CN103947461B - A kind of scion variety that makes obtains the method for virus resistance and rna interference vector pCAMBIA2300-CP and transgenic method - Google Patents

Abstract

A kind of method of scion variety acquisition virus resistance and rna interference vector pCAMBIA2300-CP and transgenic method of making of the present invention belongs to plant transgenic technology and application thereof.(1) antiviral transgenic rootstock is prepared; (2) scion grafting is made to grow to described transgenic rootstock; It is characterized in that: described antiviral transgenic rootstock obtains for proceeding to rna interference vector, the target sequence of described rna interference vector is the gene fragment in target viral gene group.The test that method of the present invention is used for tomato scion variety acquisition virus resistance obtains good effect, for in the specific embodiment of tomato, the rna interference vector of structure is pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP or pCAMBIA2300-CMV5.Present invention also offers a kind of transgenic method of improvement.The antiviral plant that aforesaid method obtains effectively can evade the potential safety hazard of genetically modified food, and can substantially increase the efficiency obtaining antiviral transformed variety.

Description

A kind of scion variety that makes obtains the method for virus resistance and rna interference vector pCAMBIA2300-CP and transgenic method

In female case first time and for the second time notification of examiner's opinion, auditor points out that female case exists multinomial invention, does not possess unicity, and therefore applicant determines to carry out divisional application to the invention not obtaining protection in female case.The application is application number 201110315208.9(denomination of invention: a kind of scion variety that makes obtains the method for virus resistance and rna interference vector and transgenic method) divisional application.

Technical field

The present invention relates to plant transgenic technology and application thereof, particularly a kind of tomato scion variety that makes obtains the method for virus resistance and rna interference vector and transgenic method.

Background technology

Plant virus causes the major reason that the horticulture plant production output such as fruit tree, vegetables, flowers decline and product qualitative change is bad, and in agriculture production, virus disease is the second largest class disease being only second to fungi, owing to preventing and treating difficulty, have the title of " plant cancer ".The prophylactico-therapeutic measures that current plant virus is conventional has elimination virus source and traditional media, application detoxification technology, chemical control and breeding resistant variety etc., and wherein breeding resistant variety prevents and treats effective, the most most economical method of virus disease.Plant disease-resistant technology based on RNA perturbation technique, because of its feature such as high efficiency, specificity, plant virus resistance breeding presents considerable prospect.

Gene silencing or title RNA disturb (RNAinterference; RNAi) refer to due to transgenic sequence or invade the homology that the viral endogenous or exogenous gene sequence with being silenced has height outward, its transcription product forms double-stranded RNA (double-strandedRNA, dsRNA) structure, thus the homology target gene mRNA that degrades specifically, make it reticent (FireA. occurs, XuS., MontgomeryM.K., etal.Potentandspecificgeneticinterferencebydouble-strand edRNAinCaenorhabditiselegans [J] .Nature, 1998,391 (6669): 806-811).Because its interference effect is the post-transcriptional level occurring in target gene, therefore, also become PTGS (post-transcriptionalgenesilencing; PTGS).Plant RNA i has the features such as specificity, high efficiency, systematicness and inheritability.RNAi technology can be utilized to carry out gene functional research; Or the specialized character varient directly utilizing RNAi to create carries out plant improvement.Wherein RNAi technology achieves good achievement in research in plant virus resistance.RNAi is the defense mechanism that in eukaryote, ubiquitous exogenous nucleic acid (as virus) is invaded; it is that the RNA silence produced due to elicit virus (weak strain) degrades the result (FrankG.R. with pathogenic homology virus (strong strain) that existing research simultaneously shows that virus produces cross protection further; StuartA.M.andDavidC.B.GeneSilencingwithoutDNA:RNA-Mediat edCross-ProtectionbetweenViruses [J] .PlantCell; 1999,11:1207-1216).Utilize RNAi to support antiviral conventional strategy to be: the sequence selecting one section of Plant virus gene, be built in the mode of inverted repeats and transcribe the rear double-stranded RNA (hairpinRNA containing hairpin structure, hpRNA) or containing the ihpRNA(intron-hairpinRNA of intron) expression vector, be incorporated on plant gene by particle gun, virus vector transfection or agrobacterium mediation converted, expression in vivo dsRNA, the generation of direct or indirect induction RNAi, plays to antiviral object.And in hairpin structure research, think ihpRNA expression vector (HelliwellC higher than hpRNA expression vector silence efficiency, WaterhouseP.Constructsandmethodsforhigh-throughputgenesi lencinginplants [J] .Methods, 2003,30(4): 289-295).

Gardening plant kind and various in style, generally undergos the threat of virus by the gardening plant offspring of approach procreation of nourishing and generating.The numerous vegetables cultivated in current production, fruit and flowers all have tens to up to a hundred kinds, almost each kind has several to arrive tens of kinds of virus diseases, virus disease inhibits growth, the result of plant, reduce the Yield and quality of fruit, even cause dead tree, plant, once by virus infection, is injured lastingly by being with poison throughout one's life.Utilize genetic engineering technique to improve for each kind, improve its antiviral ability, a large amount of manpowers and financial resources need be spent though feasible.Grafting is one of method of many gardening plants breeding, and most fruit trees and Vegetable adopt propagation by grafiting.Grafting can keep the good character of scion variety, can utilize again the advantageous feature of stock.When using graft is bred, the different varieties in general one species adopts same stock, even some belong to together in different sorts also adopt same stock.The situation that such anvil is multiplex, makes improvement stock variety than improvement scion variety is many efficiently separately.

So-called phytogenic gene silencing refers to: dsRNA, the short range transmission that the gene silencing signals such as aberrantRNA or siRNA both can have been undertaken by plasmodesma, also (BrosnanC.A. can be transmitted by the long distance of the vascular system in plant, MitterN., ChristieM., etal.Nucleargenesilencingdirectsreceptionoflong-distance mRNAsilencinginArabidopsis [J] .ProcNatlAcadSciUSA, 2007, 104 (37): 14741-14746), (KalantidisK., SchumacherH.T., AlexiadisT., etal.RNAsilencingmovementinplants [J] .BiolCell, 2008, 100 (1): 13-26), and it is reticent to induce whole plant to produce system.DanielH. (DanielH.C is waited, FabioT.S., MiyaD.H, etal.PatternformationviasmallRNAmobility [J] .Genes & Dev, 2009,23:549-554) research show that microRNA can as a kind of regulation and control of signaling molecule involved in plant development of movement.Different reports is there is about the direction of transfer of reticent signal in plant.(the PalauquiJ.C. such as Palauqui, ElmayanT., PollienJ.M., etal.Systemicacquiredsilencing:transgene-specificpost-tr anscriptionalsilencingistransmittedbygraftingfromsilence dstockstonon-silencedscions [J] .EMBOJ, 1997,16 (15): 4738-4745.) take tobacco as examination material, the conduction of discovery PTGS is unidirectional, namely can only be transmitted to the scion of non-silence from the stock of silence, and (the SonodaS.andNishiguchiM.Grafttransmissionofpost-transcrip tionalgenesilencing:targetspecificityforRNAdegradationis transmissiblebetweensilencedandnon-silencedplants such as Sonoda, butnotbetweensilencedplants [J] .PlantJ, 2000, 21 (1): 1-8) research shows, the conduction of PTGS is twocouese, all can conduct from stock to scion or from scion to stock, but the conduction efficiency of PTGS from scion to stock is starkly lower than the conduction from stock to scion.(the Li Ming such as Li Ming, Jiang Shiling, Wang Youqun, Deng. post-transcriptional silencing signal can in Arabidopis thaliana graft quick bi-directional [J]. Science Bulletin, 2006,51 (2): 142-147) result shows, no matter uses RNAi type plant as stock or scion, gene silencing signal all can cause the minimizing of corresponding wild-type scion or stock target gene mRNA, and after genetic transcription is described, reticent signal can pass through grafting face bi-directional in Arabidopis thaliana body.But miRNA(microRNA) or amiRNA (artificialmiRNA) also do not find to transmit between graft, accordingly, the present inventor's hypothetical system gene silencing direction may be relevant with species or detection level or method, but the reticent signal that certainly can obtain the siRNA of overexpression relevant in transgenosis mode upwards can pass to scion from stock.

In plant, the initial clue about systemic gene silence is tested from tobacco grafting.(the PalauquiJ.C. such as Palauqui in 1997, ElmayanT., PollienJ.M., etal.Systemicacquiredsilencing:transgene-specificpost-tr anscriptionalsilencingistransmittedbygraftingfromsilence dstockstonon-silencedscions [J] .EMBOJ, 1997,16 (15): 4738-4745) in a bud grafting to another plant time, first that the Nitrite reductase of this plant is reticent, on the young shoot of grafting, this gene is also reticent.The gene be silenced in young shoot is identical with the gene be silenced in stock, has sequence-specific.(the SonodaS.andNishiguchiM.Grafttransmissionofpost-transcrip tionalgenesilencing:targetspecificityforRNAdegradationis transmissiblebetweensilencedandnon-silencedplants such as Sonoda, butnotbetweensilencedplants [J] .PlantJ, 2000,21 (1): 1-8) research also to draw similar conclusion, and prove after grafting, even if the PTGS that scion obtains also can keep when the stock of silence does not exist simultaneously.

In recent years, around genetically modified organism breeding, China achieves in line with international standards in GMO bio-safety management and safety evaluation research, and achieves the progress attracted people's attention.But the impact of resistance selectable marker's gene pairs food safety involved in related gene engineering, groups of people have doubt always, and the research of this project avoids this subject under discussion cleverly, because the systemic resistance that scion obtains, derive from the reticent effect of the microRNA in stock, therefore in theory, resistance marker will not be contained in grafting transgene silencing plant scion variety.In order to improve the ability of the anti-target viral of scion variety, if only need by improvement stock, reach the object strengthening scion variety and resist this target viral after grafting, a brand-new approach be opened up in the breed improvement for gardening graft by this.But up to the present, make scion variety obtain in the research of gene silencing effect by grafting method, target gene is all some genes of plant self, do not see the research report that consequently germ or virogene are target.

Summary of the invention

The present invention is according to the blank in above-mentioned field and demand, a kind of tomato plant that makes is provided to obtain the method resisting virus capable, and the method relates to rna interference vector, the transgenic method etc. improved, the antiviral plant that the method obtains effectively can evade the potential safety hazard of genetically modified food, and can substantially increase the efficiency obtaining antiviral transformed variety.

Make scion variety obtain a method for virus resistance, its step is as follows:

(1) antiviral transgenic rootstock is prepared;

(2) scion grafting is made to grow to described transgenic rootstock;

It is characterized in that: described antiviral transgenic rootstock obtains for proceeding to rna interference vector, the target sequence of described rna interference vector is the gene fragment in target viral gene group.

Described target viral refers to cucumber mosaic virus CMV, and described scion variety and transgenic rootstock are all tomato variety, the target sequence of described rna interference vector as SeqIDNo.1, shown in 2,3,4,5 or 6.

Described rna interference vector is pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP or pCAMBIA2300-CMV5.

The antiviral transgenic rootstock of described preparation, transgenosis comprises the steps:

(1). tomato is sowed, (2). cut cotyledon preculture, (3). the cotyledon after antibacterial screening and culturing agrobacterium tumefaciens engineering bacteria infects, (4). short differentiation culture, (5). root culture, is characterized in that:

5 ~ 8 hours are infiltrated through sterilized water before the planting seed of described tomato; 20% clorox sterilizing 10min, aseptic washing 5 times, each 5min; 30 DEG C of incubator vernalization two days;

Describedly cutting cotyledon preculture, is before true leaf does not occur, cut cotyledon carry out preculture;

Described antibacterial screening and culturing: infected and the light culture cotyledon of 2 days by agrobacterium tumefaciens, in culture medium C: pH6.0, MediumBase+2mg/L trans-zeatin nucleosides+200mg/L Ticarcillin/Clavulanate Acid+100mg/L kantlex, blade back is illumination cultivation upward, 10d transfers once, until there is green callus or bud point; The explant of band bud point is proceeded in culture medium C 1: cultivate 10 ~ 14d in pH6.0, MediumBase+1mg/L trans-zeatin nucleosides+80mg/L kantlex+200mg/L Ticarcillin/Clavulanate Acid, treat that differentiation is sprouted;

Described short differentiation culture: the resistant buds screened in micro-organisms is transferred in culture medium C 3: pH6.0, MediumBase+0.5mg/L trans-zeatin nucleosides+1.5mg/L3-indolylacetic acid+80mg/L kantlex+200mg/L Ticarcillin/Clavulanate Acid;

The substratum of described root culture is: pH6.0, MediumBase+2mg/LIBA+200mg/L Ticarcillin/Clavulanate Acid.

With the rna interference vector that cucumber mosaic virus virus gene is target, it is characterized in that, the target sequence of described rna interference vector as SeqIDNo.1, shown in 2,3,4,5 or 6.

Described rna interference vector is pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP or pCAMBIA2300-CMV5.

Transform the bacterial strain or the vegetable cell that there are above-mentioned rna interference vector.

Described bacterial strain refers to Agrobacterium tumefaciens strain EHA105.

Described vegetable cell refers to the explant precursor cell of transgenic Fructus Lycopersici esculenti stock.

Prepare a method for transgenic Fructus Lycopersici esculenti stock, comprise the steps:

(1). tomato is sowed, (2). cut cotyledon preculture, (3). the cotyledon after antibacterial screening and culturing agrobacterium tumefaciens engineering bacteria infects,

(4). short differentiation culture, (5). root culture, is characterized in that:

5 ~ 8 hours are infiltrated through sterilized water before the planting seed of described tomato; 20% clorox sterilizing 10min, aseptic washing 5 times, each 5min; 30 DEG C of incubator vernalization two days;

Describedly cutting cotyledon preculture, is before true leaf does not occur, cut cotyledon carry out preculture;

Described antibacterial screening and culturing: infected and the light culture cotyledon of 2 days by agrobacterium tumefaciens, in culture medium C: pH6.0, MediumBase+2mg/L trans-zeatin nucleosides+200mg/L Ticarcillin/Clavulanate Acid+100mg/L kantlex, blade back is illumination cultivation upward, 10d transfers once, until there is green callus or bud point; The explant of band bud point is proceeded in culture medium C 1: cultivate 10 ~ 14d in pH6.0, MediumBase+1mg/L trans-zeatin nucleosides+80mg/L kantlex+200mg/L Ticarcillin/Clavulanate Acid, treat that differentiation is sprouted;

Described short differentiation culture: the resistant buds screened in micro-organisms is transferred in culture medium C 3: pH6.0, MediumBase+0.5mg/L trans-zeatin nucleosides+1.5mg/L3-indolylacetic acid+80mg/L kantlex+200mg/L Ticarcillin/Clavulanate Acid;

The substratum of described root culture is: pH6.0, MediumBase+2mg/LIBA+200mg/L Ticarcillin/Clavulanate Acid.

The object of the invention is, by the combination of systemic gene silence with graft technology, first make the resistance of stock acquisition to intrusive viruses, then the transduction of its virus resistance makes the scion variety grafted on this stock obtain virus resistance by stock to scion.The thinking that the present invention is different from prior art is: the gene silencing of the rna interference vector for transformed rootstock of structure is to the gene liking intrusive viruses, and the gene of non-plant itself.

Be stock and scion examination material with tomato in the present invention, with host comparatively widely cucumber mosaic virus CMV carry out concrete verification experimental verification for target viral, experimental data shows, and scion tomato obtains good CMV virus resistance.Based on design of the present invention; the normal experiment technical ability that the guidance of the experimental technique recorded in specification sheets and those of ordinary skill in the art possess; those skilled in the art method of the present invention can be applied to a variety of be easy to by virus infection and can in the plant of grafting, this application is all in the scope of request protection of the present invention.That is, method of the present invention is not limited to be applied on the tomato recorded in specific embodiment.

The present invention take tomato as examination material, with cucumber mosaic virus (CucumberMosaicVirus; CMV) be target object, verify design of the present invention.Namely by selecting CMV5 gene OPF fragment and 1 to merge totally 6 ihpRNA plant expression vectors of 5 gene fragments respectively, adopting agrobacterium mediation converted tomato, making transformed plant produce siRNA, inoculate the transfer-gen plant that CMV filters out high antiviral.Afterwards with T0 or T1 of resistant plant on behalf of stock, the not genetically modified tomato of grafting, the siRNA in stock is transported in scion, to strengthen the resistance of scion to CMV.At present, in cultivated tomato kind, also find no the resistant gene to CMV virus, and also only there is tolerance to diseases kind in cultivated tomato kind, utilize conventional hybridization method to be difficult to obtain CMV resistant tomato kind.Therefore by the method for RNA interference of transgene, be the effective way obtaining CMV resistant material fast.In recent years, around genetically modified organism breeding, China achieves in line with international standards in GMO bio-safety management and safety evaluation research, and achieves the progress attracted people's attention.But the impact of resistance selectable marker's gene pairs food safety involved in related gene engineering, groups of people have doubt always.And the present invention avoids this subject under discussion cleverly, because the systemic resistance that scion obtains, derive from the reticent effect of the microRNA in stock.Therefore in theory, grafting transgene silencing plant scion variety genome and produce female/microgamete in will not contain resistant maker gene, prevent the drift of antibiotics resistance gene.

The present invention includes following steps:

A. for cucumber mosaic virus (CMV) 5 genes, by comparison tomato est database, choose the fragment in CMV5 gene ORF interval, build by PCR and over-lap PCR 5 have merged 5 gene fragments reticent expression vector of ihpRNA plant containing CMV gene-specific fragments and 1;

B. utilize the genetic conversion system after improvement, by agrobacterium mediation converted tomato plant, detect and obtain transgenic positive plant, cottage propagation transfer-gen plant (T0 generation);

C. by inoculation CMV virus, compare the CMV resistance of different carriers transgenic line, filter out the transgenic line of high antiviral;

D. utilize resistance cuttage seeding (T0 generation) or T1 to be stock for plant, grafting WT lines (non-transfer-gen plant), inoculation CMV virus, detects the grafting plant obtaining virus resistance;

E. extract stock and scion total serum IgE, be reversed to cDNA, the expression of RT-PCR detect antibiotics resistant gene.

Accompanying drawing explanation

Fig. 1: cucumber mosaic virus (CMV) genome structure feature

Fig. 2: the vector construction scheme that the present invention adopts

Fig. 3: 5 structures containing CMV gene specific fragment vector

M2K/15K：Marker2K/15K；

A: with PstI/SalI digestion verification cloning vector pUCCRNAi-1A ~ CP, to cut out small segment be the inverted repeats being built into cloning vector;

B: by the inverted repeats after cutting from pUCCRNAi-1A ~ CP enzyme, be built into expression vector and obtain pCAMBIA2300-1A ~ CP carrier;

C:1 ~ 3:PstI/SalI digestion verification expression vector pCAMBIA2300-1A ~ CP, to cut out small segment be the inverted repeats being built into cloning vector.

Fig. 4: containing the structure of 5 CMV gene fragment fusion vectors

A.1:Marker be 2K, utilize R1AF/R1AR and R2AF/R2AR primer amplification fragment 1AF and 2AF respectively;

A.2: utilize R1AF/R2AR primer, with 1AF and 2AF mixture for template, fragment 1A+2A is merged in amplification;

B.1: utilize R2BF/R ~ RCPF/R primer amplification fragment 2BF, 3AF and CPF respectively;

B.2: utilize R2BF/RCPR primer, with 2BF, 3AF and CPF mixture for template, fragment 2B+3A+CP is merged in amplification;

C.:CMV5 is for utilizing R1AF/RCPR primer, and with 1A+2A and 2B+3A+CP mixture for template, fragment CMV5 is merged in amplification;

D.:PstI, PstI/SalI enzyme is cut and is detected pCAMBIA2300-CMV5 carrier.

Fig. 5: the tomato transgenic step after the improvement that the present invention adopts

Fig. 6: the PCR of transgenic Fructus Lycopersici esculenti detects (part strain detects in batches)

M:Marker2K; +: plasmid pCAMBIA2300-1A is template; CK: non-transgenic Fructus Lycopersici esculenti MoneyMaker is mould 1A ~ CMV5-1 ~ 9: represent with Actin1PF/IntornR to be primer, the corresponding transgenic line of different target carrier is the band of template amplification

Fig. 7: the Southern hybridization check of transgenic Fructus Lycopersici esculenti part strain

M:Marker15K; +: plasmid pCAMBIA2300-1A is template (non-enzyme cuts entirely); CK: non-transgenic Fructus Lycopersici esculenti MoneyMaker is template; T01A ~ CMV5.1 ~ 2: represent different target carrier corresponding transgenic line Southern hybridising band

Fig. 8: the RT-PCR of Transgenic Tomato Plants detects

M:Marker2K; +: plasmid pCAMBIA2300-1A is template; CK: non-transgenic Fructus Lycopersici esculenti MoneyMaker is template; T01A ~ CMV5.1 ~ 2: represent respectively with 1AF ~ CPF and R1AF(T0CMV5) be upstream primer, IntronR is downstream primer, the band of the corresponding transgenic line of the different target carrier that increases

Fig. 9: the cottage propagation of transgenic Fructus Lycopersici esculenti and CMV attack poison and screen antiviral T0 for strain

CK: be non-Transgenic Tomato Plants MoneyMaker; T01A ~ CP.1 ~ 2 and T0CMV5.1 ~ 5: represent different transgenic line cuttage seeding, identifying virus resistance after inoculation CMV virus, in figure, strain is the part high resistance strain filtered out

Figure 10: the breeding in transgenic Fructus Lycopersici esculenti T1 generation and CMV attack poison and screen antiviral T1 for strain

CK: be non-Transgenic Tomato Plants MoneyMaker; Identifying virus resistance after T11A.1 ~ CMV5.1: represent different transgenic line T1 generation, inoculation CMV virus

Figure 11: the graft technology that the present invention adopts

Figure 12: after grafting, the RT-PCR of antibiotics resistance gene NptII detects

M:Marker2K; +: plasmid pCAMBIA2300-1A is template; CK: non-transgenic Fructus Lycopersici esculenti MoneyMaker is template; T01A ~ CMV5.1 ~ 2: represent with NptIIF/R to be the expression that the upper figure of PCR band that the corresponding transgenic line of the different target carrier of primer is template amplification shows without NptII gene in scion

Embodiment

Embodiment 1., for cucumber mosaic virus (CMV) gene, by comparison tomato est database, builds the reticent expression vector of 6 ihpRNA plants;

Cucumber mosaic virus (Cucumbermosaicvirus, CMV) is Bromoviridae (Bromoviridae) Cucumovirus (Cucumovirs) member.CMV is single stranded positive-sense RNA viruses.Gene element is RNA1, RNA2 and RNA3, and Genome Size is respectively 3389nt, 3035nt and 2197nt, is coated among three virions respectively, and wherein RNA3 is containing subgenomic RNA 4, total length 1000nt.RNA1 coding nucleic acid replicative enzyme; RNA2 encodes the RNA polymerase (RNA-dependentRNApolymerase that two albumen: RNA rely on, and 2b albumen RdRP), RdRP is relevant with infecting of virus, 2b protein is like a kind of viral movement protein, and 2b albumen can weaken the silence of the virogene of RNA mediation to have experiment to prove; RNA3 encodes a kind of motor protein 3A albumen, and its concrete function is not quite clear but relevant with the transmission between virocyte; RNA4 encoding virus coat proteins: CP albumen.The genomic specific features of CMV is as Fig. 1.

The present invention is directed to cucumber mosaic virus (CMV) 5 genes, by comparison tomato est database, choose the fragment in CMV5 gene ORF interval as (shown in SeqIDNo.1,2,3,4,5), build by PCR and over-lap PCR 5 have merged 5 gene fragments reticent expression vector of ihpRNA plant containing CMV gene-specific fragments and 1, concrete steps are as follows:

The primer that amplification 5 fragments are used respectively, underscore part is the restriction enzyme site introduced:

1AF：5'-ATT GTCGACTGGATGCGTCCTGTGC-3'

1AR：5'-ATC GGATCCTTGGGCGGACTTCTTG-3'；

2AF：5'-AAT GTCGACTGTCCAACGCCAACC-3'

2AR：5'-AGG GGATCCTTCGTTGTACCTACTC-3'

2BF：5'-ATT GTCGACTGGCTCGTATGGTGGA-3'

2BR：5'-GAG GGATCCGCGAACCAATCTGTAT-3'；

3AF：5'-ATA GTCGACAGCCCTGAAGCCATTA-3'

3AR：5'-AGA GGATCCAAAGACCCTTCAGCAT-3'；

CPF：5'-ATT GTCGACCTTTGTAGGGAGTGA-3'

CPR：5'-ATC GGATCCTTTACGGACTGTCA-3'；

The overlapping PCR primers that fragment is used is merged in amplification:

R1AF：5'-TAT GTCGACTGTGCCCGAGGGTATTG-3'

R1AR：5'-TCAGTAGCACGGTTTAAATTTACAGATCACGCATTCAC-3'

R2AF：5'-GTGAATGCGTGATCTGTAAATTTAAACCGTGCTACTGA-3'

R2AR：5'-TTCTTCGCCTCCACCATACGCTTGATGAAAAGAGTCGTCGT-3'

R2BF：5'-ACGACGACTCTTTTCATCAAGCGTATGGTGGAGGCGAAGAA-3'

R2BR：5'-TCCACTGATGCTGAAGGGTCTGATAGAACGGTAGGAAGCG-3'

R3AF：5'-CGCTTCCTACCGTTCTATCAGACCCTTCAGCATCAGTGGA-3'

R3AR：5'-CGAGTTAATCCTTTGCCGAACACGGTCGTATTGCTTCCTT-3'

RCPF：5'-AAGGAAGCAATACGACCGTGTTCGGCAAAGGATTAACTCG-3'

RCPR：5'-ATC GGATCCATCTATTACCCTAAAGCCAC-3'

Cloning vector detects primer:

M13+：5'-AGGGTTTTCCCAGTCACG-3'

M13-：5'-GTGTGAAATTGTTATCCGCTC-3'

Expression vector detects primer:

Actin1PF：5'-CCTCAGCATTGTTCATCGGTAGTT-3'

IntronR：5'-TGTGTCACTCAAAACCAGATAAAC-3'

Cloning vector: pUCCRNAi, be documented in (Luo, A., Qian, Q., Yin, H.etal. (2006) EUI1, encodingaputativecytochromeP450monooxygenase, regulatesinternodeelongationbymodulatinggibberellinrespo nsesinrice.PlantCellPhysiol.47,181 – 191.) in, also there is preservation in this laboratory, can provide for experimental study from the applying date in Two decades years to the public.

Plant expression vector: pCAMBIA2300-Actin1-ocs, is documented in (Fang, J., Chai, C., Qian, Q., Li, C., Tang, J., Sun, L., Huang, Z., Guo, X., Sun, C.andLiu, M.2008.Mutationsofgenesinsynthesisofthecarotenoidprecurs orsofABAleadtopre-harvestsproutingandphoto-oxidationinri ce.ThePlantJournal.2,177-189), also there is preservation in this laboratory, can provide for experimental study from the applying date in Two decades years to the public.

Two groups of isocaudarners in pUCCRNAi are utilized to cut site XhoI/SalI and BglII/BamHI in the present invention, to choose and the forward and reverse sequence of the fragment of fragment as shown in SeqIDNo.1,2,3,4,5 through CMV5 the gene ORF interval that pcr amplification obtains is building up in two groups of restriction enzyme sites of pUCCRNAi respectively, namely forward and reverse sequence of each fragment is building up in two groups of restriction enzyme sites RNAi cloning vector pUCCRNAi-1A, 2A, 2B, 3A, CP of obtaining having inverted repeats respectively; Partial Fragment in 5 fragments shown in SeqIDNo.1,2,3,4,5 to be connected together the fragment obtained shown in SeqIDNo.6 by over-lap PCR, the forward and reverse sequence construct of the fragment shown in SeqIDNo.6 is obtained RNAi cloning vector pUCCRNAi-CMV5 in two groups of restriction enzyme sites of pUCCRNAi, and primer is overlapping PCR primers above.

By the inverted repeat district of cloning vector pUCCRNAi-1A, 2A, 2B, 3A, CP, CMV5, be connected in plant expression vector pCAMBIA2300-Actin1-ocs after cutting with restriction endonuclease SalI/PstI enzyme, vector construction scheme as shown in Figure 2, plant expression vector pCAMBIA2300-1A, 2A, 2B, 3A, CP, CMV5 enzyme obtaining having ihpRNA is cut, digestion verification as Fig. 3, shown in 4.Sequencing result also shows the structure correct position of selected forward and reverse sequence.

Being transferred in competent escherichia coli cell by building the plant expression vector obtained, enlarged culturing, extracting plasmid and being used for Agrobacterium-mediated Transformation.Operate as follows:

Step 1.pUCCRNAi carrier segments enzyme is cut and recovery

Extract pUCCRNAi plasmid (Mini Kit of plasmid DNA) in intestinal bacteria.Get 5ul plasmid, utilize XhoI and BagII restriction endonuclease, adopt 50ul enzyme to cut system, 37 DEG C of enzymes cut through night, reclaim the plasmid fragments of about 3K length in digestion products; The ultraviolet spectrometry of DNA/RNA is adopted to detect the concentration that agarose gel electrophoresis analysis judges recovery fragment.Recovery fragment label is XhoI/BagII-pUCCRNAi.

Step 2.CMV gene PCR fragment enzyme is cut and recovery

Utilize primer 1AF/R ~ CPF/R, with containing on the infectious clone carrier of CMV full-length genome, by following PCR method, obtain 5 CMV gene fragments respectively, be recorded as 1A, 2A, 2B, 3A and CP respectively; Its accuracy of sequence verification;

The dilution of primer: the primer of synthesis directly being added deionized water, to be mixed with final concentration be 10umol/L.

Following composition is added successively in PCR pipe	50ul system	25ul system
			10×PCR Buffer with Mg2+	5ul	2.5ul
Template DNA	2ul	0.4-1ul
			10mM dNTP (mixing)	4ul	2ul
10uM primers F/primer R	2ul	1ul
			Taq enzyme	1ul	0.5ul
ddH2O	Mend to 50ul	Mend to 25ul

(2) after mixing, slightly centrifugal at the bottom of pipe, PCR pipe is put into PCR instrument, covers heat lid.First preheating heat lid before amplification.

(3) following amplification condition

94 DEG C of 3min denaturations, 94 DEG C of 30sec sex change; 50-68 DEG C of 30sec annealing; 72 DEG C of 1min extend (object fragment was greater than 500bp with 1 minute, was less than 500bp with 40 seconds), 35 circulations, 72 DEG C of 10min, 4 DEG C of preservations

Purifying reclaims PCR primer and obtains 5 CMV gene fragments respectively.Respectively get 20ul and reclaim fragment, utilize SalI and BamHI restriction endonuclease, adopt 50ul enzyme to cut system, 37 DEG C of enzymes cut 6h, reclaim the plasmid fragments of sequence length shown in corresponding SeqIDNo.1 ~ 5 in digestion products.Get 1ul and reclaim fragment, carry out gel electrophoresis and judge to reclaim quality.It is SalI/BamHI-1A, SalI/BamHI-2A, SalI/BamHI-2B, SalI/BamHI-3A, SalI/BamHI-CP that CMV reclaims fragment label.

The connection of step 3.pUCCRNAi-1A ~ CPF and transformation of E. coli

Get 4ulXhoI/BagII-pUCCRNAi and 8ulSalI/BamHI-1A, SalI/BamHI-2A, SalI/BamHI-2B, SalI/BamHI-3A, SalI/BamHI-CP to carry out in succession respectively:

	Reaction system	Reaction system
			10×T4DNA Ligation Buffer	2ul	5ul
T4DNA Ligase(1U/ul)	2ul	5ul
			Enzyme cuts back to close rear PCR fragment	8ul	20ul
Carrier (50-400ng)	4ul	10ul
			Aseptic deionized water	Supply 20ul	Supply 50ul

Flick, mixing, slightly centrifugal.16 DEG C of connection 20h that spend the night react to obtain and connect product.65 DEG C of 10min deactivations.

Get 10ul and connect product, by method (8. the conversion of e. coli plasmid dna) transformation of E. coli competence (competence intestinal bacteria Trans5aChemicallyCompetentCell is purchased from Beijing Quanshijin Biotechnology Co., Ltd)

(1) in the competence intestinal bacteria got ready in every control (100ul/ pipe), add 1-10ug plasmid DNA 3ul, (connect product and be no more than competent 1/10) flicks mixing.

(2) mixture is placed in during ice-water bath keeps 30min flicks mixing.

In (3) 42 DEG C of water-baths, thermal shock transforms 60sec, then proceeds to rapidly and puts 2min on ice, notes not shaking centrifuge tube.

(4) on Bechtop, the 500ulLB liquid nutrient medium of 37 DEG C of temperature baths of aseptic nonreactive is added, mixing.

(5) 37 DEG C of 200rpm vibration preculture 1h, obtain plasmid DNA transformation bacterium liquid.(period prepares the antibiotic flat board of band)

(6) the centrifugal 5min of 4000rpm removes supernatant 400ul, and remaining 50ul painting flat board of getting screens, when being coated with dull and stereotyped, with final concentration 50mg/L penbritin (Amp) for antibiotic-screening positive transformant.

(7) get positive single bacterium colony with the choicest of 20ul rifle, join in the 1mlLB liquid nutrient medium containing Amp, 6h cultivated by 250rpm37 DEG C of shaking table; Get 2ul bacterium liquid, by the PCR method of step 2 and system (utilize cloning vector detect primer M13+/-detect transformant, positive findings is that CMV gene fragment length adds 360bp, selects PCR test positive transformed bacteria, sequence verification; Obtain, for intestinal bacteria positive bacteria liquid, being labeled as pUCCRNAi-1AF, pUCCRNAi-2AF, pUCCRNAi-2BF, pUCCRNAi-3AF, pUCCRNAi-CPF respectively.

Step 4.pUCCRNAi-1A ~ CPF carrier segments enzyme is cut and recovery

Extract pUCCRNAi-1AF, pUCCRNAi-2AF, pUCCRNAi-2BF, pUCCRNAi-3AF, pUCCRNAi-CPF plasmid in intestinal bacteria respectively.

Get 5ul plasmid respectively, utilize SalI and BamHI restriction endonuclease, adopt 50ul enzyme to cut system, 37 DEG C of enzymes cut through night, reclaim the plasmid fragments of about 3K length in digestion products; Get 1ul and reclaim fragment, the ultraviolet spectrometry detection of Application way DNA/RNA and agarose gel electrophoresis analysis judge the concentration reclaiming fragment.5 are reclaimed fragment and are labeled as SalI/BamHI-pUCCRNAi1AF, SalI/BamHI-pUCCRNAi2AF, SalI/BamHI-pUCCRNAi2BF, SalI/BamHI-pUCCRNAi3AF, SalI/BamHI-pUCCRNAiCPF respectively.

The connection of step 5.pUCCRNAi-1A ~ CP and transformation of E. coli

By the carrier in step 3 and gene fragment method of attachment, get in step 4 and obtain carrier enzyme and cut back to close the 5 kinds of CMV genes obtained in fragment and step 2, respectively by combination

SalI/BamHI-pUCCRNAi1AF+SalI/BamHI-1A、

SalI/BamHI-pUCCRNAi2AF+SalI/BamHI-2A、

SalI/BamHI-pUCCRNAi2BF+SalI/BamHI-2B、

SalI/BamHI-pUCCRNAi3AF+SalI/BamHI-3A、

SalI/BamHI-pUCCRNAiCPF+SalI/BamHI-CP, connects, and adopts 20ul system after adding other components, and 16 DEG C of connections are spent the night;

Get 10ul and connect product, transformation of E. coli competence (the same step 3) of method, get 2ul positive bacteria liquid and adopt 50ul system by method, utilize cloning vector to detect primer (M13+/-) and carry out PCR and detect the transformant positive (positive findings is that 2 × CMV gene fragment length adds 360bp); Select PCR positive transformants bacterium, sequence verification; Being verified result is positive transformed bacteria, is labeled as pUCCRNAi-1A, pUCCRNAi-2A, pUCCRNAi-2B, pUCCRNAi-3A, pUCCRNAi-CP respectively.

Step 6.pCAMBIA2300-Actin1-ocs carrier segments enzyme is cut and recovery

Extract pCAMBIA2300-Actin1-ocs plasmid in intestinal bacteria.Get 5ul plasmid, with SalI and PstI restriction endonuclease, adopt 50ul enzyme to cut system, 37 DEG C of enzymes cut through night, reclaim the plasmid fragments of about 10Kb length in digestion products; Get 1ul and reclaim fragment, utilize the ultraviolet spectrometry detection of DNA/RNA and agarose gel electrophoresis analysis to judge to reclaim the concentration of fragment.

Recovery fragment label is SalI/PstI-pCAMBIA2300.

Step 7.1A ~ CPihpRNA fragment enzyme is cut and recovery

PUCCRNAi-1A, pUCCRNAi-2A, pUCCRNAi-2B, pUCCRNAi-3A, pUCCRNAi-CP plasmid in the positives transformed bacteria of extraction step 5.Get 5ul plasmid, with SalI and PstI restriction endonuclease, adopt 50ul enzyme to cut system, 37 DEG C of enzymes cut through night, reclaim the small segment (ihpRNA fragment adds intron fragment containing forward and reverse CMV gene specific fragment) of about 700bp length in digestion products; Get 1ul and reclaim fragment, utilize the ultraviolet spectrometry of DNA/RNA to detect the concentration that agarose gel electrophoresis analysis judges recovery fragment.5 are reclaimed fragment and are labeled as SalI/PstI-1A, SalI/PstI-2A, SalI/PstI-2B, SalI/PstI-3A, SalI/PstI-CP respectively.

The connection of step 8.pCAMBIA2300-1A ~ CP and transformation of E. coli

Get the connection that SalI/PstI-1A, SalI/PstI-2A, SalI/PstI-2B, SalI/PstI-3A, SalI/PstI-CP that SalI/PstI-pCAMBIA2300 and 8ul step 7 that 4ul step 6 obtains obtains carry out carrier and gene fragment respectively, method is with step 3.

Get 10ul respectively and connect product, transformation of E. coli competence, operates the record of same step 3;

Get 2ul transformed bacteria liquid, adopt 50ul system, utilize expression vector to detect primer Actin1PF/IntronR(upstream primer Actin1PF and be matched with expression vector Actin1 promoter region, downstream primer IntronR to be matched with in ihpRNA structure in Intron) carrying out PCR, to detect transformant positive, (positive findings is that CMV gene fragment length adds about 323bp);

Select PCR positive transformants bacterium, 1:1000 joins 50ml containing in the LB liquid nutrient medium of Amp by volume, and 12h cultivated by 250rpm37 DEG C of shaking table; Extract plasmid, gained plasmid is labeled as pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP respectively.

Step 9. builds pCAMBIA2300-CMV5 carrier

Respectively with pUCCRNAi-1A and pUCCRNAi-2A plasmid for template, utilize primer R1AF/R1AR and R2AF/R2AR amplified fragments 1AF and 2AF respectively, reclaim PCR primer and obtain fragment 1AF and the 2AF of purifying; With fragment 1AF and 2AF equal amount of mixture for template, utilize R1AF/R2AR primer, pcr amplification goes out fragment 1A+2A, reclaims the fragment 1A+2A that PCR primer obtains purifying.

Respectively with pUCCRNAi-2B, pUCCRNAi-3A and pUCCRNAi-CP plasmid for template, utilize primer R2BF/R2BR, R3AF/R3AR, RCPF/RCPR amplified fragments 2BF, 3AF and CPF, reclaim PCR primer and obtain the fragment 2BF of purifying, 3AF and CPF; With fragment 2BF, 3AF and CPF equal amount of mixture for template, utilize R2BF/RCPR primer, pcr amplification goes out fragment 2B+3A+CP, reclaims purifying.

With fragment 1A+2A and 2B+3A+CP equal amount of mixture for template, utilize R1AF/RCPR primer, pcr amplification goes out fragment CMV5, reclaims purifying in addition.

PUCCRNAi-CMV5 is obtained by the operation of upper 3 steps, cut pUCCRNAi-CMV5F by the operation enzyme of step 4 and obtain SalI/BamHI-pUCCRNAiCMV5F, by step 5 obtain cloning vector pUCCRNAi-CMV5 and and obtain SalI/PstI--CMV5 by the method for step 7, the SalI/PstI--CMV5 SalI/PstI-pCAMBIA2300 in step 6 and step 7 obtained obtains expression vector pCAMBIA2300-CMV5 according to the operation of step 8.

The functional verification of embodiment 2.RNA interference carrier

Material:

ZT(Trans-Zeatin-Riboside, trans-zeatin nucleosides), Tim(Timentin, Ticarcillin/Clavulanate Acid), folic acid, As(acetyl butanone), Kan(kantlex), IAA (3-indolyl acetic acid), IBA (3-indolebutyric acid), MSsalt(M0404) equal available from Sigma.

Tomato variety: MoneyMaker, this kind is CMV susceptible kind.

Substratum is prepared: (unit: L)

(1) 1/2MS:pH5.81/2MSsalt+15g| sucrose+6.5g| agar

(2) culture medium A: pH5.8MSsalt+30g| sucrose

(3) substratum B:pH5.8MSsalt+30g| sucrose+6.5g| agar+1mg|ZT

(4) substratum Base:pH6.0MSsalt+20g| sucrose+6.5g| agar+100mg| inositol+0.1mL|10000 × folic acid

(5) culture medium C: pH6.0MediumBase+2mg|ZT+200mg|Tim+100mg|Kan

(6) culture medium C 1:pH6.0MediumBase+1mg|ZT+80mg|Kan+200mg|Tim

(7) culture medium C 3:pH6.0MediumBase+0.5mg|ZT+1.5mg|IAA+80mg|Kan+200mg|Tim

(8) substratum D:pH6.0MediumBase+2mg|IBA+200mg|Tim

Method:

Embodiment 1 obtains and identified 6 kinds of plant expression vector pCAMBIA2300-1A, 2A, 2B, 3A, CP, CMV5 with ihpRNA, all target fragments SeqIDNo.1 ~ 6 wherein, compare with tomato est database http://solgenomics.net/, all fragments and tomato EST, all without the complete complementary region of continuous more than 20nt, this ensure that the siRNA that RNAi carrier is formed in transgenic plant can not target tomato plant important gene.

Step 1. prepares transfer-gen plant

In the inventive method, to existing tomato genetic conversion system (Frary, A.andVanEck, J.2005.OrganogenesisFromTransformedTomatoExplants.Transg enicplants:methodsandprotocols.141-150.) improve, shorten transformation time.Its key step is as follows: see (Fig. 5):

(1) 6-7d is sowed: seed sterilized water infiltrates 5 ~ 8h; 20% clorox sterilizing 10min; Aseptic washing 5 times, at every turn about 5min; 30 DEG C of incubator vernalization two days; Treat that seed shows money or valuables one carries unintentionally, point is sowed in 1/2MS substratum, then proceeds to 26 ~ 28 DEG C of illumination boxs and cultivates about 5d, and cotyledon just can start to launch.Improvement place: after soaking, vernalization can be shortened and sprouts about 1 week, and sprout neatly.

(2) cut cotyledon preculture 2d: before true leaf does not occur, cotyledon just emerged seed coat and do not launch completely time, by cotyledon two tip cut-off 1-2mm, again from middle crosscut one cutter, each cotyledon is cut into two pieces, is collected in the culture dish containing culture medium A, about 50 ~ 80 at every turn.Outwell culture medium A, with scalper carefully by leaf dish (not crushing) dial on aseptic filter paper, be connected to the substratum B being coated with filter paper after blotting, cotyledon blade face upward, low light level preculture 2d.Improvement place: the cotyledon collected by period of the present invention, after differentiation efficiency will occur higher than true leaf far away.

(3) preparation of engineering bacteria:

A. regulate electric shock instrument, make its electricimpulse be 25uF, voltage is 2.5KV, and resistance is 400 Ω.

B. from-70 DEG C of refrigerators, take out Agrobacterium EHA105 competent cell, be placed in and make it melt on ice.

C. add 1ul plasmid in 50ulEHA105 competent cell, mix gently.

D. above-mentioned mixing suspension is added the bottom of electric shock cup, put electric shock cup into electric shock instrument rapidly.

E. by the parameter set in a, the electricimpulse to cell is started.After electric shock, take out sample as early as possible, add 1ml nonreactive YEB substratum.

F. the bacterium liquid obtained in e is proceeded in 1.5ml centrifuge tube, 28 DEG C of 200rpm vibration preculture 3h.

G. get 50-100ul bacterium liquid be coated on be added with microbiotic Kan and Rifampin (Rif) YEB substratum on, 28 DEG C cultivate 2-3 days, until bacterium colony grows.

Attention: all operations preferably carries out on ice, in precooling on ice before electric shock cup electric shock.

H. microwave oven fusing LB solid medium, after being cooled to about 50 DEG C, Bechtop adds corresponding microbiotic (being generally Amp).

I. the IPTG(50mg/ml of 16ul is added after bed board 20ml/ block at planar surface), the X-gal (20mg/ml) of 40ul, evenly spreadable with aseptic elbow glass stick, lucifuge is placed in Bechtop 1h, and volatilization is clean as far as possible to make the dimethylformamide of dissolving X-gal.

J. on flat board, transformed bacteria liquid is added, evenly spreadable with aseptic elbow glass stick, (the 4 DEG C of preservations of residue bacterium liquid).

K. dull and stereotyped forward places 1h, and bacterium liquid is absorbed.Then be inverted in incubator, 37 DEG C of 12-16h have been cultured to clear bacterium colony and have occurred.

L. be positioned over 4 DEG C of refrigerators after growing blue hickie, make it abundant colour developing (hickie may for positive colony, chooses to be bacterium colony PCR after doing enlarged culturing or plasmid PCR/enzyme cuts detection).

(4) engineering bacteria infects and Dual culture 2d: engineering bacteria shifts to an earlier date 2d line, shakes bacterium about 16h to OD600=0.6 ~ 0.8 under then choosing single bacterium 26 DEG C of dark conditions.5000rpm, centrifugal 5min collects bacterium liquid, is adjusted to about OD600=0.5, adds the AS that final concentration is 300uM by culture medium A.Infect the leaf dish explant 10min that preculture is crossed, aseptic filter paper blots, and blade back is placed in upward (not crushing) is coated with on the substratum B of filter paper, 26 DEG C of light culture 2d.

(5) antibacterial screening and culturing 7-10d: proceed in culture medium C, blade back is illumination cultivation upward; Once, within about 2 weeks, just can there is green callus or bud point under normal circumstances in 10d switching.Treat that in callus, bud point occurs.Then band bud point explant is proceeded to C1 and cultivate 10 ~ 14d, within 2 ~ 3 weeks, just can break up successively and sprout.Improvement place: high density ZT(2mg/L) be beneficial to division, but split speed is too fast that negative regeneration bud may be caused to escape microbiotic, reduces in time ZT and also in C, can prevent situation here with higher Kan concentration (100mg/L) in C1 substratum of the present invention.

(6) short differentiation culture 10 ~ 20d: bud to be regenerated grows about 0.5cm.Cut albefaction explant part and resistant buds is proceeded to fresh C3.The leaf dish do not sprouted, part meeting albefaction, cut ends brownization be sign and nothing goes out to heal, and this type of leaf dish should remove in time.Have the leaf dish growing regeneration bud ability, general otch there will be little callus, and differentiation is sprouted then.Improvement place: be in for a long time in ZT and easily form lopsided bud, the present invention improves culture medium C 3 and contains lower concentration ZT and add growth hormone IAA, effectively can promote differentiation and the growth of normal bud.

(7) root culture 15 ~ 30d: after 1cm grows in resistant buds stem, rejects callus, cuts and insert substratum D root culture.Improvement place: microbiotic Kan is remarkable to plant Rooting effect, the present invention not added with antibiotic Kan in root media, effectively can improve rooting rate.

(8) field is cultivated: transplant and slowly open bottle cap in first 3 days, wrap, progressively open plastics bag, transplant to land for growing field crops after 1 week after proceeding to sterilizing compost with transparent plastic bag.2d clorox wiping blade to be detected before PCR detects, blade sterilized water carries out subsequent detection after cleaning again.

The effectiveness comparison of aforesaid operations method of the present invention and existing common method:

: after soaking, vernalization can be shortened and sprouts about 1 week, and sprout neatly (1).

(2) after: the cotyledon collected by period of the present invention, differentiation efficiency will occur higher than true leaf far away.

The cotyledon adopting collect period of the present invention namely " before true leaf does not occur, cotyledon just emerged seed coat and do not launch completely time " differentiation efficiency reaches 100%(and occurs Bud Differentiation number/leaf dish number) and each leaf dish can differentiate the sprout of more than 2; 2d after true leaf occurs, investigation differentiation efficiency is 50%; 5d after true leaf occurs, investigation differentiation efficiency is less than 10%.

(3): reduce ZT in time in C1 substratum of the present invention and effectively can prevent false positive by higher Kan concentration in C.

Adopt resistant buds false positive rate (the false positive bud number/Bud Differentiation number) average out to 24% that the inventive method obtains; If utilize 2mgZT, false positive rate is 40%.Attention: the present invention adopts Kan concentration to be applicable to MoneyMaker kind, and we tested tomato variety beautiful spring and mic-Tom, and its suitable concentration is respectively 50mg/L and 75mg/L.

(4): the present invention improves culture medium C 3 and contains lower concentration ZT and add growth hormone IAA, effectively can promote differentiation and the growth of normal bud.

The inventive method resistant buds abnormal rate (lopsided bud number/resistant buds number) is 5%, and do not add IAA and differentiation after bud be placed in the abnormal rate of 1mg/LZT bud up to 22% always.

(5): Kan is on the impact of taking root.

The present invention tests different concns to the impact of taking root, and due to transgenic positive bud limited amount, selected bud is the bud that the cotyledon do not infected differentiates, each 20.100mg/L concentration Kan plant rooting rate (the plant number/sprout number of taking root after 2 weeks) 10%(2 strain); 75mg/L concentration Kan plant rooting rate 40%(8 strain); 50mg/L concentration Kan plant rooting rate 60%(12 strain); 0mg/L concentration Kan plant rooting rate 90%(18 strain).To in 1 month after 2 weeks, the plant that do not take root under 100mg/L concentration Kan does not take root always, and yellow leaf or bleach; 3 strains and the long root of 2 strains is added respectively under 75mg/L and 50mg/L concentration Kan; Remain 2 strains under 0mg/L concentration Kan and also occur root.

Step 2. fast PCR detects.

The PCR utilizing GenStar quick-speed plant PCR kit and specification sheets to carry out transgenic plant detects, and use primer is:

Actin1PF：5'CCTCAGCATTGTTCATCGGTAGTT3'，

IntronR:5'TGTGTCACTCAAAACCAGATAAAC3', and

NptIIF：5'GATACCGTAAAGCACGAGGAA3'

NptIIR：5'TGACTGGGCACAACAGACAAT3'

The PCR that application special primer antagonism plant carries out virogene detects.

With NptIIF and NptIIR for primer, carry out the detection of NptII resistant maker gene, amplification object fragment should be 673bp fragment.

With intron IntronR in Vector promoter district design upstream primer Actin1PF and carrier for downstream primer, amplification object fragment detects Insert Fragment, according to the detected result determination positive transgenic plant of such as Fig. 6.

Step 3. transfer-gen plant Southern hybridization analysis

To the positive plant detected through PCR, get its tender leaf, extract STb gene by CTAB method, cut with EcoR I enzyme, carry out Southern hybridization analysis, determine the integration of external source object fragment in different transfer-gen plant further.Operate as follows:

Probe mark:

With to the DNA of the positive plant detected through PCR for template, with dUTP(Roche) mixture carries out secondary PCR and to increase to obtain the probe of dUTP digoxigenin labeled.

The a large amount of enzyme of genome is cut:

(1) enzyme cuts system:

Genomic dna 60ug is about 100ul

10×BufferH60ul

Restriction endonuclease (EcoRI) 30ul

Final volume 600ul

(2) 37 DEG C of temperature baths are spent the night; Get the electrophoretic analysis of 5ul digestion products, detect enzyme and cut effect;

(3) enzyme cuts entirely, adds the dehydrated alcohol (-20 DEG C) of 0.1 times of volume (60ul) 3mol/LNaAc and 2 times (1200ul) volume, places 2h after mixing in-20 DEG C;

(4) 12000rpm, 4 DEG C of centrifugal 10min, carefully abandon supernatant; Add 1ml75% ethanol and wash one time, dry up precipitation in super clean bench, be dissolved in 30ulddH2O for subsequent use.

(5) with the sepharose of 0.5 × TBE preparation 1%, gel thicknesses is about about 0.5cm; Adding detection sample: 30ul(is about 10ug) DNA enzymatic cuts concentrated solution and adds 6 × bromjophenol blue solution; 120V voltage (being about 6V/cm) electrophoresis 5min, treats that bromjophenol blue enters after in glue, voltage is down to 100V(and is about 4V/cm), electrophoresis 2h.

DNA sex change:

(1) bromjophenol blue migrates to apart from glue hole 8-10cm(3/4) left and right stops electrophoresis, and from glue groove, take out blob of viscose, redundance beyond blob of viscose swimming lane is cut, the length of correct amount plastic emitting and wide, cut gel one jiao as mark;

(2) glue is contained in large culture dish, the unrestrained Denaturation solution of leaching, and on shaking table, gentle shake 15min × 2 time, make DNA sex change;

(3) glue ddH2O is washed a little, put into Nenutralization solution and do not have glue 15min × 2 time (not shaking).Transferring film/fixing film:

(1) whatman grinding tool (TurboBlotter is utilized ^tMtransfer implement), fold on request, put 4 layers of large thieving paper well, then put 5 layers of 4*7cm thieving paper, top layer puts 2 layers of smooth thieving paper; Put nylon membrane (2*SSC steeps a 5min in advance) glass rod being slightly greater than below thieving paper above smooth thieving paper well and carefully drive bubble between nylon membrane and smooth thieving paper away; Take out gel, cut flat carefully with blade by the gel that Jiao Kongchu is outstanding, glue hole is upwards placed on absorbent cloth center.Bubble between gel and filter paper is driven away with glass rod; Cut one 3 times to the wide salt bridge paper of glue, cover on glue, and 20 × SSC in grinding tool ditch is linked up, covering thieving paper on it in folding two ends;

(2) take out nylon membrane after transferring film 4h, be put on a filter paper, on nylon membrane, indicate position and the sample number of loading wells with pencil;

(3) take out nylon membrane, in conjunction with DNA one side upwards, lie against on filter paper that 10 × SSC soaks, crosslinked twice of UV-crosslinked 1200*100uj/cm2.

Prehybridization, hybridization:

(1) prehybridization: nylon membrane is put into hybrid pipe, adds the hybridization solution of appropriate 30ml42 DEG C preheating, 42 DEG C of prehybridization 30min in hybrid heater;

(2) probe sex change: get appropriate probe (adding about 25ng probe in the hybridization solution of 1ml), add ddH2O to 100ul, 95 DEG C of 5min, are placed in rapidly on ice;

(3) probe of sex change is joined the hybridization solution of 42 DEG C of preheatings, mix gently, prevent bubble from background is deepened;

(4) pour out prehybridization solution, add hybridization solution, jog, 41 DEG C (NptII) hybridize 4h or spend the night.

Wash film and color developing detection:

(1) size to fit, clean plastics casing are put in the film of having hybridized taking-up, with low rigorous film washing liquid rinsing 2 times (shaking gently during rinsing) under room temperature, each 5min;

(2) with the 68 DEG C of rinsings twice of the rigorous film washing liquid of the height of 68 DEG C of preheatings, each 15min;

(3) Washingbuffer rinsing 3min gently;

(4) add 50ml1 × blockingsolution room temperature and foster 30min;

(5) 20mlAnti-bodysolution room temperature reaction 30min is added;

(6) film is washed 2 times, each 15min with Washingbuffer;

(7) add 20mlDetectionbuffer and balance 2-5min;

(8) film is placed in a clean culture dish, adds the addition of C olorsubstratesolution, lucifuge colour developing 16h, does not shake; Outwell nitrite ion, add TEbuffer rinsing 5min and stop color reaction.

Main agents and preparation:

(1) 20 × SSC: take 175.3gNaCl and 88.2g Trisodium Citrate, is dissolved in 800ml distilled water, adjusts pH to 7.0, be settled to 1L, autoclaving, room temperature preservation with distilled water with HCl;

(2) 1MTris-HCl(pH8.0): take 12.114gTris-base, be dissolved in 80ml distilled water, after adjusting pH to 8.0 with HCl, be settled to 100ml with distilled water, autoclaving, room temperature preservation;

(3) 0.5MEDTA(pH8.0): take 18.61gEDTA, be dissolved in 80ml distilled water, after adjusting pH to 8.0 with NaOH, be settled to 100ml with distilled water, autoclaving, room temperature preservation;

(4) TEBuffer: get 1MTris-HCl(pH8.0) 5ml, 0.5MEDTA(pH8.0) 1ml, be settled to 500ml with distilled water, adjust PH to 8.0, autoclaving, room temperature preservation;

(5) 10%SDS: take 10gSDS, is dissolved in 90ml distilled water, is heated to 68 DEG C of dissolvings, adjusts pH to 7.2, be settled to 100ml with hydrochloric acid;

(6) MaleicAcidBuffer: take 11.067g toxilic acid and 8.766gNaCl is dissolved in 800ml distilled water, solid with NaOH() adjust pH to 7.5, be settled to 1L with distilled water, autoclaving, room temperature preservation;

(7) 0.3% (v/v) polysorbas20 is added after WashingBuffer:MaleicAcidBuffer sterilizing;

(8) DetectionBuffer: take 1.1688gNaCl and be dissolved in 100ml distilled water, add 20ml1MTris-HCl(pH8.0), after adjusting pH to 9.5 with NaOH, be settled to 200ml with distilled water, autoclaving, room temperature preservation;

(9) sex change liquid I (Denaturation solution): 16gNaOH, 58.43gNaCl are settled to 1L, autoclaving, room temperature preservation;

(10) sex change liquid II (Nenutralization solution): 58.43gNaCl, 0.5MTris-HCl(pH7.2) 500ml is settled to 1L, autoclaving, room temperature preservation.

(11) low rigorous film washing liquid: 20 × SSC is diluted with distilled water into 2 × SSC, and by 100:1(2 × SSC:10%SDS) add 10%SDS, be made into 2 × SSC/0.1%SDS;

(12) high rigorous film washing liquid: 20 × SSC is diluted with distilled water into 0.5 × SSC, and by 100:1(2 × SSC:10%SDS) add 10%SDS, be made into 0.5 × SSC/0.1%SDS;

(13) BlockingSolution: 10 × Blockingsolution is diluted 10 times (Fresh) with MaleicAcidBuffer;

(14) AntibodySolution: by centrifugal for Anti-Digoxigenin-AP10000rpm 5min, dilute by 1:5000 BlockingSolution;

(15) Colorsubstratesolution: NBT/BCIP is pressed 1:50 (200ul:10ml) DetectionBuffer and dilute, keep in Dark Place;

The present invention obtains 63PCR positive transformants plant (wherein 1A9,2A11,2B12,3A8, CP13, CMV510) altogether, and part southern results of hybridization, as Fig. 7, finds that positive plant exists mainly with multiple copied form.

The RT-PCR of step 4. transfer-gen plant siRNA precursor detects

To through step 2 Molecular Detection being positive tomato transgenic strain, extract RNA, reverse transcription synthesis cDNA, utilize 1AF ~ CMV5 and IntronR for primer, RT-PCR detects the expression of siRNA precursor, result is as Fig. 8, and the precursor showing each positive strain has expression, proves that constructed plant expression vector obtains expression in successful conversion to tomato.

Embodiment 3. cottage propagation transfer-gen plant determines the resistance of each target gene transgenic line.

Survive rear needs reserve seed for planting because transgenic positive plant T0 generation forwards land for growing field crops to from sterilisable chamber, be not suitable for direct virus inoculation.Therefore the present invention adopt the mode of cuttage carry out nutrition expand numerous, can address this problem.Meanwhile, owing to being nourish and generate, numerous can providing more with the stock material of genetic background for follow-up grafting is expanded in cuttage.

Step 1. plant to be planted grows to certain altitude, maternal plant is for obtaining seed, get the lateral bud that axil portion grows, or get the stem section of one, band knot, lateral bud or stem section are collected in clean triangular flask, add the sterilized water 50ml containing 0.2mg/LIBA, bottom 1 ~ 2 week rear side bud, new root (stem section is slightly slow) can be sent.Plant after taking root is proceeded in the substratum after sterilizing, is placed in greenhouse and cultivates.It is all positive that fast PCR detects cuttage seeding.

Be used for subsequent viral inoculation when launching etc. cuttage seeding 4 leaf to detect.

The determination of the inoculation system of step 2. cuttage seeding CMV virus

By following GB methodology to cuttage seeding (contrast MoneyMaker; MM) virus inoculation, 21 days afterwards a lot of cuttage seeding non-evident sympton produce, and just there is classical symptom after 50 ~ 60 days.This is presumably because that cuttage seeding is relative to seedling, having spent the virgin phase comes to the ripening period, and its resistance to sick ability has had certain raising.For shortening qualification time and obtaining reliable disease resistance result, frictional inoculation (twice) changes at continuous three times (1 week, interval) by the present invention, observes and finds that all contrast cuttage seeding all occurred symptom at about 30 days.Therefore determine, cuttage seeding from maternal plant be separated survive after, treat that cuttage plant 4 leaf starts to inoculate CMV virus, every multiple connection in a week once, totally 3 times, grow 30 " Invest, Then Investigate " CMV virus resistances.

Operation steps:

(1) 0.03mol/L, pH8.0 phosphoric acid buffer is prepared.A:0.03mol/L disodium phosphate soln: take 10.74 grams of Na2HPO4 and be dissolved in 1000mL water, shake up.B:0.03mol/L potassium dihydrogen phosphate: take 4.08 grams of potassium primary phosphates and be dissolved in 1000mL water and shake up.Allocating A liquid pH value with B liquid is 8.0.

(2) preparation of virus: tomato CMV virus is in the upper breeding of common cigarette " the withered spot three lives ", and adopt down after virus morbidity and weigh, add phosphoric acid buffer in the ratio of 1:5, smash to pieces, double gauze uses after filtering immediately.

(3) inoculation method: carry out first time inoculation when tomato grows to 2 true leaves, silicon carbide (600 order) (to be spread the surface to plant to be seeded with powder sprayer by frictional inoculation; Adopt frictional inoculation method, the finger namely fully cleaned dips inoculation suspension, slightly rubs cause microtrauma on blade face, and every strain inoculation 1st ~ 2 true leaves, rinse viral juice unnecessary on blade face with clear water after inoculation immediately.Inoculation twice, interval 3d ~ 5d.Be seeded in greenhouse and carry out, the room temp inoculating the same day is 26 DEG C ~ 30 DEG C, and later day temperature controls, at 24 DEG C ~ 30 DEG C, to be not less than 20 DEG C night, conventional illumination, normal cultivation management as far as possible.

(4) Disease investigation and grade scale

The division of the tomato virus disease state of an illness rank that table 1 cucumber mosaic virus causes

	symptom describes
		0	without illness.
1	the vein of lobus cardiacus is bright arteries and veins, and 1 ~ 2 true leaf presents floral leaf.
		3	middle and upper part blade floral leaf.
5	most blade floral leaf, minority leaf malformation or obviously shrinkage.
		7	the heavy floral leaf of most blade, partial blade is lopsided, elongated, and plant is obviously downgraded.

9	the heavy floral leaf of nearly all blade, most leaf malformation, fern leaf.Plant is seriously downgraded, even withered.

(5) control time: about 21d carries out after inoculation.

(6) state of an illness is recorded: the state of an illness rank of each qualification plant is recorded in investigation, and calculates disease index.Disease index is by following formulae discovery:

$\mathrm{DI}=\frac{\mathrm{\Σ}(s\×n)}{N\×S}\×100$

In formula: DI---disease index;

∑---each state of an illness rank represents the summation of numerical value and corresponding each state of an illness rank plant number product;

S---the representative numerical value of each state of an illness rank;

N---the plant number of each state of an illness rank;

N---investigate total plant number;

S---the representative numerical value of the highest state of an illness rank.

(7) evaluation of resistance: when susceptible control material reaches its corresponding susceptible degree (DI >=50), this batch of qualification is considered as effectively.The disease index mean value repeated for 3 times according to expert evidence determines its resistance level, and the criteria for classifying sees the following form.

Tomato is to the judgement criteria of Cucumber Mosaic Virus resistance

Disease index (DI)	Evaluation of resistance
		DI＝0	Immunity Immune(I)
0＜DI＜10	High resistance Highly resistant(HR)
		10≤DI＜30	Disease-resistant Resistant(R)
30≤DI＜50	In anti-Moderately resistant(MR)
		50≤DI＜70	Susceptible Susceptible(S)
70≤DI≤100	High sense Highly susceptible(HS)

Step 3. transgenic line cuttage seeding virus resistance is identified

As stated above after virus inoculation, for transgenic Fructus Lycopersici esculenti, virus resistance qualification is carried out to T0.Be specially, each T0, for about the strain of transgenosis maternal plant cottage propagation 10, adds up resistance result after virus inoculation, result is as following table (Fig. 9):

In table, result can be found out, all transgenic lines all have the CMV virus resistance of higher degree, wherein major part is high resistance plant, and CMV5 is not obvious relative to other strains, possible reason is that investigated transgenosis high resistance strain is a lot, and its advantage does not embody.

Note: most high resistance plant is immunization type (namely asymptomatic) by classified calculating formula, but we repeat CMV virus to be detected in strain (cuttage strain) in the part of these plant, just content is very low, in view of RNAi is the gene silencing phenomenon of post-transcriptional level, we think that transfer-gen plant is different from proper immune plant, and it can not ensure that CMV does not infect plant completely.Therefore, we by this type of Resistant variants all unification be classified as high resistance type.

Result proves, the RNA interference antagonism CMV virus utilizing transgenosis to produce is highly effective.For ease of final-period management, by each strain by resistance renumber for T01A1 ~ 9 grade (T0 represents T0 generation, and 1A represents the target gene that transfer-gen plant is corresponding, 1 ~ 9 represent corresponding strain; Next number principle is identical therewith).

Embodiment 4. identifies that T1 is for plant virus resistance; With resistant plant (T0 and T1 generation) for stock, grafting WT lines; Inoculation CMV virus, detects the grafting plant obtaining virus resistance.

In step 1. pair T1 generation, attacks poison screening

Due in the present invention, it is mode with self propagated that tomato is reserved seed for planting, and T1 is for having selfing restructuring and the phenomenon be separated in tomato.Therefore, be necessary to carry out Molecular Identification and virus inoculation qualification to T1 for seed.We on behalf of examination material, obtain seed with resistant plant T0, and seed propagation obtains T1 for plant, the plant of transgenic positive is wherein identified by the method for fast PCR, for subsequent viral Resistance Identification, by the method inoculation CMV of embodiment 3 step 2, identify its antiviral ability.Result is as following table:

Resistance	MM	T11A.1	T12A.1	T12B.1	T13A.1	T1CP.1	T1CMV5.1
								High resistance (HR)	-	13	11	13	7	8	13
Disease-resistant (R)	-	-	2	2	1	-	1
								In anti-(MR)	-	1	1	-	-	-	2
Susceptible (S)	-	-	1	-	-	-	-
								High sense (HS)	-	-	-	-	-	-	-
Add up to	20	14	15	15	8	8	16

The present invention attacks poison by T1 for the CMV of plant, though find that resistance trait is separated to some extent, most of positive T1 plant has very high CMV resistance equally.

Step 2. transgenosis T0 and T1 for plant as the Resistence research of stock to grafting plant CMV

For whether checking CMV resistance can keep in scion, the present invention utilizes the transgenosis T0 of high resistance type and T1 on behalf of stock grafting susceptible kind (MoneyMaker; MM).Engrafting method, as Figure 11.

For T0 generation, we have chosen the cuttage seeding of all high resistance plant, and each strain expands numerous 5 strains, is used as stock.Grafting nontransgenic plants, susceptible kind (MM) scion.Treat that bud grows to 3 ~ 4 leaves and opens, start to carry out virus inoculation qualification by the inoculum system, method of cuttage seeding CMV virus.For T1 generation, because progeny plant strain is too many, we only have chosen part strain and test.

Grafting operation is as follows:

With reference to (Shaharuddin, N.A., Han, Y., Li, H.andGrierson, D.2006.Themechanismofgrafttransmissionofsenseandantisens egenesilencingintomatoplants.FEBSLett.28-29,6579-86.)

(1) cultivate tomato plant, grow to after 20 ~ 30cm height until stock, truncated terminal bud (about 5cm), with blade from otch top down, the mouth that the about 1.5 ~ 2cm that rives is long.

(2) bud (about 3 ~ 5cm) of scion variety is got, top stays 2 true leaf place blades that stem is whittled into wedge shape downwards, two tangent planes of wedge shape require smooth, tangent plane length should be consistent with the degree of depth of stock otch, immediately scion is inserted in stock otch, slightly firmly be seated, fix (or wrapping up with preservative film) with Grafting clip.

(3) plant grafted puts disposable plastic bag or puts into the airtight hut of plastics, to keep plant periphery humidity.Note after grafting observing greenhouse humiture, temperature remains on about 23 ~ 25 DEG C, and humidity keeps 85% ~ 90%.

(4) grafting started progressively take a breath (progressively raising plastics bag) after 3 ~ 4 days, after grafting 5 ~ 10 days, grafting wound healed completely, and scion lobus cardiacus has " guttation " phenomenon, normal management is carried out, as suitably imposed rich water, strengthening the control etc. of insect pest and leaf diseases after 10 days.At grafting plant growing period, lateral bud can be sprouted by the axil place of stock true leaf, should erase these lateral buds in time, prevent lateral bud from producing detrimentally affect to scion.

Found that (as following table), T0 presents different virus resistance for different grafting strain, and major part is high resistance.But relative to transfer-gen plant (stock), grafting plant (scion) the CMV resistance of part correspondence declines to some extent, and this may be relevant with the reticent signal transmission efficiency of the RNA of different plants, transgenic insert copy number (or siRNA expression amount), graft union degree and scion sprout growth conditions.Grafting result shows, with high resistance CMV viral transgene plant for the susceptible scion variety of stock grafting, effectively can improve the virus resistance of scion variety.Resistance T1 stock can give the very high virus resistance of scion (Figure 10) equally.Further proof utilizes graft technology to be the effective ways improving scion variety virus resistance by the mode improveing stock.

Step 3. Molecular Detection stock and scion antibiotics resistance gene.

The present invention improves the method for plant virus resistance, and the main mode of grafting transgenic rootstock that adopts realizes.This method, can avoid again another great problem in Transgene-safty, the possibility namely reducing or avoid antibiotics resistance gene to drift about cleverly simultaneously.

The present invention take scion leaf as examination material, take rotaring gene plant blade as contrast, extracts respective RNA, reverse transcription synthesis cDNA, and with to be detected the expression of NptII gene by the method for RT-PCR for template, verify the transgene component of scion in grafting strain.

Result as Figure 12, without the transcript of NptII in scion.Analyze theoretically, without gene transformation process in scion, the antibiotic-resistance marker's gene used in plant expression vector can not be there is.Therefore, can ensure, in the sexual gamete produced at scion variety, also can not there is antibiotic-resistance marker's gene.

110 Agricultural University Of Hunan

120 1 kinds of methods and rna interference vector pCAMBIA2300-CP and transgenic method making scion variety obtain virus resistance

130P11551NYDHN

16030

170PatentInversion3.3

2101

211276

212DNA

213 fragment 1A

4001

tggatgcgtcctgtgcccgagggtattgtttattctgtcggttataatgaacgcggttta60

ggtccgaagtctgatggagagctttacattgtcaatagtgaatgcgtgatctgtaacagt120

gaatctttatccactgtcacgcgttctcttcaagctccaaccgggaccattagtcaagtt180

gacggagttgctggttgtgggaaaaccacggcaattaaatccatttttgagccgtccact240

gacatgatcgttaccgcgaacaagaagtccgcccaa276

2102

211277

212DNA

213 fragment 2A1

4002

tgtccaacgccaaccatcgcgattcctccggatttaaaccgtgctactgatcgtgttgat60

atcaatttagttcaatccatttgtgactcgactctgcccactcgtagtattacgacgact120

cttttcatcaagtgttcgtcgaaagtgcagactattctatagatctggatcatgttagac180

ttcgacagtctgatcttattgcaaaaattccagattcagggcatatgataccggttctga240

acaccgggagcggtcacaagagagtaggtacaacgaa277

2103

211259

212DNA

213 fragment 2B

4003

tggctcgtatggtggaggcgaagaagcagagacgaaggtctcacaaacagaatcgacggg60

aacgaggtcacaaaagtcccagcgagagagcgcgttcaaatctcagactattccgcttcc120

taccgttctatcaagtggatggttcggaactgacagggtcatgccgccatgtgaacgtgg180

cggagttacccgagtctgaggcctctcgtttagagttatcggcggaagaccatgattttg240

acgatacagattggttcgc259

2104

211239

212DNA

213 fragment 3A

4004

aaagacccttcagcatcagtggaaactgttcgagtaacagcacataacacttgagggaca60

ctcatgtatccttttgagcataattcaccaacatcatatccagacttaaagaaggaagca120

atacgaccgtgggttacttcgggaacgaggggccggactgaaatagcattatcagcgcgc180

atccaatgatgccggcctaggtcacactcagtagccattttcttaatggcttcagggct239

2105

211211

212DNA

213 fragment CP

4005

tttacggactgtcacccacacggtagaatcaaatttcggcaaaggattaactcgaatttg60

aatgcgcgaaacaagcttcttatcatattccgtgactgaatcaggtagtaacaacctttt120

accgtaataagacccacggtctatttttggtggctttagggtaatagatgtgaacgtgta180

cccaggtctacagcgttcactccctacaaag211

2106

211600

212DNA

213 merge fragment CMV

4006

ctgtgcccgagggtattgtttattctgtcggttataatgaacgcggtttaggtccgaagt60

ctgatggagagctttacattgtcaatagtgaatgcgtgatctgtaaatttaaaccgtgct120

actgatcgtgttgatatcaatttagttcaatccatttgtgactcgactctgcccactcgt180

agtattacgacgactcttttcatcaagcgtatggtggaggcgaagaagcagagacgaagg240

tctcacaaacagaatcgacgggaacgaggtcacaaaagtcccagcgagagagcgcgttca300

aatctcagactattccgcttcctaccgttctatcaagacccttcagcatcagtggaaact360

gttcgagtaacagcacataacacttgagggacactcatgtatccttttgagcataattca420

ccaacatcatatccagacttaaagaaggaagcaatacgaccgtgttcggcaaaggattaa480

ctcgaatttgaatgcgcgaaacaagcttcttatcatattccgtgactgaatcaggtagta540

acaaccttttaccgtaataagacccacggtctatttttggtggctttagggtaatagatg600

Claims (4)

1. make scion variety obtain a method for virus resistance, its step is as follows:

(1) antiviral transgenic rootstock is prepared;

(2) scion grafting is made to grow to described transgenic rootstock;

It is characterized in that: described antiviral transgenic rootstock obtains for proceeding to rna interference vector, the target sequence of described rna interference vector is the gene fragment in target viral gene group, described target viral refers to cucumber mosaic virus CMV, described scion variety and transgenic rootstock are all tomato variety, and the target sequence of described rna interference vector is for shown in SeqIDNo.5.

2. with the rna interference vector that cucumber mosaic virus virus gene is target, it is characterized in that, the target sequence of described rna interference vector is for shown in SeqIDNo.5.

3. transform the bacterial strain of rna interference vector described in requirement 2 of having the right.

4. bacterial strain according to claim 3, its starting strain is transgenosis Agrobacterium tumefaciens strain EHA105.