CN106755408B - Plant allele imbalance expression detection method - Google Patents
Plant allele imbalance expression detection method Download PDFInfo
- Publication number
- CN106755408B CN106755408B CN201611200502.4A CN201611200502A CN106755408B CN 106755408 B CN106755408 B CN 106755408B CN 201611200502 A CN201611200502 A CN 201611200502A CN 106755408 B CN106755408 B CN 106755408B
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- primers
- sample
- allele
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a plant allele imbalance expression detection method, which comprises the following steps: 1) comparing the candidate gene sequences, and screening SNPs sites of the marker allele; 2) designing qPCR specific primers and degenerate primers according to the screened SNPs sites; 3) respectively carrying out PCR amplification on cDNA of a sample to be detected by using qPCR specific primers and degenerate primers to obtain amplification products; 4) if the melting curve of the amplification product is a single peak, calculating the allele expression specificity of the sample to be detected according to the Ct value of the PCR amplification; the qPCR specific primers comprise a forward primer and a reverse primer, and LNA (low noise amplifier) modification is performed on nucleotides complementary to the 3 'end of the primer and the 3' end of the SNP locus. The method increases the accuracy and reliability of the detection result, simplifies the experimental matching conditions and obviously reduces the experimental cost.
Description
Technical Field
The invention relates to the field of gene expression detection, in particular to a plant allele imbalance expression detection method.
Background
Alleles (allele also known as allelomorph) generally refer to a pair of genes that control relative traits at the same position on a pair of homologous chromosomes.
Allelic Expression Imbalance (AEI) is within the same cell, with 2 copies of each gene, and the ratio of 2 copies of the gene expression deviates from 1: l. The phenomenon of unbalanced expression of alleles is ubiquitous, and besides the absolute unbalanced expression of genetic imprinting genes, a considerable number of genes have AEI in different time and space of part of individuals and the same individual. And is related to the polymorphic sites of some specific regions of the genome.
At present, the conventional allele imbalance expression detection mainly adopts a restriction fragment length polymorphism and single-strand conformation polymorphism technology, a sequencing method, an expression profile chip method and a SNaPshot technology based on an electrophoresis technology, the sequencing method and the SNaPshot are expensive, a related large instrument platform is used as a support, and the flexibility of experiment operation is poor.
Disclosure of Invention
In view of the above, the present invention provides an allele imbalance expression detection method, so as to solve the problems of high cost and poor accuracy of allele imbalance expression detection in the prior art.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a method for detecting the unbalanced expression of plant alleles, which comprises the following steps:
1) comparing the candidate gene sequences, and screening SNPs sites of the marker allele;
2) designing qPCR specific primers and degenerate primers according to the SNPs sites screened in the step 1), wherein the qPCR specific primers comprise forward primers and reverse primers, and LNA modification is performed on nucleotides complementary to the 3 'ends of the SNP sites at the 3' ends of the forward primers or the reverse primers;
3) respectively carrying out PCR amplification on cDNA of a sample to be detected by using the qPCR specific primer and the degenerate primer to obtain an amplification product; detecting an amplification curve in the PCR amplification process, and detecting a melting curve of an amplification product after the PCR amplification is finished;
4) if the melting curve of the amplification product is a single peak, calculating according to the Ct value of the PCR amplification to obtain the allele expression specificity of the sample to be detected;
the qPCR specific primers comprise a forward primer and a reverse primer, and LNA (low noise amplifier) modification is performed on nucleotides complementary to the 3 'end of the primer and the 3' end of the SNP locus.
Preferably, the sample to be detected in the step 3) is a forest tree species.
Preferably, the sample to be detected is populus trichocarpa or eucalyptus grandis.
Preferably, when the sample to be detected is populus trichocarpa, the SNP locus is located on the heat shock transcription factor gene 2.
Preferably, the qPCR specific primers comprise a forward primer SEQ ID No.1, a reverse primer SEQ ID No.4 and a forward primer SEQ ID No. 2; the penultimate nucleotides at the 3' ends of the SEQ ID NO.1 and SEQ ID NO.2 are subjected to LNA modification; the degenerate primers comprise a forward degenerate primer SEQ ID NO.3 and a reverse degenerate primer SEQ ID NO. 4.
Preferably, when the sample to be detected is eucalyptus grandis, the SNP locus is located on a MYB transcription factor gene.
