CN104293896B - The method of SNP site genotyping - Google Patents
The method of SNP site genotyping Download PDFInfo
- Publication number
- CN104293896B CN104293896B CN201310298870.7A CN201310298870A CN104293896B CN 104293896 B CN104293896 B CN 104293896B CN 201310298870 A CN201310298870 A CN 201310298870A CN 104293896 B CN104293896 B CN 104293896B
- Authority
- CN
- China
- Prior art keywords
- pcr amplification
- primer
- snp site
- seqidno
- measured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method of SNP site genotyping.The method comprises the following steps: S1, carries out cloning and sequencing and multiple ratio pair, determine SNP site to be measured to the DNA sequence dna of target area; S2, for SNP site design pcr amplification primer, the corresponding SNP site to be measured of 3 ˊ ends of the forward primer in pcr amplification primer or reverse primer, carries out LNA modification by the Nucleotide on 3 ˊ ends of SNP site to be measured for correspondence; S3, adopts pcr amplification primer to treat test sample DNA originally and increases, and determine the SNP site genotype of sample to be tested according to the presence or absence of object band in amplified production.Apply technical scheme of the present invention, lock nucleic acid primer is adopted to carry out pcr amplification to determine the genotype of SNP site, not only increase accuracy and the reliability of detected result, and drastically increase the handiness of experiment, simplify complementary conditions and significantly reduce experimental cost.
Description
Technical field
The present invention relates to technical field of molecular biology, in particular to a kind of method of SNP site genotyping.
Background technology
Lock nucleic acid (Lockednucleicacid, LNA) refers to and the class RNA derivative that 2'-O and the 4'-C on nucleotide sugar ring is connected by methylene bridge can match with DNA or RNA according to general basepairing rule.This bridged linkage adds the stability of nucleic acid backbone, improves annealing temperature, enhances the specificity of base pairing, greatly reduces the probability that mispairing occurs.Therefore lock nucleic acid and be widely used (Braasch in many fields such as gene chip, RNA interference, D.A.andD.R.Corey, Lockednucleicacid (LNA): fine-tuningtherecognitionofDNAandRNA.Chemistry & biology, 2001.8 (1): p.1-7.).
In theory, polymerase chain reaction (PolymeraseChainReaction, PCR) to carry out smoothly be correctly be paired into prerequisite with template strand and primer strand according to basepairing rule.So, in the region comprising base difference, design the PCR primer that a group is only had single base difference, utilize common PCR amplification instrument, increase, detect and whether have the amplified production meeting design fragment length to produce, the base type of target area target site can be judged.But when using Standard PCR primer, even if there is the mispairing of single base, PCR reaction also can normally be carried out sometimes, obtains the amplified production identical with object fragment length.When thus using custom primer to carry out pcr amplification somatotype, cannot false positive results be got rid of, and then the genotyping result of mistake may be obtained.
At present, conventional SNP site genotype detection method mainly contains sequencing, chip method and mass spectroscopy etc., wherein sequencing price comparison is expensive, and chip method and mass spectroscopy only have measure at the same time multiple site or research large group sample time comparatively have superiority, and all using relevant large-scale instrument platform as support, multiple limitation must be there is in these three kinds of methods.
Summary of the invention
The present invention aims to provide a kind of method of SNP site genotyping, to solve high or complicated, the expensive technical problem of SNP site genotyping technology false positive in prior art.
To achieve these goals, according to an aspect of the present invention, a kind of method of SNP site genotyping is provided.The method comprises the following steps: S1, carries out cloning and sequencing and multiple ratio pair, determine SNP site to be measured to the DNA sequence dna of target area; S2, for SNP site design pcr amplification primer, the corresponding SNP site to be measured of 3' end of the forward primer in pcr amplification primer or reverse primer, carries out LNA modification to the Nucleotide on the 3' end of correspondence SNP site to be measured; S3, adopts pcr amplification primer to treat test sample DNA originally and increases, and determine the SNP site genotype of sample to be tested according to the presence or absence of object band in amplified production.
Preferably, it is carry out under the best pcr amplification condition obtained by gradient experiment and reaction system that the DNA adopting pcr amplification primer to treat test sample basis in step S3 carries out increasing.
Preferably, in pcr amplification primer and primer 3' end that template hybridizes affine degree high carry out LNA modification.
Preferably, the forward primer in pcr amplification primer or the 3' end of the reverse primer individual or corresponding SNP site to be measured of penultimate nucleotide last.
Preferably, sample to be tested is Cortex Populi Tomentosae, and SNP site to be measured is positioned on Cellulose-synthase gene 5, and the base sequence of pcr amplification primer is SEQIDNO:1, SEQIDNO:2 and SEQIDNO:3; Last Nucleotide on the 3' end of SEQIDNO:1 and SEQIDNO:2 carries out LNA modification.
Preferably, sample to be tested is Cortex Populi Tomentosae, and SNP site to be measured is positioned on Cellulose-synthase gene 5, and the base sequence of pcr amplification primer is SEQIDNO:4, SEQIDNO:5 and SEQIDNO:6; Last Nucleotide on the 3' end of SEQIDNO:5 and SEQIDNO:6 carries out LNA modification.
Preferably, sample to be tested is Cortex Populi Tomentosae, and SNP site to be measured is positioned on Cellulose-synthase gene 8, and the base sequence of pcr amplification primer is SEQIDNO:7, SEQIDNO:8 and SEQIDNO:9; Penultimate nucleotide on the 3' end of SEQIDNO:8 and SEQIDNO:9 carries out LNA modification.
Preferably, the condition of pcr amplification is: denaturation 95 DEG C of 5min, sex change 95 DEG C of 30s, and anneal 58 ~ 65 DEG C of 30s or 20s, extends 72 DEG C of 1min, 30 circulations, finally extends 72 DEG C of 10min.
Preferably, the system of pcr amplification is: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10 × PCRbuffer and 50ng forward primer and 50ng reverse primer, make up water to 25 μ l.
Due to the existence of mismatching phenomenon, common pcr amplification primer and template DNA chain cannot carry out combining right-on hybridization, also just mean the nucleotide type that cannot be judged target site by the presence or absence detecting pcr amplification product.In order to solve this technical problem, the technique means that application lock nucleic acid is modified, single base difference Nucleotide in primer sets is modified, under the annealing temperature and PCR reaction conditions of the best, the specificity of pcr amplification primer and the set of template DNA chain can be improved significantly, make its right-on basepairing rule of following carry out pcr amplification, to be reached through the presence or absence of detection amplified production to judge the object of target site nucleotide type, realize the genotyping of SNP site to be detected.That is, apply technical scheme of the present invention, adopt lock nucleic acid primer to carry out pcr amplification to determine the genotype of SNP site, not only increase accuracy and the reliability of detected result, and drastically increase the handiness of experiment, simplify complementary conditions and significantly reduce experimental cost.
Accompanying drawing explanation
The Figure of description forming a application's part is used to provide a further understanding of the present invention, and schematic description and description of the present invention, for explaining the present invention, does not form inappropriate limitation of the present invention.In the accompanying drawings:
Fig. 1 shows annealing temperature gradient pcr amplification product electrophoresis result figure in embodiment 1, G: the pcr amplification product point sample swimming lane using forward primer C5SNP1GF and reverse primer C5SNP1R, T: the pcr amplification product point sample swimming lane using forward primer C5SNP1TF and reverse primer C5SNP1R.
Embodiment
It should be noted that, when not conflicting, the embodiment in the application and the feature in embodiment can combine mutually.Below with reference to the accompanying drawings and describe the present invention in detail in conjunction with the embodiments.
For high or complicated, the expensive technical problem of SNP site genotyping technology false positive in prior art, the present inventor utilizes the improved properties of lock nucleic acid SNP site genotyping method, to the primer in primer sets, only replace corresponding common nucleotides in difference site to lock nucleic acid accordingly, synthesize special lock nucleic acid primer, carry out pcr amplification, whether there is the genotype type inferring difference site with testing goal long fragment, obtain believable SNP genotype call results.
According to a kind of typical embodiment of the present invention, provide a kind of method of SNP site genotyping.The method comprises the following steps: S1, carries out cloning and sequencing and multiple ratio pair, determine SNP site to be measured to the DNA sequence dna of target area; S2, for SNP site design pcr amplification primer, the corresponding SNP site to be measured of 3' end of the forward primer in pcr amplification primer or reverse primer, the Nucleotide on the 3' end of corresponding SNP site to be measured carries out LNA modification; S3, adopts pcr amplification primer to treat test sample DNA originally and increases, and determine the SNP site genotype of sample to be tested according to the presence or absence of object band in amplified production.
Technical scheme of the present invention, the genotype detection of the SNP site of the individuality such as plant and microorganism or colony can be directly applied to, and theoretical method is clear, Research Group site quantity is not limit, and experimental design is flexible, and required equipment is simple, operation is easy to grasp, process is convenient and swift, and result is accurately reliable, and price advantage is obvious.
In a kind of exemplary embodiment of the present invention, above-mentioned steps S2 specifically comprises, design one group of PCR primer, last of the 3' end of wherein forward primer (or reverse primer) or penultimate base and SNP site to be detected are matched, and when carrying out primer synthesis, the sugared ring of the Nucleotide at this base place is carried out lock nucleic acid bridging modification (LNA modification).Because generally there are two kinds of genotype in site to be detected, so the single base difference forward primer (or reverse primer) will synthesizing two LNA modifications is corresponding with corresponding genotype simultaneously, namely the Nucleotide only having site to be detected corresponding in primer is variant, and all the other nucleotide sequences are constant.Another reverse primer (or forward primer) can carry out design and synthesis according to conventional primer design rule, and arranging in pairs or groups as general primer and forward primer (or reverse primer) uses.Because the position of carrying out that primer of LNA modification is relatively fixing, thus determine to forward primer still to reverse primer carry out LNA modify time, can with reference to design of primers rule, to select the most easily and DNA chain is hybridized the primer combined and carried out LNA modification.Can have three primers in one group of primer: single base difference forward primer (or reverse primer) that two LNA modify, a shared conventional reverse primer (or forward primer), can amplify at most the object band that two length is equal.Certainly, if SNP site has Multi-genotype, the design of primer also increases thereupon.
Preferably, it is carry out under the best pcr amplification condition obtained by gradient experiment and reaction system that the DNA adopting pcr amplification primer to treat test sample basis in step S3 carries out increasing, and can improve the accuracy of genotype detection like this.
In actually operating, due to discovery and when determining candidate SNP locus, the loci gene type type to be detected of some individuals is clear and definite, so the DNA of several individuality can be selected wherein, as the template DNA of gradient experiment test pcr amplification, better find out best pcr amplification condition and reaction system.
Pcr amplification primer pair template DNA is used to carry out annealing temperature gradient pcr amplification, whole primer pair and whole template DNA are arranged in pairs or groups between two, formed one " reaction combination ", use identical annealing temperature, wherein each collocation (comprise two similar pcr amplification) is one " reaction member ".Annealing temperature gradient quantity is identical with " react and combine " quantity.Temperature range really normal root is slightly different according to the difference of PCR amplification instrument.Its rule followed be the annealing temperature of the non-LNA Mdification primer of answering with this group primer pair for minimum temperature, be upwards that a unit increases progressively step by step with 0.5 DEG C or 1 DEG C, the upper limit is generally no more than 72 DEG C.Other PCR reaction conditions is temporarily set as the condition that Standard PCR reacts, and adjusts when amplification is undesirable again.
Amplified production is carried out agarose gel electrophoresis detection, two amplified productions of each " reaction member " carry out point sample at adjacent swimming lane, with facilitate follow-up luminance factor comparatively and result add up, the reaction having object band to produce represents this LNA Mdification primer successful matching, namely represents that the base type corresponding to it exists; Do not have object band to produce, namely represent that the base type corresponding to it does not exist.One " reaction member " (namely using one group of primer) can determine the genotype in a site to be detected.Wherein, the object band of two same brightness is had to occur representing that this site is heterozygous, article one, there is clear bright object band in swimming lane and in another swimming lane, do not occur that object band represents that this site is homozygous, and can determine that aobvious recessiveness is isozygotied type according to the position at object band place.
If whole annealing temperature gradient pcr amplification product electrophoresis result is all undesirable, particularly there is jumping characteristic in the electrophoresis result of homozygous gene type, the optimum of " a bright nothing " cannot be produced, now should reduce annealing temperature gradient scope, design temperature gradient around the annealing temperature corresponding to flex point result, and suitably reduce unit change temperature, re-start annealing temperature gradient pcr amplification, until determine optimum annealing temperature.In some cases, reduce range of temperature and reduce unit change temperature, still can not get best result, when annealing temperature is lower, in the amplified production of homozygous genotype corresponding " reflection unit ", there will be the band (appearance of filaments of sun band can disturb the statistics of result) of light and dark two entry, and in " reaction member " of adjacent higher anneal temperature, the band of two entries does not all occur (showing that annealing temperature is too high).Now, the measure shortened the annealing steps time and (or) reduce pcr amplification cycle number can be taked, re-start annealing temperature gradient pcr amplification, until determine optimum annealing temperature.If best pcr amplification condition still cannot be determined according to amplification, just on the pcr amplification conditioned basic of result relative ideal, SSR-PCR optimization (reducing reagent and DNA profiling concentration), uses touchdownPCR, and increases warm start step etc.
According to the typical embodiment of the present invention one, in pcr amplification primer and primer 3' end that template hybridizes affine degree high carry out LNA modification, to improve the specificity that primer is combined with template, make it correctly carry out hybridization according to basepairing rule and increase.Preferably, the forward primer in pcr amplification primer or the 3' end of the reverse primer individual or corresponding SNP site to be measured of penultimate nucleotide last.
According to the typical embodiment of the present invention one, sample to be tested is Cortex Populi Tomentosae, SNP site to be measured is positioned on Cellulose-synthase gene 5, the base sequence of pcr amplification primer is SEQIDNO:1(C5SNP1TF:5'-CGTCTTTCTCACTACCTCCTT-3'), SEQIDNO:2(C5SNP1GF:5'-GTCTTTCTCACTACCTCCTG-3') and SEQIDNO:3(C5SNP1R:5'-AGCTTCTCTCTAACTCTCCACTT-3').Last Nucleotide on the 3' end of SEQIDNO:1 and SEQIDNO:2 carries out LNA modification.The condition of pcr amplification is: denaturation 95 DEG C of 5min, sex change 95 DEG C of 30s, and anneal 62 DEG C of 30s, extends 72 DEG C of 1min, 30 circulations, finally extends 72 DEG C of 10min.The system of pcr amplification is: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10 × PCRbuffer and 50ng forward primer and 50ng reverse primer, make up water to 25 μ l.
In a kind of typical embodiment of the present invention, sample to be tested is Cortex Populi Tomentosae, SNP site to be measured is positioned on Cellulose-synthase gene 5, and the base sequence of pcr amplification primer is SEQIDNO:4(C5SNP14F:5'-GGACGAGGGGAAGATTCTG-3'), SEQIDNO:5(C5SNP14GR:5'-ACACGAGAACGAGGGATGC-3') and SEQIDNO:6(C5SNP14AR:5'-ACACGAGGACGAGGGATGT-3').Last Nucleotide on the 3' end of SEQIDNO:5 and SEQIDNO:6 carries out LNA modification.The condition of pcr amplification is: denaturation 95 DEG C of 5min, sex change 95 DEG C of 30s, and anneal 60 DEG C of 20s, extends 72 DEG C of 1min, 30 circulations, finally extends 72 DEG C of 10min.The system of pcr amplification is: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10 × PCRbuffer and 50ng forward primer and 50ng reverse primer, make up water to 25 μ l.
In a kind of typical embodiment of the present invention, sample to be tested is Cortex Populi Tomentosae, SNP site to be measured is positioned on Cellulose-synthase gene 8, and the base sequence of pcr amplification primer is SEQIDNO:7(C8SNP13R:5'-TCATGGGCTTCACCTGCGC-3'), SEQIDNO:8(C8SNP13CF:5'-GGTTGAGAGTTAGAGAAGCCG-3') and SEQIDNO:9(C8SNP13TF:5'-GGTTGAGAGTTAGAGAAGCTG-3').Penultimate nucleotide on the 3' end of SEQIDNO:8 and SEQIDNO:9 carries out LNA modification.The condition of pcr amplification is: denaturation 95 DEG C of 5min, sex change 95 DEG C of 30s, and anneal 59 DEG C of 20s, extends 72 DEG C of 1min, 30 circulations, finally extends 72 DEG C of 10min.The system of pcr amplification is: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10 × PCRbuffer and 50ng forward primer and 50ng reverse primer, make up water to 25 μ l.
Beneficial effect of the present invention is further illustrated below in conjunction with embodiment.
Embodiment 1
Use the SNP typing method of LNA Mdification primer pcr amplification, SNP1(SNP1 in Cortex Populi Tomentosae natural population Cellulose-synthase gene 5 is referred to the 23bp place of Cellulose-synthase gene 5 full length gene, the gene order of its region is as follows: ATCGTCTTTCTCACTACCTCCT
tcAATCCACACTCTCTTTCTTTCTCTGT, italic "
t" be SNP site) site carries out genotype detection.
It is individual that 460 strains in Guan County, Shandong Cortex Populi Tomentosae gene pool (national Cortex Populi Tomentosae germplasm resource bank) taken from by material.
S1, after extracting the DNA of every strain individuality, according to areal distribution, random choose 40 strain is individual, carries out cloning and sequencing one by one, determine candidate SNP locus to its Cellulose-synthase gene 5.
S2, for SNP1 site (black matrix underscore mark), whole natural population comprises the DNA profiling chain of two types, wherein template strand I:3'-GCAGAAAGAGTGATGGAGGA
anNNNNNNNNNNN-5', template strand II:3'-GCAGAAAGAGTGATGGAGGA
cnNNNNNNNNNNN-5'.Corresponding genotype is respectively T and G.The three strain individualities that Select gene type is respectively TT, TG and GG carry out annealing temperature gradient pcr amplification, to determine the best pcr amplification condition of genotype detection.
Design and synthesis two 3' terminal nucleotide LNA modify the forward primer of (3' end last Nucleotide): SEQIDNO:1(C5SNP1TF:5'-CGTCTTTCTCACTACCTCCTT-3'), SEQIDNO:2(C5SNP1GF:5'-GTCTTTCTCACTACCTCCTG-3'), a conventional reverse primer SEQIDNO:3(C5SNP1R:5'-AGCTTCTCTCTAACTCTCCACTT-3').Article two, LNA modification forward primer is arranged in pairs or groups with conventional reverse primer respectively and is used, and forms one group of primer sets.Amplified production object fragment length is 396bp.
S3, combines the genomic DNA template of three strain individualities described in S2 and the primer sets of designed synthesis respectively, carries out annealing temperature gradient pcr amplification, and annealing region is set as that, from 58 DEG C to 65 DEG C, unit change temperature is 1 DEG C.Other reaction conditions is: denaturation 95 DEG C of 5min, sex change 95 DEG C of 30s, and annealing 30s, extends 72 DEG C of 1min, 30 circulations, finally extends 72 DEG C of 10min, 10 DEG C of preservations.25 μ l reaction systems comprise: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10xPCRbuffer and 50ng forward primer and 50ng reverse primer.
The product of annealing temperature gradient pcr amplification is carried out agarose gel electrophoresis detection, and every two swimming lanes detect the genotype of a strain individuality, result the best (as shown in Figure 1) when wherein annealing temperature is 62 DEG C.In Fig. 1 above loading wells, letter G represents that this swimming lane is the pcr amplification product point sample swimming lane using forward primer C5SNP1GF and reverse primer C5SNP1R, tee represents that this swimming lane is the pcr amplification product point sample swimming lane using forward primer C5SNP1TF and reverse primer C5SNP1R, and the rightmost side is DL2000Marker.According to the presence or absence of object fragment, can determine that the genotype of three strain individualities is respectively GG, GT and TT, consistent with known results.Using 62 DEG C as optimum annealing temperature, and in conjunction with other reaction conditions and reaction system described in 5, the method for standard PCR amplification can be adopted, use LNA Mdification primer group described in 4, whole Cortex Populi Tomentosae natural population is carried out to the genotype detection in SNP1 site.
Taking from the Cortex Populi Tomentosae gene pool of Guan County, Shandong in 460 strain individualities, there are 187 strain idiotypes to be GT, have 229 strain idiotypes to be TT, having 44 strain idiotypes to be GG.
Embodiment 2
Use the SNP typing method of LNA Mdification primer pcr amplification, be the 977bp place of Cellulose-synthase gene 5 full length gene to the SNP14(SNP14 in Cortex Populi Tomentosae natural population Cellulose-synthase gene 5 in embodiment 1, the gene order of its region is as follows: CATAGGCTCAAAAGCATTGTCTCCCT
atATGCTCTATTCAATGTCAGAAA, italic "
a" be SNP) site carries out genotype detection.
Experiment material and step reference implementation example 1.
According to the sequence characteristic of site to be detected and DNA profiling chain, design and synthesis conventional forward primer: SEQIDNO:4(C5SNP14F:5'-GGACGAGGGGAAGATTCTG-3'), article two, 3' terminal nucleotide LNA modifies the reverse primer of (3' end last Nucleotide): SEQIDNO:5(C5SNP14GR:5'-ACACGAGAACGAGGGATGC-3'), SEQIDNO:6(C5SNP14AR:5'-ACACGAGGACGAGGGATGT-3'), genotype G and A is detected respectively.Amplified production object fragment length is 304bp.
By annealing temperature gradient pcr amplification, determine that optimum annealing temperature is 60 DEG C, the annealing steps time is 20s, and other condition is consistent with reaction conditions in embodiment 1 and reaction system.
To the SNP14 loci gene type detected result in Cortex Populi Tomentosae natural population Cellulose-synthase gene 5 be: have 347 strain idiotypes to be AG, have 89 strain idiotypes to be AA have 24 strain idiotypes to be GG.
Embodiment 3
Use the SNP typing method of LNA Mdification primer pcr amplification, be the 546bp place of Cellulose-synthase gene 8 full length gene to the SNP13(SNP13 in Cortex Populi Tomentosae natural population Cellulose-synthase gene 8 in embodiment 1, the gene order of its region is as follows: GATAAGAGGTTGCTTCTGAGGTTGAGAGTTAGAGAAGC
tgACGCTTCGATGCTCTCTGTATGATTAGGG, italic "
t" be SNP) site carries out genotype detection.
Experiment material and step reference implementation example 1.
According to the sequence characteristic of site to be detected and DNA profiling chain, design and synthesis conventional reverse primer: SEQIDNO:7(C8SNP13R:5'-TCATGGGCTTCACCTGCGC-3'), article two, 3' terminal nucleotide LNA modifies the forward primer of (3' end penultimate nucleotide): SEQIDNO:8(C8SNP13CF:5'-GGTTGAGAGTTAGAGAAGCCG-3'), SEQIDNO:9(C8SNP13TF:5'-GGTTGAGAGTTAGAGAAGCTG-3'), genotype C and T is detected respectively.Amplified production object fragment length is 390bp.
By annealing temperature gradient pcr amplification, determine that optimum annealing temperature is 59 DEG C, the annealing steps time is 20s, and other condition is consistent with reaction conditions in embodiment 1 and reaction system.
To the SNP13 loci gene type detected result in Cortex Populi Tomentosae natural population Cellulose-synthase gene 8 be: have 237 strain idiotypes to be CT, have 136 strain idiotypes to be CC have 107 strain idiotypes to be TT.
From above description, can find out, technical scheme of the present invention: first, design one group of forward and reverse PCR primer, SNP site to be detected is matched to the 3' end (last or penultimate base) of the forward primer in primer or reverse primer therewith, and this 3' terminal nucleotide lock nucleic acid is replaced (modification of lock nucleic acid bridging).Then, using this to lock nucleic acid primer, to having determined in institute's Research Group that the individuality of loci gene type to be detected carries out annealing temperature gradient PCR, and determining other PCR reaction conditions and the reaction systems such as annealing temperature, annealing time, cycle number.Then the reaction conditions consistent with known type result is selected to carry out pcr amplification to whole colony, finally by agarose gel electrophoresis inspection and statistics, to determine the genotype type of all individualities in colony.
Apply technical scheme of the present invention, lock nucleic acid primer is adopted to carry out pcr amplification to determine the genotype of SNP site, not only increase accuracy and the reliability of detected result, and drastically increase the handiness of experiment, simplify complementary conditions and significantly reduce experimental cost.
The foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, for a person skilled in the art, the present invention can have various modifications and variations.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (4)
1. a method for SNP site genotyping, is characterized in that, comprises the following steps:
S1, carries out cloning and sequencing and multiple ratio pair to the DNA sequence dna of target area, determines SNP site to be measured;
S2, for described SNP site design pcr amplification primer, the corresponding described SNP site to be measured of 3' end of the forward primer in described pcr amplification primer or reverse primer, carries out LNA modification by the Nucleotide on the described 3' end of described for correspondence SNP site to be measured;
S3, adopts described pcr amplification primer to treat test sample DNA originally and increases, and determine the SNP site genotype of described sample to be tested according to the presence or absence of object band in amplified production;
Described sample to be tested is Cortex Populi Tomentosae, described SNP site to be measured is positioned on Cellulose-synthase gene 5, the base sequence of described pcr amplification primer is SEQIDNO:1, SEQIDNO:2 and SEQIDNO:3, and last Nucleotide on the 3' end of described SEQIDNO:1 and SEQIDNO:2 carries out LNA modification.
2. method according to claim 1, is characterized in that, it is carry out under the best pcr amplification condition obtained by gradient experiment and reaction system that the DNA adopting described pcr amplification primer to treat test sample basis in described step S3 carries out increasing.
3. method according to claim 1, is characterized in that, the condition of described pcr amplification is: denaturation 95 DEG C of 5min, sex change 95 DEG C of 30s, and anneal 58 ~ 65 DEG C of 30s or 20s, extends 72 DEG C of 1min, 30 circulations, finally extends 72 DEG C of 10min.
4. method according to claim 1, is characterized in that, the system of described pcr amplification is: 20ng genomic dna, 0.8UTaq enzyme, 0.2mMdNTPs, 10 × PCRbuffer and 50ng forward primer and 50ng reverse primer, make up water to 25 μ l.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510869867.5A CN105331729B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
| CN201310298870.7A CN104293896B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
| CN201510869105.5A CN105331728B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310298870.7A CN104293896B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510869105.5A Division CN105331728B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
| CN201510869867.5A Division CN105331729B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293896A CN104293896A (en) | 2015-01-21 |
| CN104293896B true CN104293896B (en) | 2016-03-16 |
Family
ID=52313844
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510869867.5A Active CN105331729B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
| CN201310298870.7A Active CN104293896B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
| CN201510869105.5A Active CN105331728B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510869867.5A Active CN105331729B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510869105.5A Active CN105331728B (en) | 2013-07-16 | 2013-07-16 | The method of SNP site genotyping |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN105331729B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755408B (en) * | 2016-12-22 | 2020-10-13 | 北京林业大学 | Plant allele imbalance expression detection method |
| CN107841548A (en) * | 2017-04-20 | 2018-03-27 | 上海生物芯片有限公司 | Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms |
-
2013
- 2013-07-16 CN CN201510869867.5A patent/CN105331729B/en active Active
- 2013-07-16 CN CN201310298870.7A patent/CN104293896B/en active Active
- 2013-07-16 CN CN201510869105.5A patent/CN105331728B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293896A (en) | 2015-01-21 |
| CN105331728A (en) | 2016-02-17 |
| CN105331728B (en) | 2019-01-11 |
| CN105331729B (en) | 2019-01-11 |
| CN105331729A (en) | 2016-02-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3789506B1 (en) | Prunus mume pendulous trait snp molecular markers and use thereof | |
| CN106282394B (en) | Method for high-throughput detection of southern rust resistance genotyping of corn and kit thereof | |
| CN106048042B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits color traits | |
| CN104073487A (en) | Molecular marker of rice-blast-resistant gene Pi2 and application of molecular marker | |
| CN105331715B (en) | For detecting the primer of cherry SSR marker | |
| CN109055598B (en) | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof | |
| CN109762812A (en) | Wheat growth gesture related SNP and its as target spot identification wheat growth gesture character in application | |
| CN106381343B (en) | One kind molecular labeling TaSnRK2.3A relevant to thousand grain weight of wheat and plant height and its application | |
| CN104293896B (en) | The method of SNP site genotyping | |
| CN109234423A (en) | The application of soybean molecular labeling and its polymorphism in identification soybean branch amount character | |
| CN111961753B (en) | SNP (Single nucleotide polymorphism) marker related to resistance gene of pepper and tomato leaf blight virus, and specific primer and application thereof | |
| Schramm et al. | Development of single nucleotide polymorphism (SNP) markers for cereal breeding and crop research: current methods and future prospects | |
| CN110283929B (en) | SNP (single nucleotide polymorphism) marker 5-160 related to pepper phytophthora blight resistance gene as well as specific primer and application thereof | |
| CN106755355B (en) | One kind molecular labeling TaSnRK2.3B relevant to thousand grain weight of wheat and stalk soluble sugar content and its application | |
| Zhao et al. | Genetic diversity estimation and core collection construction of Sinojackia huangmeiensis based on novel microsatellite markers | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| KR101630814B1 (en) | SNP molecular markers associated with distinction of grape understock variety and uses thereof | |
| CN106755408B (en) | Plant allele imbalance expression detection method | |
| KR101581388B1 (en) | Probe for detecting polymorphism, method of detecting polymorphism, method of evaluating drug efficacy and reagent kit for detecting polymorphism | |
| CN110317897B (en) | SNP marker 5-162 related to pepper phytophthora blight resistance gene and specific primer and application thereof | |
| CN108570509B (en) | Detection method of EC16SNP marker of exopalaemon carinicauda | |
| Yang et al. | Limitation of high-resolution melting curve analysis for genotyping simple sequence repeats in sheep | |
| CN105779570A (en) | Method for detecting SNP sites |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |