CN107841548A - Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms - Google Patents
Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms Download PDFInfo
- Publication number
- CN107841548A CN107841548A CN201710259900.1A CN201710259900A CN107841548A CN 107841548 A CN107841548 A CN 107841548A CN 201710259900 A CN201710259900 A CN 201710259900A CN 107841548 A CN107841548 A CN 107841548A
- Authority
- CN
- China
- Prior art keywords
- genotype
- sequence
- pipes
- seq
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of method based on ARMS PCR detection people's mthfr gene polymorphisms, step includes：1) sample DNA is extracted；2) using DNA obtained by step 1) as template, in four reaction tubes, respectively for mthfr gene two SNP sites four kinds of allele, progress real-time fluorescence quantitative PCR reaction；3) according to the genotype of Ct value judgement sample two SNP sites of mthfr gene.The invention also discloses the people's mthfr gene SNP detection primers group and kit for the above method.Two SNP sites design specific primer of the present invention for mthfr gene, and in the end mark of specific primer 3 ' LNA, realize the specific detection of two SNP site genotype on mthfr gene, compared with existing mthfr gene pleiomorphism detecting method, method of the invention has quick, accurate, high sensitivity, low cost and other advantages.
Description
Technical field
The present invention relates to field of biological detection, is the detection for being related to people's mthfr gene polymorphism specifically.
Background technology
Folic acid is particularly important methyl donor in vivo, participates in DNA synthesis and repairs, maintain intracellular normal methyl groupization and
Genome stability.The enzyme for participating in folic acid metabolism mainly has 5,10- methylenetetrahydrofolate reductases (5,10-
Methylenetetrahydrofolate reductase, MTHFR), methionine synthetase reductase (5-
Methyltetrahydrofolate-homocysteine methyltransferase reductase, MTRR) and first sulphur ammonia
Acid enzyme (5-methyltetrahydrofolate-homocysteine methyltransferase, MTR), etc..Folic acid
Some enzyme gene Mutations may influence folate level in circulation in metabolic pathway.Folic acid metabolism enzyme related genes variants draw
The corresponding enzymatic activity risen, which reduces, to prevent homocysteine to be converted into methionine, cause low folic acid mass formed by blood stasis and high homotype half
Cystine mass formed by blood stasis.On the one hand, MTHFR is catalyzed the methyl group of the 5-methyltetrahydrofolate of 5,10-CH2-THFA generation
Methionine is generated, then methionine is transformed into S-adenosylmethionine in the presence of adenylase, and S- adenosine first
Methyllanthionine is methyl donor general in vivo.On the other hand, the substrate 5,10-CH2-THFA of MTHFR catalytic reactions with
Thymidine and purine synthesis etc. multiple metabolic pathways it is relevant, for DNA synthesis have extremely important effect.
The mutation of folic acid metabolism enzyme can directly result in DNA synthesis and repair produce obstacle, intracellular aberrant methylation and
Genome it is unstable, turn into a major reason of tumour occurrence and development, and the weight of related neoplasms medication (such as 5-FU)
Will foundation.Meanwhile the polymorphism of folic acid metabolism enzyme also influences absorption of the pregnant woman to folic acid, the detection of related gene can be reduced effectively
Newborn Birth-defects risk, reduce parent and suffer from pregnant woman's macrocytic anemia, cardiovascular and cerebrovascular disease, malignant tumour, gestation height
The risk of the Pregnancy Complications such as blood pressure, pre-eclampsia, and prevent fetus and produce embryo NTD, harelip, congenital
The diseases such as heart malformations.
Research confirms that being metabolized closely related gene with methyl biostearin (folic acid and vitamin B12) mainly has
MTHFR, MTRR and MTR etc., wherein MTHFR play more crucial effect during folic acid metabolism.Mthfr gene is located at people
On class No.1 chromosome 1p36.3, full-length genome 15.8kb, including 11 extrons and 10 intrones, entirely encode the head of district
1980bp.MTHFR is the key enzyme during folic acid metabolism, 5,10-MTHF can be transformed into 5-MTHF, so as to participate in methionine
Metabolic cycles and DNA's methylates.Two common SNP sites, respectively C677T are primarily present on mthfr gene
And A1298C (rs1801131) (rs1801133).Mthfr gene C677T sites are the 677th nucleotide cytosines (C) by chest
Gland pyrimidine (T) is replaced, and causes the 222nd amino acids of enzyme to become valine by alanine, so as to influence MTHFR activity, is led
Cause enzymatic activity and heat endurance to decline, while change the metabolism of cysteine.If rs1801133C/C genotype is carried with individual
When its MTHFR activity be 100%, carry T/C genotype activity then be C/C 71%, genotype for T/T types only
34%.Thus, there is very big difference in Different Individual, in the demand of the folic acid in pregnancy period if the individual of genotype position T/T types
Need the folic acid more one times compared with normal individual supplement.In addition, the polymorphism in mthfr gene C677T sites and lung cancer, stomach cancer, knot
The neurological susceptibility of the Several Kinds of Malignancy such as the carcinoma of the rectum, liver cancer, nasopharyngeal carcinoma is related.Clinically, mthfr gene C677T sites is more
State property detection has been widely accepted.Research shows, mthfr gene C677T polymorphism can influence folic acid concentration and its intracellular
Distribution, simultaneously influence tumour cell growth and the sensitiveness to chemotherapy.In addition, mthfr gene C677T also with brain soldier
In, the generation of the disease such as congenital heart disease, hyperlipemia, NTD, habitual abortion it is related.Research finds, MTHFR
The polymorphism in Gene A 1298G (also known as rs1801131) site is to influence another active key factor of the enzyme.MTHFR bases
Because A1298C sites are that the 1298th nucleotides adenine (A) is replaced by cytimidine (C), and influence the activity of enzyme.Carry
The enzymatic activity of the gene of rs1801131 saltant types is 68% or so of wild type, makes the horizontal rises of internal 5,10-MTHF, thus
Folic acid metabolism is hindered, causes a series of disease incidence risk increases.Have similarly for pregnancy period physical examination and tumour personalized medicine
There is important directive significance.
Lock nucleic acid (Locked nucleic acid, LNA) is a kind of class oligonucleotide derivative, β-D- furans in structure
2'-O, 4'-C position of ribose act on forming rigid structure by shrink.Compared with traditional DNA probe, LNA has following excellent
Point：1) double-strand complementary with DNA, RNA has very strong heat endurance (Δ Tm=3~8 DEG C), and observes Watson-Crick simultaneously
(Watson-Crick) base-pair principle；2) stability of 3 ' deoxynucleotide enzymes degraded is resisted；3) LNA-DNA hybrids
RNase H can be activated；4) good water solubility, cell membrane is freely passed into, is easily absorbed by organisms；5) it is free of toxic effects in vivo；6) efficiently
The effect of automatic oligomerization, synthetic method is relatively easy.
Mutation amplification system (amplification refractory mutation system, ARMS) is also known as equipotential base
Because of specific amplification method (allele specific amplification, ASA), general principle is, if 3 ' end alkali of primer
Base is not complementary with template base, then can not be extended with general hot resistant DNA polymerase.ARMS PCR have advantages below：1) test
Cycle is short；2) experimental cost is low；3) sensitivity is higher.
Mthfr gene pleiomorphism detecting method commonly used at present is TaqMan probe method and DNA direct Sequencings etc..
TaqMan probe method is to utilize Taq enzyme 3 '>5 ' exonuclease activities, probe is cut off, discharge the method for fluorescence signal.But should
Method has the following disadvantages：TaqMan probe method is with high costs, and preliminary experiment cycle early stage is longer.DNA direct Sequencings are based on double
The principle that DNA chain end terminates, obtain DNA base sequence.This method has the following disadvantages：Detection cycle is longer,
Both expensive, the operation of non-stopped pipe, it is difficult to avoid cross pollution, flux is not high.Therefore, both the above method is all difficult is applied to clinic
Detection.And there is an urgent need to develop a kind of mthfr gene polymorphism that is quick, accurate, easy to operate and avoiding cross pollution for clinic
Detection technique, meet the ageing requirement in terms of clinical application and checkout and diagnosis.
The content of the invention
One of the technical problem to be solved in the present invention is to provide one group of primer sets for being used for people's mthfr gene SNP detections, it
It can be used for polymorphism that is quick, accurate, delicately detecting people's mthfr gene.
In order to solve the above technical problems, people's mthfr gene SNP detection primer groups of the present invention, for detecting people's MTHFR bases
Because of upper No. rs1801133 and the genotype of rs1801131 SNP sites, the primer sets include being used to detect the rs1801133
The primer of the primer pair of the C/C genotype of number SNP site, the T/T genotype for detecting the rs1801133 SNP sites
To, the primer pair of A/A genotype for detecting the rs1801131 SNP sites, for detecting described No. rs1801131
The primer pair of the C/C genotype of SNP site；Wherein,
The primer pair for being used to detect the C/C genotype of rs1801133 SNP sites has and SEQ ID NO:1 institute
Show the identical upstream sequence of sequence more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 3；
The primer pair for being used to detect the T/T genotype of rs1801133 SNP sites has and SEQ ID NO:2 institutes
Show the identical upstream sequence of sequence more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 3；
The primer pair for being used to detect the A/A genotype of rs1801131 SNP sites has and SEQ ID NO:4 institutes
Show the identical upstream sequence of sequence more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 6；
The primer pair for being used to detect the C/C genotype of rs1801131 SNP sites has and SEQ ID NO:5 institutes
Show the identical upstream sequence of sequence more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 6.
Preferably, the upstream sequence for detecting the primer pair of the C/C genotype of rs1801133 SNP sites is such as
SEQ ID NO:Shown in 1, downstream sequence such as SEQ ID NO:Shown in 3；The T/T for being used to detect rs1801133 SNP sites
The upstream sequence of the primer pair of genotype such as SEQ ID NO:Shown in 2, downstream sequence such as SEQ ID NO:Shown in 3；It is described to be used for
Detect the upstream sequence such as SEQ ID NO of the primer pair of the A/A genotype of rs1801131 SNP sites:Shown in 4, downstream sequence
Such as SEQ ID NO:Shown in 6；The upstream sequence for being used to detect the primer pair of the C/C genotype of rs1801131 SNP sites
Such as SEQ ID NO:Shown in 5, downstream sequence such as SEQ ID NO:Shown in 6.
Preferably, last kilobase marker at 3 ' ends of the upstream sequence has LNA modifications.
The second technical problem to be solved by the present invention is to provide a kind of based on ARMS-PCR detection people's mthfr gene polymorphisms
PCR reaction kits.
In order to solve the above technical problems, the PCR reactions based on ARMS-PCR detection people's mthfr gene polymorphisms of the present invention
Kit, include foregoing people's mthfr gene SNP detection primer groups.
Primer concentration in the PCR reaction kits is 0.1~0.5 μM.
Also comprising rs1801133 SNP site C/C type plasmids on someone's mthfr gene in the PCR reaction kits
Standard items, the standard items of rs1801133 SNP site T/T type plasmids, the standard of rs1801131 SNP site A/A type plasmids
The standard items of product, rs1801131 SNP site C/C type plasmids.
PCR reactant mixture SYBR Master Mix, the SYBR can also be included in the PCR reaction kits
Master Mix include PCR reaction buffer TrisHCl, dNTP, SYBR fluorescent dye, taqDNA polymerases, potassium chloride,
Ammonium sulfate, magnesium chloride etc.；The pH value of the SYBR Master Mix is between 8.0~9.0.
The third technical problem to be solved by the present invention is to provide a kind of based on ARMS-PCR detection people's mthfr gene polymorphisms
Method, the method comprising the steps of：
1) extract sample DNA and purify；
2) using DNA obtained by step 1) as template, it is in A, B, C, D four PCR reaction tubes in numbering, while carry out in real time
Fluorescent quantitative PCR is reacted；Wherein：
The above-mentioned primer pair for being used to detect the C/C genotype of the rs1801133 SNP sites is added in A pipes；
The above-mentioned primer pair for being used to detect the T/T genotype of the rs1801133 SNP sites is added in B pipes；
The above-mentioned primer pair for being used to detect the A/A genotype of the rs1801131 SNP sites is added in C pipes；
The above-mentioned primer pair for being used to detect the C/C genotype of the rs1801131 SNP sites is added in D pipes；
3) according to the base of No. rs1801133 of Ct value judgement sample mthfr genes and No. rs1801131 two SNP site
Because of type.
Step 1), the DNA extract from the cast of peripheral blood cells, tissue, body fluid or cavity, and DNA after purification is dense
Spend for 0.5~20ng/ μ L.
Step 2), PCR reaction conditions are 92~97 DEG C of 0.5~10min of pre-degeneration；92~97 DEG C denaturation 10~30s, 56~
60 DEG C of 10~60s of annealing, 40~50 circulations.
Step 3), the determination methods of genotype are：During Ct values >=36, it is judged to not express；Ct values ＜ 36, is judged to express；Work as A
Expressed in pipe, when not expressed in B pipes, judge rs1801133 genotype for C/C types；Express when in A pipes, expressed simultaneously in B pipes
When, judge rs1801133 genotype for T/C types；When not expressed in A pipes, when being expressed in B pipes, rs1801133 gene is judged
Type is T/T types；Expressed when in C pipes, when not expressed in D pipes, judge rs1801131 genotype for A/A types；Expressed when in C pipes,
When being expressed in D pipes simultaneously, judge rs1801131 genotype for A/C types；When not expressed in C pipes, when being expressed in D pipes, judge
Rs1801131 genotype is C/C types.
The present invention is with the C/C types and T/T type matter of people's mthfr gene rs1801133 SNP sites of genetic engineering structure
Grain, and the A/A types of rs1801131 SNP sites and C/C types plasmid are template, for No. rs1801133 and No. rs1801131
Two SNP sites design specific primers, and in last kilobase marker LNA at 3 ' ends of specific primer, realize
The specifically detection of the genotype of No. rs1801133 and rs1801131 SNP sites on mthfr gene.With existing MTHFR
Gene pleiomorphism detecting method is compared, the method have the advantages that and beneficial effect：
(1) genotype of 2 SNP sites of mthfr gene can be detected simultaneously, and easy to detect quick, accuracy is high；
(2) sensitivity and selective enumeration method ability are above traditional sequencing methods, 1ng genomic DNAs can detection base
Because of type, and testing result is coincide with the testing result 100% obtained according to traditional sequencing methods；
(3) simple to operate, detection speed is fast, and detection process only needs to complete for 90 minutes；
(4) testing cost is low.
Brief description of the drawings
Fig. 1 is that the embodiment of the present invention detects rs1801133 sites C/C type PCR amplification figures.
Fig. 2 is that the embodiment of the present invention detects rs1801133 sites C/C type solubility curves.
Fig. 3 is that the embodiment of the present invention detects rs1801133 sites T/C type PCR amplification figures.
Fig. 4 is that the embodiment of the present invention detects rs1801133 sites T/C type solubility curves.
Fig. 5 is that the embodiment of the present invention detects rs1801133 sites T/T type PCR amplification figures.
Fig. 6 is that the embodiment of the present invention detects rs1801133 sites T/T type solubility curves.
Fig. 7 is that the embodiment of the present invention detects rs1801133 sites negative control PCR amplification figures.
Fig. 8 is that the embodiment of the present invention detects rs1801133 sites negative control solubility curve.
Fig. 9 is that the embodiment of the present invention detects rs1801133 site sensitivity analysis result of the test PCR amplification figure (genes
Group DNA 1ng).
Figure 10 is that the embodiment of the present invention detects rs1801133 site sensitivity analysis result of the test solubility curves.(gene
Group DNA 1ng).
Figure 11 is that the embodiment of the present invention detects rs1801131 sites A/A type PCR amplification figures.
Figure 12 is that the embodiment of the present invention detects rs1801131 sites A/A type solubility curves.
Figure 13 is that the embodiment of the present invention detects rs1801131 sites A/C type PCR amplification figures.
Figure 14 is that the embodiment of the present invention detects rs1801131 sites A/C type solubility curves.
Figure 15 is that the embodiment of the present invention detects rs1801131 sites C/C type PCR amplification figures.
Figure 16 is that the embodiment of the present invention detects rs1801131 sites C/C type solubility curves.
Figure 17 is that the embodiment of the present invention detects rs1801131 sites negative control PCR amplification figures.
Figure 18 is that the embodiment of the present invention detects rs1801131 sites negative control solubility curve.
Figure 19 is that the embodiment of the present invention detects rs1801131 site sensitivity analysis result of the test PCR amplification figure (genes
Group DNA 1ng).
Figure 20 is that the embodiment of the present invention detects rs1801131 site sensitivity analysis result of the test solubility curves.(gene
Group DNA 1ng).
Embodiment
To have and more specifically understanding to technology contents, feature and effect of the present invention, in conjunction with drawings and the specific embodiments,
To the present invention, details are as follows：
The present embodiment based on ARMS-PCR detect No. rs1801133 of mthfr gene of 8 human mouth swab samples and
The method of the genotype of No. rs1801131 two SNP site, specifically comprises the following steps：
1. design and synthesize primer
No. rs1801133 and No. rs1801131 two SNP site of the people's mthfr gene announced according to ncbi database is believed
Breath, No. rs1801133 and No. rs1801131 two site upstream 20bp at least 15 in the 100bp sections of downstream is chosen respectively
Continuous nucleotides, using Primer Express 3.0.1 primer-design softwares, design detection people's mthfr gene
No. rs1801133 and 4 positive specific primers and 2 general reverse primers in rs1801131 Liang Ge mutational sites, and
LNA modifications are marked in last base at the 3' ends of all positive specific primers.
Mankind's mthfr gene rs1801133 and No. rs1801131 two SNP site information are as follows：
rs1801133：TTGAAGGAGAAGGTGTCTGCGGGAG[C/T]CGATTTCATCATCACGCAGCTTTTC
rs1801131：TGGGGGGAGGAGCTGACCAGTGAAG[A/C]AAGTGTCTTTGAAGTCTTCGTTCTT
Design principle is to combine to form a kind of more stable duplex of thermodynamics with the SNP site of complementation using LNA,
Once base and the base mispairing of template that primer 3' ends are modified through LNA, PCR non-specific amplification can be substantially reduced, from
And improve specificity, sensitivity and the accuracy of reaction.
The nucleotide sequence (5 ' -3 ') for designing 4 obtained specific primers and 2 universal primers is as follows：
rs1801133-C-F：TGTCTGCGGGAG+C (SEQ ID NO:1)
rs1801133-T-F：GTGTCTGCGGGAG+T (SEQ ID NO:2)
rs1801133-R：CCACTCCAGCATCACTCACT (SEQ ID NO:3)
rs1801131-A-F：GAGCTGACCAGTGAAG+A (SEQ ID NO:4)
rs1801131-C-F：GCTGACCAGTGAAG+C (SEQ ID NO:5)
rs1801131-R：CCACTCCAGCATCACTCACT (SEQ ID NO:6)
Wherein, the "+" in sequence represents that the base of the end of primer 3 ' is modified through LNA.Such as sequence SEQ ID NO:In 1,
"+C " represents that the base C of the end of primer 3 ' modifies through LNA, once "+the C " on the primer be not mutual with the base on template strand
Mend, PCR non-specific amplification will reduce, and the specificity of PCR reactions will increase.
Respectively using C/C types standard items, T/C types standard items, T/T types standard items, negative control, 1ng genomic DNAs mould
Plate, in two PCR reaction tubes of A, B, for two kinds of allele of C, T in rs1801133 sites, pcr amplification reaction is carried out,
Examine specificity and the sensitivity of the above-mentioned primer in rs1801133 sites.Pcr amplification reaction system is as shown in table 1~2.
Respectively using A/A types standard items, A/C types standard items, C/C types standard items, negative control, 1ng genomic DNAs mould
Plate, in two PCR reaction tubes of C, D, for two kinds of allele of A, C in rs1801131 sites, pcr amplification reaction is carried out,
Examine specificity and the sensitivity of the above-mentioned primer in rs1801131 sites.Pcr amplification reaction system is as shown in table 3~4.
Table 1A pipe pcr amplification reaction systems
| Composition | Volume |
| 2 × SYBR Master Mix (reactant mixture) | 10μL |
| 50 × ROX Reference Dye (reference dye) | 0.4μL |
| 10 μM of rs1801133-C-F primers | 0.4μL |
| 10 μM of rs1801133-R primers | 0.4μL |
| Template | 2μL |
| ddH2O | 6.8μL |
| Cumulative volume | 20μL |
Table 2B pipe pcr amplification reaction systems
Table 3C pipe pcr amplification reaction systems
| Composition | Volume |
| 2×SYBR Master Mix | 10μL |
| 50×ROX Reference Dye | 0.4μL |
| 10 μM of rs1801131-A-F primers | 0.4μL |
| 10 μM of rs1801131-R primers | 0.4μL |
| Template | 2μL |
| ddH2O | 6.8μL |
| Cumulative volume | 20μL |
Table 4D pipe pcr amplification reaction systems
| Composition | Volume |
| 2×SYBR Master Mix | 10μL |
| 50×ROX Reference Dye | 0.4μL |
| 10 μM of rs1801131-C-F primers | 0.4μL |
| 10 μM of rs1801131-R primers | 0.4μL |
| Template | 2μL |
| ddH2O | 6.8μL |
| Cumulative volume | 20μL |
Pcr amplification reaction condition is：95 DEG C of pre-degenerations 30 seconds, 1 circulation；95 DEG C are denatured 5 seconds, and 60 DEG C are annealed 34 seconds, and 40
Individual circulation.SYBR fluorescence signals are detected in annealing.
Pcr amplification reaction result is respectively as shown in table 5~6 and Fig. 1~20, and the genotype of each sample is and direct sequencing
The genotype results of acquisition are consistent.
Specificity and sensitivity evaluation of the table 5 for the primer in rs1801133 sites
Specificity and sensitivity evaluation of the table 6 for the primer in rs1801131 sites
Note：In table 5~6, Ct values are considered as more than 40 to be not detected by
The above results prove that 4 positive specific primers that above-mentioned design obtains can be respectively used to detect people's MTHFR bases
Because of No. rs1801133 and 4 kinds of allele in rs1801131 Liang Ge mutational sites, and for the detection of genomic DNA sample
Lower limit is less than 1ng.
2. extract sample DNA
Buccal swab sample is put into centrifuge tube, 200 μ L PBSs is added, adds 180 μ L GB buffer solutions
(Buffer GB), 20 μ L Proteinase Ks (Proteinase K) and 10 μ L 10mg/mL ribonuclease A (RNase A), fill
Divide to inhale and play mixing, warm bath 10 minutes in 56 DEG C of water-baths.Then the ethanol of 200 μ L 100% is added, fully inhales and plays mixing, by supernatant
Carefully it is transferred in 2mL centrifugal columns, 12000rpm centrifugations 2min.Add 500 μ L WA buffer solutions (Buffer WA), 12000rpm
1min is centrifuged, careful lid of opening adds 700 μ L WB buffer solutions (Buffer WB), 12000rpm centrifugations 1min.Blank pipe
12000rpm centrifuges 2min, adds 40 μ L ddH2O incubates 5min, 12000rpm centrifugations 2min in film center.
Carried DNA is dissolved in ddH2In O, through NanoDrop2000 Detection and Extraction quality, its concentration is determined, is then adjusted with solution
Whole DNA concentration is to 10ng/ μ L as follow-up PCR reaction templates.
3. fluorescent PCR amplified reaction
2 μ L samples DNA are taken as reaction template, positive specific primer and general reverse primer using above-mentioned design,
Using ABI7500 real-time fluorescence PCRs instrument (Applied biosystems), carried out respectively in tetra- reaction tubes of A, B, C, D
Pcr amplification reaction, the pcr amplification reaction system in each pipe as shown in table 1~4, wherein, above-mentioned 2nd step of template is extracted
10ng/ μ L buccal swab samples DNA.Positive control respectively using rs1801133 sites C/C type plasmids standard items,
The standard items of rs1801133 sites T/T type plasmids, the standard items of rs1801131 sites A/A type plasmids, No. rs1801131
The standard items of site C/C type plasmids.
Pcr amplification reaction condition is：95 DEG C of pre-degenerations 30 seconds, 1 circulation；95 DEG C are denatured 5 seconds, and 60 DEG C are annealed 34 seconds, and 40
Individual circulation.SYBR fluorescence signals are detected in annealing.
According to ARMS method principles, gene is carried out to rs1801133 the and rs1801131 sites of the mthfr gene after amplification
Phenotypic analysis, i.e. on the Ct value judgement sample mthfr genes shown according to fluorescent PCR amplification instrument rs1801133 and
The genotype in rs1801131 sites：When Ct values >=36, it is considered as and does not express；As Ct value ＜ 36, it is considered as expression.When table in A pipes
Reach, when not expressed in B pipes, then it represents that rs1801133 genotype is C/C types；Expressed when in A pipes, when being expressed in B pipes simultaneously,
The genotype for then representing rs1801133 is T/C types；When not expressed in A pipes, when being expressed in B pipes, then it represents that rs1801133 base
Because type is T/T types.Expressed when in C pipes, when not expressed in D pipes, then it represents that rs1801131 genotype is A/A types；When in C pipes
Express, when being expressed in D pipes simultaneously, then it represents that rs1801131 genotype is A/C types；When not expressed in C pipes, expressed in D pipes
When, then it represents that rs1801131 genotype is C/C types.
8 buccal swab sample testing results are referring to table 7 and table 9.Wherein, on mthfr gene, rs1801133 genotype
Ratio for C/C types is that the ratio of 50.0%, T/C types is that the ratios of 37.5%, T/T types is 12.5%；Rs1801131 genotype
Ratio for A/A types is that the ratio of 37.5%, A/C types is that the ratios of 50.0%, C/C types is 12.5%.
Meanwhile contrasting detection is carried out using direct sequencing, referring to table 8 and table 10.As a result show, with the present embodiment
The testing result that LNA-ARMS PCR detection methods obtain is reached with the testing result coincidence rate obtained using direct sequencing
100%, further demonstrate the accuracy of detection method.
The rs1801133 genotype call results that table 7 is obtained using the method for the present invention
The rs1801133 genotype call results that table 8 is obtained using generation direct sequencing
| Sample number | Genotype |
| 1 | T/C |
| 2 | T/C |
| 3 | T/T |
| 4 | C/C |
| 5 | T/C |
| 6 | C/C |
| 7 | C/C |
| 8 | C/C |
The rs1801131 genotype call results that table 9 is obtained using the method for the present invention
Note：In table 7,9, Ct values are considered as more than 40 to be not detected by
The rs1801131 genotype call results that table 10 is obtained using generation direct sequencing
| Sample number | Genotype |
| 1 | A/A |
| 2 | A/C |
| 3 | C/C |
| 4 | A/A |
| 5 | A/C |
| 6 | A/A |
| 7 | A/C |
| 8 | A/C |
Sequence table
<110>Shanghai Biochip Co., Ltd
<120>Method, primer and kit based on ARMS-PCR detection people's mthfr gene polymorphisms
<130> CPC-NP-17-100418
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 13
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<223>Primer
<400> 1
tgtctgcggg agc 13
<210> 2
<211> 14
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<223>Primer
<400> 2
gtgtctgcgg gagt 14
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<223>Primer
<400> 3
ccactccagc atcactcact 20
<210> 4
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<223>Primer
<400> 4
gagctgacca gtgaaga 17
<210> 5
<211> 15
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<223>Primer
<400> 5
gctgaccagt gaagc 15
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<223>Primer
<400> 6
ccactccagc atcactcact 20
Claims (8)
1. people's mthfr gene SNP detection primer groups, for detecting on people's mthfr gene No. rs1801133 and No. rs1801131
The genotype of SNP site, it is characterised in that including drawing for the C/C genotype for detecting the rs1801133 SNP sites
Thing to, the primer pair of T/T genotype for detecting the rs1801133 SNP sites, for detecting the rs1801131
The primer of the primer pair of the A/A genotype of number SNP site, the C/C genotype for detecting the rs1801131 SNP sites
It is right；Wherein,
The primer pair for being used to detect the C/C genotype of rs1801133 SNP sites has and SEQ ID NO:Sequence shown in 1
The identical upstream sequence of row more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 3；
The primer pair for being used to detect the T/T genotype of rs1801133 SNP sites has and SEQ ID NO:Sequence shown in 2
The identical upstream sequence of row more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 3；
The primer pair for being used to detect the A/A genotype of rs1801131 SNP sites has and SEQ ID NO:Sequence shown in 4
The identical upstream sequence of row more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 6；
The primer pair for being used to detect the C/C genotype of rs1801131 SNP sites has and SEQ ID NO:Sequence shown in 5
The identical upstream sequence of row more than 80% and with SEQ ID NO:The identical downstream sequence of sequence more than 80% shown in 6.
2. primer sets according to claim 1, it is characterised in that the C/ for being used to detect rs1801133 SNP sites
The upstream sequence of the primer pair of C genotype such as SEQ ID NO:Shown in 1, downstream sequence such as SEQ ID NO:Shown in 3；It is described to be used for
Detect the upstream sequence such as SEQ ID NO of the primer pair of the T/T genotype of rs1801133 SNP sites:Shown in 2, downstream sequence
Such as SEQ ID NO:Shown in 3；The upstream sequence for being used to detect the primer pair of the A/A genotype of rs1801131 SNP sites
Such as SEQ ID NO:Shown in 4, downstream sequence such as SEQ ID NO:Shown in 6；It is described to be used to detect rs1801131 SNP sites
The upstream sequence of the primer pair of C/C genotype such as SEQ ID NO:Shown in 5, downstream sequence such as SEQ ID NO:Shown in 6.
3. primer sets according to claim 1 or 2, it is characterised in that last alkali at 3 ' ends of the upstream sequence
Base is marked with lock nucleic acid modification.
4. the PCR reaction kits based on ARMS-PCR detection people's mthfr gene polymorphisms, it is characterised in that comprising having the right
It is required that the primer sets described in any one of 1-3.
5. kit according to claim 4, it is characterised in that the kit is also comprising on someone's mthfr gene
The standard items of rs1801133 SNP site C/C type plasmids, the standard items of rs1801133 SNP site T/T type plasmids,
Standard items, the standard items of rs1801131 SNP site C/C type plasmids of rs1801131 SNP site A/A type plasmids.
6. the method based on ARMS-PCR detection people's mthfr gene polymorphisms, it is characterised in that step includes：
1) extract sample DNA and purify；
2) using DNA obtained by step 1) as template, it is in A, B, C, D four PCR reaction tubes numbering, while carry out real-time fluorescence
Quantitative pcr amplification reaction；Wherein：
The C/C genotype for being used to detect the rs1801133 SNP sites described in claim any one of 1-3 is added in A pipes
Primer pair；
The T/T genotype for being used to detect the rs1801133 SNP sites described in claim any one of 1-3 is added in B pipes
Primer pair；
The A/A genotype for being used to detect the rs1801131 SNP sites described in claim any one of 1-3 is added in C pipes
Primer pair；
The C/C genotype for being used to detect the rs1801131 SNP sites described in claim any one of 1-3 is added in D pipes
Primer pair；
3) according to the genotype of No. rs1801133 of Ct value judgement sample mthfr genes and No. rs1801131 two SNP site.
7. according to the method for claim 6, it is characterised in that step 2), PCR reaction conditions are 92~97 DEG C of pre-degenerations
0.5~10min；92~97 DEG C of 10~30s of denaturation, 56~60 DEG C of 10~60s of annealing, 40~50 circulate.
8. according to the method for claim 6, it is characterised in that step 3), the determination methods of genotype are：Ct value >=36
When, it is judged to not express；Ct values ＜ 36, is judged to express；Expressed when in A pipes, when not expressed in B pipes, judge rs1801133 gene
Type is C/C types；Expressed when in A pipes, when being expressed in B pipes simultaneously, judge rs1801133 genotype for T/C types；When in A pipes not
Express, when being expressed in B pipes, judge rs1801133 genotype for T/T types；Express when in C pipes, when not expressed in D pipes, judge
Rs1801131 genotype is A/A types；Expressed when in C pipes, when being expressed in D pipes simultaneously, the genotype for judging rs1801131 is
A/C types；When not expressed in C pipes, when being expressed in D pipes, judge rs1801131 genotype for C/C types.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710259900.1A CN107841548A (en) | 2017-04-20 | 2017-04-20 | Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710259900.1A CN107841548A (en) | 2017-04-20 | 2017-04-20 | Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107841548A true CN107841548A (en) | 2018-03-27 |
Family
ID=61682794
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710259900.1A Pending CN107841548A (en) | 2017-04-20 | 2017-04-20 | Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107841548A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110205379A (en) * | 2019-07-03 | 2019-09-06 | 贵州省临床检验中心 | One kind SNP marker relevant to In Congenital Heart Disease and its application |
| WO2020051529A1 (en) * | 2018-09-07 | 2020-03-12 | Sequenom, Inc. | Methods, and systems to detect transplant rejection |
| CN111321216A (en) * | 2020-03-20 | 2020-06-23 | 河南赛诺特生物技术有限公司 | Primer group, kit and detection method for detecting polymorphism of human MTHFR and MTRR genes |
| CN113913509A (en) * | 2021-11-18 | 2022-01-11 | 江苏博嘉生物医学科技有限公司 | Detection kit and detection method for screening gene mutation of related molecular marker in cerebral apoplexy risk |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531852A (en) * | 2014-12-12 | 2015-04-22 | 广东省妇幼保健院 | Probe and primer sensitized by locking nucleic acid and used for detecting C677T mutation of MTHFR gene, kit and detection method |
| CN105256019A (en) * | 2015-10-14 | 2016-01-20 | 武汉海吉力生物科技有限公司 | MTHFR and MTRR gene polymorphism detection primer group and kit |
| CN105331728A (en) * | 2013-07-16 | 2016-02-17 | 北京林业大学 | SNP locus genotype classifying method |
-
2017
- 2017-04-20 CN CN201710259900.1A patent/CN107841548A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331728A (en) * | 2013-07-16 | 2016-02-17 | 北京林业大学 | SNP locus genotype classifying method |
| CN104531852A (en) * | 2014-12-12 | 2015-04-22 | 广东省妇幼保健院 | Probe and primer sensitized by locking nucleic acid and used for detecting C677T mutation of MTHFR gene, kit and detection method |
| CN105256019A (en) * | 2015-10-14 | 2016-01-20 | 武汉海吉力生物科技有限公司 | MTHFR and MTRR gene polymorphism detection primer group and kit |
Non-Patent Citations (1)
| Title |
|---|
| YUAN, LAMEI; SONG, ZHI; DENG, XIONG; 等.: "Association of the MTHFR rs1801131 and rs1801133 variants in sporadic Parkinson"s disease patients", 《NEUROSCIENCE LETTERS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020051529A1 (en) * | 2018-09-07 | 2020-03-12 | Sequenom, Inc. | Methods, and systems to detect transplant rejection |
| CN110205379A (en) * | 2019-07-03 | 2019-09-06 | 贵州省临床检验中心 | One kind SNP marker relevant to In Congenital Heart Disease and its application |
| CN111321216A (en) * | 2020-03-20 | 2020-06-23 | 河南赛诺特生物技术有限公司 | Primer group, kit and detection method for detecting polymorphism of human MTHFR and MTRR genes |
| CN113913509A (en) * | 2021-11-18 | 2022-01-11 | 江苏博嘉生物医学科技有限公司 | Detection kit and detection method for screening gene mutation of related molecular marker in cerebral apoplexy risk |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110036118A (en) | The composition and method of nucleic acid molecules for identification | |
| CN107841548A (en) | Method, primer and kit based on ARMS PCR detection people's mthfr gene polymorphisms | |
| CN105296621B (en) | Primer pair, fluorescence probe and kit for detecting mthfr gene polymorphism | |
| KR20100063050A (en) | Analysis of nucleic acids of varying lengths by digital pcr | |
| CN105002275A (en) | Specific sequence specific primers-polymerase chain reaction primers and kit for human MTHFR and MTRR gene polymorphism detection | |
| CN107841537A (en) | A kind of full premix MTHFR and MTRR multiplex PCR genetic polymorphism detection kits and method | |
| CN109890983A (en) | For assessing the composition and method of immune response | |
| CN108456727A (en) | Mthfr gene polymorphic detection probe, primer, kit and detection method | |
| EP4219757A1 (en) | Multiplex nucleic acid detection method, and combination and kit | |
| CN106701987A (en) | PCR (polymerase chain reaction) amplification system for genotyping of three SNP (single-nucleotide polymorphism) loci related to human folic acid metabolism and detection kit | |
| CN104109714A (en) | Primer for detecting folic acid metabolism related gene SNP, fluorescent probe and application | |
| CN101760526A (en) | Kit for quantitative guidance of folic acid supplement dosage before and during pregnancy | |
| CN106834519A (en) | A kind of primer of TaqMan MGB sonde methods detection mankind's ALDH2 gene pleiomorphisms and its application | |
| CN106701918A (en) | Rs8099917 genotyping dual-color fluorescence PCR rapid detection kit | |
| CN108441553A (en) | It is a kind of it is accurate detection ALDH2 gene pleiomorphisms kit and its application | |
| CN107385063B (en) | Composition for detecting MTHFR and MTRR gene polymorphism and application thereof | |
| CN105018592B (en) | Mgmt gene promoter methylation detection based on pyrosequencing techniques | |
| CN102399862A (en) | Methylated DNA detection method based on melting curve | |
| CN103667435A (en) | Kit for detecting individual folate metabolism disorder | |
| EP2013366B1 (en) | Sequencing of the L10 codon of the HIV gag gene | |
| CN105296601B (en) | The PCR SBT methods and reagent of a kind of human platelet alloantigen system gene parting | |
| KR101287431B1 (en) | Primer composition for amplifying genetic region having various genetic variations in target genes, method for amplifying the target genes using the same, PCR amplification kit comprising the same and method for analyzing the genotype of the target genes | |
| CN104185683A (en) | Method and primer set for detecting mutation | |
| Zhang et al. | Single nucleotide polymorphism genotyping of ALDH2 gene based on asymmetric PCR and fluorescent probe-mediated melting curves | |
| CN107267621A (en) | MDR1 genetic polymorphism detections system and its kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180327 |