Preferably, the qPCR specific primers comprise a forward primer SEQ ID No.5, SEQ ID No.6 and a reverse primer SEQ ID No. 8; the penultimate nucleotides at the 3' ends of SEQ ID No.5 and SEQ ID No.6 are modified by LNA; the degenerate primers comprise a forward degenerate primer SEQ ID NO.7 and a reverse degenerate primer SEQ ID NO. 8.
Preferably, the PCR amplification procedure of the cDNA of the sample to be detected is: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 40 s; 40 cycles.
Preferably, the PCR amplification system for the cDNA of the sample to be tested comprises: 20 ng/mu L of cDNA of a sample to be detected, 1 mu L; SYBR Premix Ex TaqTM (2X), 10. mu.L; 0.5. mu.L of 10. mu.M forward primer; 10 μ M reverse primer 0.5 μ L; 8 μ L of double distilled water.
Preferably, according to the method of claim 1, the calculation formula of the allele expression specificity of the test sample is 2-ΔCtΔ Ct ═ Ct value for candidate allele type R-Ct value for candidate allele type R'; the genotype R is one of A, T, C and G, and the genotype R' is one of A, T, C and three of G except R.
The invention has the beneficial effects that: according to the method provided by the invention, the SNP locus is subjected to qPCR amplification by using the LNA locked nucleic acid modified primer to obtain a melting curve of an amplification product, and when the melting curve is a single peak, the allele imbalance expression specificity level is calculated by using the Ct value of the PCR amplification. The method provided by the invention adopts the LNA locked nucleic acid modified primer, can improve the annealing temperature, enhance the specificity of base pairing, greatly reduce the probability of mismatching, and increase the accuracy and reliability of the detection result.
Drawings
FIG. 1 is an allelic amplification curve of the hairy fruit poplar heat shock transcription factor gene 2;
FIG. 2 is an allele amplification curve for the MYB transcription factor gene of E.grandis.
Detailed Description
The invention provides a plant allele imbalance expression detection method, which comprises the following steps: 1) comparing the candidate gene sequences, and screening SNPs sites of the marker allele; 2) designing qPCR specific primers and degenerate primers according to the screened SNPs sites; 3) respectively carrying out PCR amplification on cDNA of a sample to be detected by using qPCR specific primers and degenerate primers to obtain amplification products; 4) if the melting curve of the amplification product is a single peak, calculating the allele expression specificity of the sample to be detected according to the Ct value of the PCR amplification; the qPCR specific primers comprise a forward primer and a reverse primer, and LNA (low noise amplifier) modification is performed on nucleotides complementary to the 3 'end of the primer and the 3' end of the SNP locus.
The detection method provided by the invention is suitable for detecting the unbalanced expression of the plant allele, the preferable sample to be detected is forest tree species, and the more preferable sample to be detected is populus trichocarpa or eucalyptus grandis.
In the present invention, the candidate gene sequences are compared, and the following two methods are selected for species when the sites of SNPs of marker alleles are selected: aiming at model species, candidate gene SNPs locus screening is carried out through a species re-sequencing database, wherein the re-sequencing database is preferably a Phytozome database, and the website is https:// Phytozome.jgi.doe.gov/; specifically, when the SNPs sites are screened by using the resequencing database, the screened SNPs sites meet the following conditions: the frequency of the selected SNPs sites in the population is more than 5%, and the sites are in a heterozygous state in the individual.
For non-model species, allele SNPs locus screening is carried out through candidate gene cDNA clone, specifically, at least 8 clone sequencing is carried out when the candidate gene cDNA clone carries out allele SNPs locus screening, and the success rate of allele SNPs locus screening reaches more than 99.8%. The method for cloning and screening the candidate gene cDNA can be realized by adopting a conventional gene cloning and screening method in the field, and the method specifically comprises the following steps of: designing a primer according to the conserved sequence of the candidate gene, and amplifying a corresponding gene segment by taking the cDNA as a template. The ligation of the recombinant plasmid was performed using a PMD-18T vector from Takara, in the following manner: mu.L of Solution I, 1. mu.L of pMD-18T Vector (50 ng/. mu.L), 2. mu.L of PCR product, 12. mu.L of double distilled water, and ligation overnight at 16 ℃. Transformation of the recombinant plasmid was then carried out: 1) adding 5uL of the ligation product into 50uL of escherichia coli TOP10 receptor cells, mixing uniformly, and carrying out ice bath for 30 min; 2) performing water bath heat shock at 42 ℃ for 90s, and performing ice bath for 3 min; 3) adding 200uL LB liquid culture medium, and mixing. Culturing at 37 deg.C under 150rpm for 30-60 min; 4) 100uL of the culture medium was applied to LB solid medium containing Amp50 mg/L. The cells were cultured at 37 ℃ in an inverted manner overnight. Finally, 10 individual colonies were picked from the plate in a 20. mu.L pool of liquid LB medium. Taking a single colony for PCR identification. After sequencing the positive colony, 5 'and 3' RACE primers are designed according to the obtained gene sequence, and RACE PCR amplification is carried out, so that a full-length gene sequence is obtained.
In the present invention, the SNPs site of the selected marker allele is preferably located in a non-conserved region at the 3' end of the candidate gene, and is used for distinguishing different members of the gene family. In the invention, when the sample to be detected is populus trichocarpa, the screened SNP locus is preferably positioned on a heat shock transcription factor gene 2 (the number is Potri.001G108100); when the sample to be detected is eucalyptus grandis, the selected SNP locus is preferably located on the MYB transcription factor gene (with the code of Eucgr.K02470).
After the marked allele SNPs loci are obtained by screening, qPCR specific primers and degenerate primers are designed according to the screened SNPs loci. The qPCR specific primers comprise a forward primer and a reverse primer, and LNA modification is carried out on nucleotides complementary to the 3 'end of the SNP locus at the 3' end of the forward primer or the reverse primer. Specifically, in the invention, the penultimate or penultimate base at the 3' end of the forward primer or the reverse primer is matched with the SNPs sites of the marker allele, and the sugar ring of the nucleotide of the base is subjected to LNA modification, namely locked nucleic acid bridging modification, during primer synthesis. LNA locked nucleic acid refers to a kind of RNA derivatives in which 2'-O and 4' -C on the nucleotide sugar ring are connected by methylene bridge, and can be paired with DNA or RNA according to the general base pairing principle. The bridging structure can increase the stability of the nucleic acid skeleton, improve the annealing temperature, enhance the specificity of base pairing and greatly reduce the probability of mismatch. In the invention, because SNPs sites to be detected generally have two genotypes, two LNA modified forward primers or two reverse primers are preferably synthesized simultaneously; preferably, the qPCR specific primer has only single base difference with SNPs sites, that is, only the corresponding nucleotides of SNPs sites in the qPCR specific labeling primer have difference, and the rest nucleotide sequences are not changed. The other reverse primer or forward primer can be designed and synthesized according to the conventional primer design rule without LNA modification. Since the position of the primer for LNA modification is relatively fixed, when determining whether to perform LNA modification on the forward primer or the reverse primer, one primer that is most easily hybridized and bound to the DNA strand can be selected for LNA modification with reference to the primer design rule.
In the present invention, the degenerate primers are designed for amplification in order to determine whether non-specific amplification is present in the amplification of the qPCR-specific primers by comparing the amount of amplification product obtained by amplification with the degenerate primers with the amount of amplification product obtained by amplification with the qPCR-specific primers. The known degenerate primer can simultaneously amplify two different allelic sites on the SNP locus, and when the amount of an amplification product obtained by amplifying the qPCR specific primer is less than or equal to the amount of the amplification product obtained by amplifying the degenerate primer, the amplification of the qPCR specific primer has no non-specific amplification; when the amount of the amplification product obtained by amplification of the qPCR specific primer is larger than that obtained by amplification of the degenerate primer, the amplification of the qPCR specific primer is proved to have non-specific amplification, and the subsequent data is unreliable.
In the invention, when the sample to be detected is hairy fruit poplar, the selected SNP locus is preferably positioned at SNP8583997 on a heat shock transcription factor gene 2, a qPCR primer is designed according to the SNP locus, and the qPCR specific primer comprises a forward primer SEQ ID NO. 1: HSF2SNP8583997T F:5' -ACAGAACTCATGTTCT
G-3'、SEQ ID NO.2：HSF2SNP8583997C F:5'-ACAGAACTCATGTTCT
G-3' and reverse primer SEQ ID NO. 4: HSF2R: 5'-TAGATGTGCTGCTGACTTCCTAC-3'; the penultimate nucleotides at the 3' ends of SEQ ID No.1 and SEQ ID No.2 are LNA modified. In the present invention, degenerate primers designed according to the SNP sites include forward degenerate primers SEQ ID NO. 3: HSF2SNP8583997T/C F5' -ACAGAACTCATGTTCT
G-3' and reverse primer SEQ ID NO. 4: HSF2R: 5'-TAGATGTGCTGCTGACTTCCTAC-3'.
In the invention, when the sample to be detected is eucalyptus grandis, the SNP locus is located at position 8583997 of the MYB transcription factor gene SNP. Designing qPCR primers according to the SNP loci, wherein the qPCR specific primers comprise forward primers SEQ ID NO. 5: MYBSNP8583997G F:5' -GAAGACTCTTTGTTTGTCTGTT
G-3'、SEQ ID NO.6：MYBSNP8583997AF:5'-GAAGACTCTTTGTTTGTCTGT T
G-3' and reverse primer SEQ ID NO. 8: 5'-GATCTAGTTGAGTTAGAACAAAG-3' parts of MYBR; the penultimate nucleotides at the 3' end of SEQ ID No.5 and SEQ ID No.6 are LNA modified. In the present invention, degenerate primers are designed to include forward degenerate primers SEQ ID NO. 7: MYBSNP8583997G/A F:5' -GAAGACTCTTTGTTTGTCTGTT
G-3' and reverse primer SEQ ID NO. 8: and MYBR: 5'-GATCTAGTTGAGTTAGAACAAAG-3'.
After the qPCR specific primers and the degenerate primers of the SNPs sites are obtained, the qPCR specific primers and the degenerate primers are used for respectively carrying out PCR amplification on cDNA of a sample to be detected, and amplification products are obtained. The cDNA of the sample to be detected is obtained by extracting RNA of the sample to be detected and then carrying out reverse transcription. The method for obtaining cDNA by RNA extraction and reverse transcription is not particularly limited in the invention, and the conventional method in the field can be adopted. Preferably, in the present invention, the PCR amplification procedure of the cDNA of the sample to be tested is independently: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 40 s; 40 cycles. Preferably, the PCR amplification system for the sample cDNA to be tested independently comprises: 20 ng/mu L of cDNA of a sample to be detected, 1 mu L; SYBR Premix Ex TaqTM (2X), 10. mu.L; 0.5. mu.L of 10. mu.M forward primer; 10 μ M reverse primer 0.5 μ L; 8 μ L of double distilled water.
The invention obtains the melting curve of the PCR product in the range of 72-95 ℃. In the invention, if the melting curve of the amplification product is a single peak, the PCR amplification is indicated to be specific amplification, and then the allele expression specificity of the sample to be detected is calculated according to the Ct value of the PCR amplification. Specifically, in the invention, the calculation method of the allele imbalance expression specificity of the sample to be detected adopts 2-ΔCt(ii) a calculation method, Δ Ct ═ Ct value for candidate allele genotype R-Ct value for candidate allele genotype R'; the genotype R is one of A, T, C and G, and the genotype R' is one of A, T, C and three of G except R; the calculation result is the unbalanced expression difference level of different genotypes of the allele.
The method for detecting the unbalanced expression of plant alleles according to the present invention will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.
Example 1
According to the Phytozome database (https:// Phytozome. jgi. doe. gov/pz/portal. html # |)!
gene? 1& brown & 1& detail & 1& method & 0& search text & transliptid & 27040781) field fruit poplar hot shock transcription factor gene 2(HSF2) the re-sequencing data screened for SNPs sites located in the 3' non-conserved region of the gene for identification of alleles, where the frequency of SNPs needs to be greater than 5% in the population and is heterozygous at that site in the experimental individuals. The SNP8583997 site meets the requirements, and an individual with the site in a heterozygous state is selected as an allele expression detection material. The allele expression pattern of a heat shock transcription factor gene 2(Potri.001G108100) is detected by using LNA modified primer qPCR, and SNP8583997 in the hairy fruit poplar heat shock transcription factor gene 2(HSF2) is used as an allele identification site, and the gene sequence of the region in which the allele expression pattern is located is as follows:
ACTCCAAGTATAGACGTGCTTC
AGAACATGAGTTCTGTTACCACTTGCGATTGCTATT, italics
Is SNP site.
For the SNP8583997 site (underlined in bold), two types of template strands were included in the body of the experimental material, wherein the template strand I:5' -NNNNNNNNC
AGAACATGAGTTCTGTNNNNN
NNNN-3', template Strand II:5' -5' -NNNNNNNNC
AGAACATGAGTTCTGTNNNNNNN
N-3'. The corresponding genotypes were T and C, respectively.
Two forward primers were designed to synthesize a 3 'terminal nucleotide LNA modification (3' terminal penultimate nucleotide): SEQ ID NO.1(HSF2SNP8583997T F:5' -GGTAACAGAACTCATGTTCT)
G-3'), SEQ ID NO.2(HSF2SNP8583997C F:5'-GGTAACAGAACTCATGTTCTGG-3'), degenerate primer SEQ ID NO.3
(HSF2SNP8583997T/C F5'-GGTAACAGAACTCATGTTCT
G-3'), reverse primer SEQ ID NO.4(HSF2R: 5'-TAGATGTGCTGCTGACTTCCTAC-3'). The length of the target fragment of the amplification product is 232 bp.
And (3) carrying out qPCR amplification on the high-temperature stress treated hairy fruit poplar leaf cDNA by using the primers. The reaction system is the Populus tomentosa cDNA (20 ng/. mu.L) extracted after high temperature (42 ℃, 6h) treatment, and the reaction system is 1. mu.L; SYBR Premix Ex TaqTM (2X), 10. mu.L; forward primer (10. mu.M), 0.5. mu.L; reverse primer (10. mu.M), 0.5. mu.L; double distilled water was supplemented to 20. mu.L. The conditions for PCR amplification were: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 10s, annealing at 63 ℃ for 30s, extension at 72 ℃ for 40s, and reading plates in 40 cycles to obtain a melting curve of a PCR product at 72-95 ℃.
The PCR amplification curve is shown in FIG. 1, wherein A is an HSF2 gene degenerate primer amplification curve, B is an HSF2SNP8583997T primer qPCR amplification curve, and C is an HSF2SNP8583997C primer qPCR amplification curve.
Only one peak appears in the melting curves of the three amplification reactions, which indicates that the specific amplification is carried out. The Ct value of the primers SEQ ID NO.1 and SEQ ID NO.2 is larger than that of the primer SEQ ID NO.3, which indicates that only the allele template corresponding to the primers is amplified in the allele site amplification reaction. The amplification efficiency is between 90% and 100%, which indicates that the three pairs of primers have strong amplification efficiency consistency, and the amplification result can be used for comparative analysis.
By using i.e. 2-ΔCtThe method calculates the expression pattern of the hairy fruit poplar heat shock transcription factor gene 2(HSF2) allele, wherein delta Ct is (Ct (HSF2-SNP8583997T) -Ct (HSF2-SNP 8583997C)).
2-ΔCt＝2-(26.81-30.42)
＝2-(-3.61)
＝12.21
Namely, the expression level of the allele HSF2-SNP8583997T is 12.21 times higher than that of the allele HSF2-SNP 8583997C.
ACTIN2 was used as an internal reference gene, namely 2-ΔΔCtThe method calculates the high-temperature treatment mode of the heat shock transcription factor gene 2(HSF2) allele response of the hairy fruit poplar. Δ Δ Ct ═ Ct (high temperature treatment-HSF 2-SNP8583997T) -Ct (high temperature treatment-ACTIN 2)) -Ct (control-HSF 2-SNP8583997T) -Ct (control ACTIN 2)).
2-ΔΔCt＝2-(26.81-23.56)-(31.12-23.45)
＝2-(3.25-7.67)
＝2-(-4.42)
＝21.4
Namely, the expression level of the allele HSF2-SNP8583997T is up-regulated by 21.4 times compared with the control under high-temperature treatment.
ACTIN2 was used as an internal reference gene, namely 2-ΔΔCtThe method calculates the high-temperature treatment mode of the heat shock transcription factor gene 2(HSF2) allele response of the hairy fruit poplar. Δ Δ Ct ═ Ct (high temperature treatment-HSF 2-SNP8583997C) -Ct (high temperature treatment-ACTIN 2)) -Ct (control-HSF 2-SNP8583997C) -Ct (control ACTIN 2))).
2-ΔΔCt＝2-(30.42-23.56)-(31.54-23.45)
＝2-(6.86-8.09)
＝2-(-1.23)
＝2.34
Namely, the expression level of the allele HSF2-SNP8583997C is up-regulated by 2.34 times compared with the control under high-temperature treatment.
Example 2
According to the phytochrome database (https:// phytochrome. jgi. doe. gov/pz/portal. html # | gene&crown＝1&detail＝1&method＝0&SearchText (trans ptid:32066262) Eucalyptus grandis MYB transcription factor gene (Eucgr. K02470) sequencing data screening the sites of SNPs located in the 3' non-conserved region of the gene for allele identification, where the frequency of SNPs needs to be greater than 5% in the population and where it is heterozygous in the experimental individuals. The SNP8583997 site meets the requirements, and an individual with the site in a heterozygous state is selected as an allele expression detection material. The allele expression pattern of MYB transcription factor gene (Eucgr.K02470) is detected by LNA modified primer qPCR, SNP32768853 in the MYB transcription factor gene (Eucgr.K02470) of E.grandis is used as an allele identification site, and the gene sequence of the region is as follows: CTCTTTGTTTGTCTGTT
GTGTTTATCG, italics
Is SNP site.
For SNP32768853 site (bold and underlined), trueThe test material contains two types of template strands, wherein the template strand I:5' -NNNNNNNNTGTCTGTT
GTGTTTNNNNN
NNNN-3', template Strand II:5' -5' -NNNNNNNNGTCTGTT
GTGTTTNNNNNNN
N-3'. The corresponding genotypes are G and a, respectively. Annealing temperature gradient PCR amplification was performed to determine the optimal qPCR amplification conditions for allele expression detection.
Two forward primers were designed to synthesize a 3 'terminal nucleotide LNA modification (3' terminal penultimate nucleotide): SEQ ID NO.5(MYBSNP8583997G F:5' -GAAGACTCTTTGTTTGTCTGTT)
G-3'),SEQ ID NO.6(MYBSNP8583997A F:5'-GAAGACTCTTTGTTTGTCTGT T
G-3'), a group of degenerate primers SEQ ID NO.7(MYBSNP8583997G/A F:5' -GAAGACTCTTTGTTTGTCTGTT)
G-3'), reverse primer SEQ ID NO.8(MYBR: 5'-GATCTAGTTGAGTTAGAACAAAG-3'). The length of the target fragment of the amplification product is 176 bp.
The cDNA of the eucalyptus grandis leaves subjected to high-temperature stress treatment is subjected to qPCR amplification. The reaction system is E.grandis cDNA (20 ng/. mu.L), μ L; SYBR Premix Ex TaqTM (2X), 10. mu.L; forward primer (10. mu.M), 0.5. mu.L; reverse primer (10. mu.M), 0.5. mu.L; double distilled water was supplemented to 20. mu.L. The conditions for PCR amplification were: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 40s, and reading plates in 40 cycles to obtain a melting curve of a PCR product at 72-95 ℃.
The PCR amplification curve is shown in FIG. 1, wherein A is a MYB gene degenerate primer amplification curve, B is a MYBSNP8583997G primer qPCR amplification curve, and C is a MYBSNP8583997A primer qPCR amplification curve.
Only one peak appears in the melting curves of the three amplification reactions, which indicates that the specific amplification is carried out. The amplification Ct value of the primers SEQ ID NO.1 and SEQ ID NO.2 is larger than that of the primer SEQ ID NO.3, which indicates that only the allele template corresponding to the primer is amplified in the allele site amplification reaction. The amplification efficiency is between 90% and 110%, which indicates that the three pairs of primers have strong amplification efficiency consistency, and the amplification result can be used for comparative analysis.
By using i.e. 2-ΔCtThe eucalyptus grandis MYB transcription factor (eucgr.k02470) allele expression pattern was calculated, where Δ Δ Ct ═ Ct (MYB-MYBSNP8583997G) -Ct (MYBSNP 8583997A)).
2-ΔCt＝2-(25.97-28.85)
＝2-(-2.88)
＝7.36
Namely, the expression level of the allele MYBSNP8583997G is 7.36 times higher than that of the allele MYBSNP 8583997A.
According to the method provided by the invention, the specific expression level of the allele is calculated by performing qPCR amplification on the SNP locus by using the LNA locked nucleic acid modified primer, the specificity is strong, the accuracy and the reliability of the detection result are high according to the amplification curve and the Ct value in the embodiment, and only the PCR means is used, so that the experimental matching conditions are simplified, and the experimental cost is remarkably reduced.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Beijing university of forestry
<120> a method for detecting the unbalanced expression of plant alleles
<140>201611200502.4
<141>2016-12-22
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>22
<212>DNA
<213>Artificial Sequence
<400>1
ggtaacagaa ctcatgttct ag 22
<210>2
<211>22
<212>DNA
<213>Artificial Sequence
<400>2
ggtaacagaa ctcatgttct gg 22
<210>3
<211>22
<212>DNA
<213>Artificial Sequence
<400>3
<210>4
<211>23
<212>DNA
<213>Artificial Sequence
<400>4
<210>5
<211>24
<212>DNA
<213>Artificial Sequence
<400>5
gaagactctt tgtttgtctg ttgg 24
<210>6
<211>24
<212>DNA
<213>Artificial Sequence
<400>6
gaagactctt tgtttgtctg ttag 24
<210>7
<211>24
<212>DNA
<213>Artificial Sequence
<400>7
gaagactctt tgtttgtctg ttrg 24
<210>8
<211>23
<212>DNA
<213>Artificial Sequence
<400>8
gatctagttg agttagaaca aag 23
Claims (4)
1. A method for detecting the unbalanced expression of plant alleles comprises the following steps:
1) comparing the candidate gene sequences, and screening SNPs sites of the marker allele;
2) designing qPCR specific primers and degenerate primers according to the SNPs sites screened in the step 1), wherein the qPCR specific primers comprise forward primers and reverse primers, and LNA modification is performed on nucleotides complementary to the 3 'ends of the SNP sites at the 3' ends of the forward primers or the reverse primers;
3) respectively carrying out PCR amplification on cDNA of a sample to be detected by using the qPCR specific primer and the degenerate primer to obtain an amplification product; monitoring an amplification curve in the PCR amplification process, and detecting a melting curve of an amplification product after the PCR amplification is finished;
4) if the melting curve of the amplification product is a single peak, calculating according to the Ct value of the PCR amplification to obtain the allele imbalance expression specificity of the sample to be detected;
the SNPs locus of the marker allele is positioned in a non-conserved region at the 3' end of the candidate gene;
the sample to be detected is Chinese white poplar or eucalyptus grandis;
when the sample to be detected is a hairy fruit poplar, the SNP locus is positioned on a heat shock transcription factor gene 2; the qPCR specific primer comprises a forward primer SEQ ID NO.1, a forward primer SEQ ID NO.2 and a reverse primer SEQ ID NO. 4; the penultimate nucleotides at the 3' ends of SEQ ID NO.1 and SEQ ID NO.2 are subjected to LNA modification; the degenerate primers comprise a forward degenerate primer SEQ ID NO.3 and a reverse degenerate primer SEQ ID NO. 4;
when the sample to be detected is eucalyptus grandis, the SNP locus is located on a MYB transcription factor gene; the qPCR specific primers comprise forward primers SEQ ID NO.5, SEQ ID NO.6 and reverse primers SEQ ID NO. 8; the penultimate nucleotides at the 3' ends of SEQ ID No.5 and SEQ ID No.6 are LNA modified; the degenerate primers comprise a forward degenerate primer SEQ ID NO.7 and a reverse degenerate primer SEQ ID NO. 8.
2. The method of claim 1, wherein the PCR amplification procedure of the cDNA of the sample to be tested is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 40 s; 40 cycles.
3. The method of claim 1, wherein the PCR amplification system for the cDNA of the sample to be tested comprises: 20 ng/mu L of cDNA of a sample to be detected, 1 mu L; 2 × SYBR PremixEx TaqTM, 10 μ L; 0.5. mu.L of 10. mu.M forward primer; 10 μ M reverse primer 0.5 μ L; 8 μ L of double distilled water.
4. The method of claim 1, wherein the calculation of the allele imbalance expression specificity of the test sample is expressed as 2-ΔCtΔ Ct ═ Ct value for candidate allele type R-Ct value for candidate allele type R'; the genotype R is one of A, T, C and G, and the genotype R' is one of A, T, C and three of G except R.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611200502.4A CN106755408B (en) | 2016-12-22 | 2016-12-22 | Plant allele imbalance expression detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611200502.4A CN106755408B (en) | 2016-12-22 | 2016-12-22 | Plant allele imbalance expression detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755408A CN106755408A (en) | 2017-05-31 |
| CN106755408B true CN106755408B (en) | 2020-10-13 |
Family
ID=58897202
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611200502.4A Active CN106755408B (en) | 2016-12-22 | 2016-12-22 | Plant allele imbalance expression detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755408B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831593B (en) * | 2021-03-16 | 2022-08-30 | 安徽省农业科学院园艺研究所 | SNP molecular marker primer for variety identification of red peach trees in early summer and identification and application method thereof |
| CN114023379B (en) * | 2021-12-31 | 2022-05-13 | 浙江迪谱诊断技术有限公司 | Method and device for determining genotype |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768635A (en) * | 2009-01-05 | 2010-07-07 | 中南大学 | ARMS-PCR method for mtDNA allelic gene typing and point mutation detecting |
| CN101792805A (en) * | 2010-03-18 | 2010-08-04 | 江苏省农业科学院 | Molecular markers of paddy endosperm low amylose content gene Wx-mq |
| CN102618626A (en) * | 2011-01-30 | 2012-08-01 | 杭州优思达生物技术有限公司 | Method and kit for rapidly detecting single nucleotide polymorphisms (SNPs) |
| CN104293896A (en) * | 2013-07-16 | 2015-01-21 | 北京林业大学 | Method of SNP locus genotyping |
-
2016
- 2016-12-22 CN CN201611200502.4A patent/CN106755408B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768635A (en) * | 2009-01-05 | 2010-07-07 | 中南大学 | ARMS-PCR method for mtDNA allelic gene typing and point mutation detecting |
| CN101792805A (en) * | 2010-03-18 | 2010-08-04 | 江苏省农业科学院 | Molecular markers of paddy endosperm low amylose content gene Wx-mq |
| CN102618626A (en) * | 2011-01-30 | 2012-08-01 | 杭州优思达生物技术有限公司 | Method and kit for rapidly detecting single nucleotide polymorphisms (SNPs) |
| CN104293896A (en) * | 2013-07-16 | 2015-01-21 | 北京林业大学 | Method of SNP locus genotyping |
Non-Patent Citations (2)
| Title |
|---|
| Enhanced Allele-Specific PCR Discrimination in SNP Genotyping Using 30 Locked Nucleic Acid (LNA) Primers;David Latorra,Krista Campbell, Andreas Wolter, J. Michael Hurley;《HUMAN MUTATIO》;20030731;第22卷(第1期);第79-85页 * |
| 两个ZmZF等位基因的分型及表达研究;胡焕春;《中国优秀硕士学位论文全文数据库 基础科学辑》;20090315;第1.2.1节至第2.3.4节，附录5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755408A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Danilova et al. | Application of inter simple sequence repeat (ISSR) polymorphism for detection of sex-specific molecular markers in hop (Humulus lupulus L.) | |
| CN109913572B (en) | Molecular marker tightly linked with spike length major QTL (quantitative trait locus) and application thereof | |
| KR101883117B1 (en) | SNP marker for selecting tomato cultivars resistant to tomato Bacterial wilt and use thereof | |
| Wang et al. | Development and characterization of 59 polymorphic cDNA‐SSR markers for the edible oil crop Sesamum indicum (Pedaliaceae) | |
| CN106755408B (en) | Plant allele imbalance expression detection method | |
| CN111321241B (en) | Molecular marker of wheat thousand-grain weight and grain length gene TaGS3-4A and application thereof | |
| CN111826426A (en) | Method for detecting molecular marker based on KASP technology | |
| CN111850161A (en) | Sand-melt aegilops 7SshChromosome specific molecular marker and application thereof | |
| McNeil et al. | Conversion of AFLP markers to high-throughput markers in a complex polyploid, sugarcane | |
| CN102732514B (en) | Identification method for chemotactic factor acceptor 9 gene used as molecular marker for bovine excellent superovulation trait and application of same | |
| KR101748366B1 (en) | Molecular marker for selecting tomato leaf mold resistant and selection method using the same molecular marker | |
| KR101630814B1 (en) | SNP molecular markers associated with distinction of grape understock variety and uses thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
| KR102142389B1 (en) | Molecular marker for discrimination of CMV-P1 resistant pepper cultivar and uses thereof | |
| CN114717352A (en) | Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof | |
| CN108103229B (en) | Candida krusei STR molecular marker and application thereof | |
| CN110904260B (en) | Molecular marker linked with apple fructose content QTL (quantitative trait locus) and application thereof | |
| KR101481734B1 (en) | Microsatellite marker of Korean Astragalus mongholicus and primer set for amplifying the same | |
| KR101955072B1 (en) | Snp markers for discrimination of raphanus sativus | |
| CN104293896B (en) | The method of SNP site genotyping | |
| KR102625086B1 (en) | Biomarkers for determining the maturation date of wheat | |
| CN116970734B (en) | SNP locus linked with cotton multi-ventricular control gene GaMV and application thereof | |
| CN112852996B (en) | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof | |
| CN103571919B (en) | Specific detection primers and detection liquid phase chip for HNF1B gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |