB1 antigenic epitope (polypeptide) that the present invention mentions is prepared in a large number by the mode that Phage amplification, chemosynthesis or genetically engineered are recombinant expressed.Phage amplification refers to phage displaying being had FB1 antigenic epitope (polypeptide), the mode increased by biology, and amount reproduction production displaying has the bacteriophage particles of FB1 antigenic epitope (polypeptide).Chemosynthesis refers to the aminoacid sequence according to the FB1 antigenic epitope announced, and carries out Peptide systhesis by the mode of chemically synthesized polypeptide.The recombinant expressed mode of genetically engineered refers to the gene of coding FB1 antigenic epitope, by being cloned into expression vector, carries out a large amount of preparations of FB1 antigenic epitope with the form of polypeptide-fusion rotein.

The invention still further relates to described fumonisins B ₁the application of antigenic epitope in immunology detection is analyzed.The type of immunology detection comprises the immune analysis type of detection based on Ag-Ab specific reaction such as MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization.

Fumonisins B of the present invention ₁antigenic epitope (NNAAMYSEMATD, FYTSPGRTSHYM, IHQELRYTKDSP, GDGVHKSHDIRG, TTLQMRSEMADD, SMLNDYRDYTTH, TRDKSSMLERWP) is when applying, the mimic epitopes of synthesis can be used for immunology detection analysis, the displaying obtained by Phage amplification is had FB ₁the bacteriophage particles of antigenic epitope (polypeptide) is directly used in analyzing and testing, certainly, and also can by FB ₁antigenic epitope scales off from phage and replaces FB ₁standard substance carry out immunology detection analysis.

Also relate to fumonisins B ₁antigenic epitope application in immunology detection is analyzed with solid phase antigen or competition antigen.

Also relate to fumonisins B ₁antigenic epitope detects the application in analyzing as solid phase antigen at colloidal gold immunochromatographimethod.

Aforementioned fumonisins B ₁antigenic epitope can replace the expensive and FB of strong toxicity ₁standard substance, and be applied to FB as competition antigen or solid-phase coating antigen ₁immunology detection, this antigenic epitope has and natural FB ₁the immune response characteristic of molecular mimicry, effect is very good.

The invention has the beneficial effects as follows: fumonisins B of the present invention ₁antigenic epitope can replace the expensive and FB of strong toxicity ₁standard substance, and be applied to FB as competition antigen or solid-phase coating antigen ₁immunology detection, this antigenic epitope has and natural FB ₁the immune response characteristic of molecular mimicry, effect is very good.Decrease FB ₁to the harm of HUMAN HEALTH, save cost, there is very high using value.

Accompanying drawing explanation

Fig. 1 is the indirect competitive ELISA typical curve set up with FB1 antigenic epitope.The equation of linear regression of typical curve is y=-144.5ln (x)+196.18, R2=0.9609, IC ₅₀value is 0.562ng/mL, and linear detection range is 0.171 ~ 2.420 ng/mL, and lowest detection is limited to 0.121 ng/mL.

Embodiment

Embodiment 1. FB ₁the affine elutriation of antigenic epitope and qualification thereof

1) FB ₁the affine elutriation of antigenic epitope: concrete grammar is: dilute anti-FB with 10 mM PBS (pH 7.4) ₁monoclonal antibody, and wrap by 96 hole enzyme plates with final concentration 100 μ g/mL, 4 DEG C of overnight incubation.Within second day, with after TBST (50 mM NaCl, pH 7.5 comprise 0.1% Tween-20 (v/v)) washing 10 times, add 300 μ l confining liquid (3% BSA-PBS) 4 DEG C and hatch 2 hours.Abandon confining liquid after 2 hours, wash 5 times with TBST, every hole adds 100 μ l phage peptide libraries, and (phage stoste, purchased from NEB company, is diluted with TBS 10 times, about 1.0 × 10 in phage display dodecapeptide storehouse ¹¹pfu), 22-26 DEG C of oscillatory reaction 1 hour.Discard unconjugated phage, wash 10 times with TBST, in conjunction with on phage 0.2 M Glycine-HCl (pH 2.2) wash-out, and use immediately 15 μ l 1 M Tris-HCl (pH 9.1) neutralization.Get 10 μ l wash-out bacteriophages survey titres, remaining for infect 20 mL grow to logarithm early stage e. colieR2738 bacterial strain increases.3rd day with PEG/NaCl deposition and purification phage, and the titre of phage after measuring amplification.

In the panning process that second, third is taken turns, the anti-FB of bag quilt ₁mAb concentration is respectively 75 μ g/mL and 50 μ g/mL, and TBST concentration used is 0.25% and 0.5%, and all the other steps are the same.

2) qualification of positive phage clones: measure random picking 20 phage spots the flat board of phage titre after third round elutriation, carry out the amplification of phage, adopt Immunofluorescent antibody detection method (Indirect Enzyme Linked immunoasorbent assay, I-ELISA) qualification of positive phage clones is carried out, concrete grammar is: first, dilutes anti-FB with 10 mM PBS (pH 7.4) ₁monoclonal antibody, 10 μ g/mL wrap by 96 hole enzyme plates, 4 DEG C of overnight incubation.Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with the PBS containing 3% skim-milk, hatch 1 hour for 37 DEG C; Drop into 100 μ l phage spot amplification liquid (1.0 × 10 ¹¹pfu), using naive phage peptide storehouse as negative control, hatch 1 hour for 37 DEG C; Add the HRP that 1:5000 doubly dilutes and mark the anti-100 μ l of anti-M13 phage two, hatch 1 hour for 37 DEG C; Add 100 μ l tmb substrate liquid, lucifuge colour developing 5min, microplate reader (Thermo Scientific Multiskan FC) reads the absorption value at 450 nm places.Choose OD ₄₅₀the phage clone being greater than negative control 2 times is positive colony.

3) FB ₁the qualification of antigenic epitope: adopt the method for indirect competitive ELISA to carry out FB ₁the qualification of antigenic epitope, concrete grammar is: dilute anti-FB with 10 mM PBS (pH 7.4) ₁monoclonal antibody, 10 μ g/mL coated elisa plates, 4 DEG C of overnight incubation; Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with the PBS containing 3% skim-milk, hatch 1 hour for 37 DEG C; Drop into 50 μ l and be accredited as positive phage clone (1.0 × 10 through indirect ELISA ¹¹pfu) and 50 μ l FB ₁standard substance (concentration range is 0-20 ng/ml), hatch 1 hour for 37 DEG C; Add the anti-100 μ l of anti-M13 phage two that 1:5000 dilutes HRP mark, hatch 1 hour for 37 DEG C; Add 100 μ l tmb substrate liquid, lucifuge colour developing 5min, reads OD ₄₅₀, can in conjunction with anti-FB ₁monoclonal antibody, and can by FB ₁the phage that standard substance block, is accredited as FB ₁antigenic epitope.

Embodiment 2. FB ₁the order-checking of antigenic epitope encoding gene and the determination of aminoacid sequence thereof

Show have the phage of FB1 antigenic epitope to increase by through indirect competitive ELISA qualification, extract the DNA sequencing template of phage.Simplified process is as follows: carry out Phage amplification, after the first step is centrifugal, 800 μ l is proceeded to a new centrifuge tube containing phage supernatant.Add 200 μ l PEG/NaCl precipitating phage.After centrifugal, precipitation is resuspended in 100 μ l iodide damping fluid (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI), add 250 μ l dehydrated alcohol precipitation DNA, again by 70% washing with alcohol precipitation (DNA sequencing template) after centrifugal.Precipitation is finally resuspended in 20 μ l aqua sterilisas, gets 2 μ l and carries out agarose gel electrophoresis analysis; Get 5 μ L phage templates and carry out DNA sequencing, its-96 gIII sequencing primer is: 5 '- ^hOcCC TCA TAG TTA GCG TAA CG-3 '.FB can be obtained according to DNA sequencing result and password sublist ₁the aminoacid sequence of antigenic epitope.Their aminoacid sequence is as follows:

Embodiment 3. FB ₁antigenic epitope is as the application of competition antigen in ELISA

(1) sample extraction

Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter of 60 %, 200 rpm vibrate 5 minutes; After extracting solution whatman No. 1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.

(2) wrap by and close

Anti-FB is diluted with 10 mM PBS (pH 7.4) ₁monoclonal antibody, 10 μ g/mL coated elisa plates, 4 DEG C of overnight incubation.Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with containing the PBS of 3% skim-milk, 37 DEG C hatch 1 hour after, wash plate 6 times with PBST stand-by.

(3) foundation of typical curve

Take out the lath handled well through step (2), every hole is dropped into 50 μ l respectively and is shown there is FB ₁the phage (1.0 × 10 of antigenic epitope ¹¹and 50 μ l FB of a series of different concns pfu) ₁standard substance, hatch 1 hour for 37 DEG C.The anti-M13 phage two adding 1:5000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read ₄₅₀.With FB ₁log concentration is X-coordinate, and combination rate (adds FB ₁the OD in hole ₄₅₀/ do not add FB ₁the OD in hole ₄₅₀× 100%) be ordinate zou, set up indirect competition typical curve.Result display typical curve is S-type, and linear dependence better (Fig. 1).As Fig. 1, the indirect competitive ELISA typical curve set up with FB1 antigenic epitope (aminoacid sequence is for NNAAMYSEMATD).The equation of linear regression of typical curve is y=-144.5ln (x)+196.18, R2=0.9609, IC50 value is 0.562ng/mL, and linear detection range is 0.171 ~ 2.420 ng/mL, and lowest detection is limited to 0.121 ng/mL.

(4) detection of sample

Take out the lath handled well through step (2), every hole is dropped into 50 μ l respectively and is shown there is FB ₁the phage (1.0 × 10 of antigenic epitope ¹¹pfu) and testing sample extracting solution, 1 hour is hatched for 37 DEG C.The anti-M13 phage two adding 1:5000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read ₄₅₀, calculations incorporated rate, and according to typical curve, FB in sample of retrodicting out ₁content.

Embodiment 4. FB ₁antigenic epitope is as the application of solid phase antigen in ELISA

(1) sample extraction

(2) wrap by and close

Dilute displaying with 10 mM PBS (pH 7.4) and have FB ₁the phage (2.0 × 10 of antigenic epitope ¹¹pfu), 100 microlitres are coated in enzyme plate, 4 DEG C of overnight incubation.Within second day, with after PBST (10 mM PBS, 0.05% Tween-20 (v/v)) washing 3 times, close with containing the PBS of 3% skim-milk, 37 DEG C hatch 1 hour after, wash plate 6 times with PBST stand-by.

(3) foundation of typical curve

Take out the lath handled well through step (2), the anti-FB of 50 μ l is dropped in every hole respectively ₁50 μ l FB of monoclonal antibody (0.5 ng/ml) and a series of different concns ₁standard substance, hatch 1 hour for 37 DEG C.The sheep anti-mouse igg two adding 1:2000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD is read ₄₅₀.With FB ₁log concentration is X-coordinate, and combination rate (adds FB ₁the OD in hole ₄₅₀/ do not add FB ₁the OD in hole ₄₅₀× 100%) be ordinate zou, set up indirect competition typical curve.

(4) detection of sample

Embodiment 5. FB ₁antigenic epitope is as the application of solid phase antigen in highly-pathogenic avian influenza

(1) sample extraction

(2) dot matrix of phage and control line

Dilute displaying with 10 mM PBS (pH 7.4) and have FB of the present invention ₁the phage (2.0 × 10 of antigenic epitope ¹¹pfu), phage is lined (aperture 0.2-0.45 micron) on nitrocellulose filter, as detection line with dot matrix instrument or micropipet; The sheep anti-mouse igg two that the HRP of 0.5 mg/ml marks is resisted, lines (be positioned at the top of detection line, distance is greater than 5 millimeters) on same nitrocellulose filter, as control line with dot matrix instrument or micropipette.

(3) colloid gold label FB ₁antibody

By FB ₁antibody dropwise adds in colloidal gold solution (pH=8.2), drip while stir, after 30 minutes, getting 1% PEG adds in above-mentioned solution, continue stirring adds 1/10th volumes 10% BSA solution after 15 minutes, stir after 15 minutes, leave standstill 30 minutes, remove supernatant after centrifugal, obtain the FB of colloid gold label ₁antibody-solutions.

(4) assembling of colloidal-gold detecting-card

By the FB of colloid gold label ₁antibody point is sprayed on glue gold pad upper (1.0 mcg/ml), and by sample pad, glue gold pad, nitrocellulose filter and the blotter of dot matrix detection line and control line are assembled, and are cut into test strip, load in test card stand-by.

(5) detection of sample

Sample extracting solution is added in sample pad, leave standstill 10 minutes, if containing FB in sample ₁and exceeding the detection threshold of colloidal gold test, then do not develop the color in detection line region, and the colour developing of control line region; If not containing FB in sample ₁and lower than the detection threshold of colloidal gold test, then detection line region colour developing, also develops the color in control line region.If do not develop the color in control line region, show that test strip lost efficacy.

Embodiment 5 FB ₁a large amount of preparations of antigenic epitope

(1) in the mode of Phage amplification

Displaying being had the phage of FB1 antigenic epitope to be added to 20 ml inoculations has in the culture of ER 2738,37 degree of 220 rpm shaking culture 4.5 h.Proceeded to by culture in another centrifuge tube, 4 DEG C of 10000 centrifugal 10 min of rpm, proceeds to top 80 % of supernatant in a fresh tube, adds the PEG/NaCl of 1/6 volume, leaves standstill 120 min at 4 DEG C.4 DEG C of 10000 centrifugal PEG/NaCL of rpm leaves standstill solution 15 min.Abandon supernatant, of short duration centrifugal after suck residual supernatant liquor.Adding 1mL TBS carries out resuspended, is Phage amplification liquid.

(2) with FB ₁the mode of antigenic epitope-fusion rotein is prepared

A. the external source encoding gene of pcr amplification FB1 antigenic epitope

PCR reaction system: (50 μ L)

10 × Pyrobest Buffer (Mg2+ plus) 5 μL

dNTP Mixture (each for 2.5 mM) 4 μL

M13KE insert extension primer (10 mM） 1 μL

-96 gIII sequencing primer (10 mM) 1 μL

Phage DNA template 1 μ L

Pyrobest DNA Polymerase 0.5 μL

Sterilizing ddH2O 37.5 μ L

PCR reaction conditions: 95 DEG C of 5 min, then 95 DEG C of 30 sec, 55 DEG C of 30 sec, 72 DEG C of 40sec, 72 DEG C of 10 min totally 30 cycles.

Adopt PCR product to reclaim kits PCR product, trace dna quantitative instrument is quantitative.The coding gene sequence of FB1 antigenic epitope corresponds to respectively:

B. the double digestion of external source encoding gene and expression vector

ACC65I and the Eag external source code gene of I enzyme and expression vector (MBP fusion rotein can be expressed by pMAl-pIII, NEB company) is adopted to carry out double digestion respectively.

C. enzyme cuts connection and the conversion of after product

By plasmid pMal-PIII and object fragment with 1: 10(mol ratio) mixing, connect 12 h in 16 DEG C of water-baths, get 10 μ L and connect products and add in 100 μ L competent cell TB1, fully mix.After ice bath 30 min, 42 DEG C of water-bath heat shock 90 s, 600 μ L LB liquid mediums are added immediately after ice bath 5 min, 37 DEG C, 200 rpm cultivate 1 h, centrifugal 2 min of 10000 rpm, suck supernatant and leave and take about 200 μ L, coat in LB-A solid (Ampr) substratum, 37 DEG C of incubated overnight, obtain positive colony.

D. FB ₁the expression of antigenic epitope-MBP fusion rotein

By the positive colony of above-mentioned acquisition, a single colony inoculation is chosen in 5 mL LB-A from flat board, in 0.2% sucrose, 37 DEG C, 220 r/min, shaking culture is spent the night, overnight culture is inoculated in the LB-A of 50 mL by 1 % inoculum size (v/v), in 0.2 % sucrose medium, inoculate 3 bottles respectively, 37 DEG C, 220 r/min shaking culture, when culture bacterial concentration OD600 reaches 0.6, in three bottles of cultures, add IPTG to final concentration is 0.2 mmol/L, 220 r/min shaking culture, by inductor (PEG solution) in 4 DEG C, 4000 g, centrifugal 20 min collect bacterial sediment, abandon supernatant.Re-suspended cell in 400 mL 30 mM Tris-HCl, 20% sucrose, pH 8.0 (80 mL/g wet cell weight), add EDTA to 1 mM, under room temperature, shake 5-10 min, 8000 g, 4 DEG C, centrifugal 20 min, abandon supernatant, precipitation is resuspended in 5 mM MgSO4 of 400 ml precoolings, shakes 10 min on ice, 8000 g, 4 DEG C, centrifugal 20 min, retain supernatant, in supernatant liquor, add 8 mL 1 M Tris-HCl, pH 7.4, obtain FB1 antigenic epitope-MBP fusion rotein.

SEQUENCE LISTING

<110> University Of Nanchang

<120> simulates fumonisins B ₁antigenic epitope and application thereof

<130> 1

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 12

<212> PRT

<213> artificial sequence

<400> 1

Asn Asn Ala Ala Met Tyr Ser Glu Met Ala Thr Asp

1 5 10

<210> 2

<211> 12

<212> PRT

<213> artificial sequence

<400> 2

Phe Tyr Thr Ser Pro Gly Arg Thr Ser His Tyr Met

1 5 10

<210> 3

<211> 12

<212> PRT

<213> artificial sequence

<400> 3

Ile His Gln Glu Leu Arg Tyr Thr Lys Asp Ser Pro

1 5 10

<210> 4

<211> 12

<212> PRT

<213> artificial sequence

<400> 4

Gly Asp Gly Val His Lys Ser His Asp Ile Arg Gly

1 5 10

<210> 5

<211> 12

<212> PRT

<213> artificial sequence

<400> 5

Thr Thr Leu Gln Met Arg Ser Glu Met Ala Asp Asp

1 5 10

<210> 6

<211> 12

<212> PRT

<213> artificial sequence

<400> 6

Ser Met Leu Asn Asp Tyr Arg Asp Tyr Thr Thr His

1 5 10

<210> 7

<211> 12

<212> PRT

<213> artificial sequence

<400> 7

Thr Arg Asp Lys Ser Ser Met Leu Glu Arg Trp Pro

1 5 10

<210> 8

<211> 35

<212> DNA

<213> artificial sequence

<400> 8

aataatgcgg cgatgtattc ggagatggct actgat 36

<210> 9

<211> 36

<212> DNA

<213> artificial sequence

<400> 9

ttttatacta gtccgggtcg gacgagtcat tatatg 36

<210> 10

<211> 36

<212> DNA

<213> artificial sequence

<400> 10

attcatcagg agttgcgtta tactaaggat tctccg 36

<210> 11

<211> 36

<212> DNA

<213> artificial sequence

<400> 11

ggggatgggg tgcataagtc gcatgatatc cgtggg 36

<210> 12

<211> 36

<212> DNA

<213> artificial sequence

<400> 12

actacgcttc agatgcgtag tgagatggct gatgat 36

<210> 13

<211> 36

<212> DNA

<213> artificial sequence

<400> 13

tcgatgctta atgattatcg tgattatact actcat 36

<210> 14

<211> 36

<212> DNA

<213> artificial sequence

<400> 14

actcgggata agtcgtcgat gttggagcgt tggccg 36

Claims

1. simulate fumonisins B ₁antigenic epitope, is characterized in that aminoacid sequence is: IHQELRYTKDSP.

2. encode described in claim 1 and simulate fumonisins B ₁the Nucleotide of antigenic epitope aminoacid sequence.

3. Nucleotide as claimed in claim 2, sequence pair should be:

ATTCATCAGGAGTTGCGTTATACTAAGGATTCTCCG。

4. simulate fumonisins B described in claim 1 ₁the application of antigenic epitope in immunology detection is analyzed.

5. apply as claimed in claim 4, it is characterized in that simulation fumonisins B ₁antigenic epitope application in immunology detection is analyzed with solid phase antigen or competition antigen.

6., as applied as claimed in claim 4, it is characterized in that simulation fumonisins B ₁antigenic epitope detects the application in analyzing as solid phase antigen at colloidal gold immunochromatographimethod.