CN1709908A - Tomato RNA virus host factor and its coding gene and use thereof - Google Patents

Abstract

This invention has disclosed a tomato RNA virus host factor gene and its coding gene and application. Its purpose is to offer a tomato RNA virus host factor gene and its coding gene and application of antivirus plant breeding. This tomato RNA virus host factor gene is a protein with one of amino residues as followed: 1. SEQ ID No.1 in the sequence list;2. Amino residue sequence of SEQ ID No.1 in the sequence list, through substitution by 1 to 10 amino residues, lacunae or addition and protein with virus copy effect.This tomato RNA virus host factor gene, Gene ToTOM1 and method to control this gene's expression, have greater actual meaning and wide application prospect of antivirus plant breeding.

Description

A kind of tomato RNA virus host factor and encoding gene thereof and application

Technical field

The present invention relates to albumen and encoding gene and application in the biological technical field, particularly relate to a kind of tomato RNA virus host factor and encoding gene thereof and its application in the plant virus resistance breeding.

Background technology

Tomato is a kind of important fruit type vegetables.In its growth and development process, be subjected to the harm of various diseases easily, wherein serious with viral disease.The viral great majority that infect tomato of report are RNA viruses at present, wherein modal RNA viruses has 7 kinds, be cucumber mosaic virus (Cucumber mosaic virus, CMV), tobacco mosaic virus (TMV) (Tabacco mosaic virus, TMV), Tomato mosaic virus (Tomato mosaic virus, ToMV), marmor upsilon (Potato virus Y, PVY), tomato bushy stunt virus (Tomato bushy stunt virus, TBSV), tomato aspermy virus (Tomato aspermy virus, TAV) and tomato chlorosis spot poison (Tomatochlorotic spot virus, TCSV).

Because virus is strict obligatory parasite, also there is not strict optionally chemical agent to can be effectively used to the control of the viroses of plant so far.In production practice, mainly kill the harm that virus disease is controlled in preventive measures such as amboceptor insect and cultivation disease-resistant varieties with the route of transmission that cuts off virus, with chemical agent, wherein to cultivate disease-resistant varieties economical and effective the most to remove malicious source.Yet conventional disease resistant and breeding method process is loaded down with trivial details, needs lot of manpower and material resources, the more important thing is the normal and bad agronomic shape gene linkage of disease-resistant gene, is difficult to reach disease-resistant fine production requirement; On the other hand, the shortage of resistant gene resource has also limited the application of conventional breeding aspect.New approach (Powell A.P. has been opened up in the control that be applied as the viroses of plant of plant genetic engineering in breeding, N elson R.S., HoffmanN., et al.Delay of disease development in transgenic plants that express thetobacco mosaic virus coat protein gene.Science, 1986,232:738-743).The method that obtains at present antiviral transfer-gen plant mainly contains two kinds: the one, will derive from the regulating and controlling sequence of the gene of virus self or gene (as the coat protein gene of virus, rdrp gene and fragment thereof, movement protein gene and 3 ' or 5 ' end non-coding region thereof, virus antisense RNA, ribozyme gene and viral satellite RNA etc.) the importing recipient plant, thereby obtain antiviral plant (the Lomonossoff G.P. of the resistance (pathogen-derived resistance) of viral origin, 1995.Pathogen-derived Resistance to Plant Viruses, Annu.Rev.Phytopathol., 33:323-343), but the antiviral plant that utilizes this method to obtain generally shows as vertical resistance, and, there are certain potential Hazard Factor in this method, the virus sequence that promptly is used to transform plant might be recombinated with the virus that the field exists, thereby produces new virus; Another kind method is to utilize the disease-resistant gene of plant itself (as the N gene) to obtain antivirus plant (Goldbach R., Bucher E., and Prins is to plant viruses:an review.Virus Research. M.2003.Resistancemechanisms, 92:207-212).

To the research of virus host factor gene, for the antiviral gene engineering provides a new approach.Host factor (Host Factors) is meant that host cell offers all viral conveniences in virus infection process (comprising poisoning intrusion, viral gene expression, virus particle assembling and release etc.), also claims host's albumen (host proteins) or cell protein (cellular proteins).If lack these host factors in the host cell, just the reproducible or the efficient of duplicating do not reduce (Ahlquist P. to virus greatly, Noueiry, A.O., and Lee, W.M., et al., 2003.Host Factor in Positive-Strand RNA Viruses Genome Replication.Journalof Virology, 77 (15): 8181-8126.).Therefore, by supporting the gene of virus replication in inhibition or the reticent host cell, might make it not support virus duplicating and keeping in host cell, thereby obtain the antiviral plant of broad spectrum.

Summary of the invention

The purpose of this invention is to provide a kind of tomato RNA virus host factor and encoding gene thereof.

Tomato RNA virus host factor provided by the present invention, name is called ToTOM1, and derive from tomato and belong to tomato (Lycopersicon esculentum Miller), be the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 1;

2) with SEQ ID № in the sequence table: 1 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of supporting the virus replication effect.

SEQ ID № in the sequence table: 1 is made up of 288 amino-acid residues.The zone that comprises a plurality of high hydrophobicities infers that this albumen is the transmembrane protein of a kind of 6-7 of having membrane spaning domain, with the homology of Arabidopis thaliana AToTOM1 gene on amino acid levels be 74.9%.

SEQ ID № in the code sequence tabulation: the polynucleotide of 1 protein sequence also belong to protection scope of the present invention.

The encoding gene of tomato RNA virus host factor (ToTOM1) comprises the cDNA gene of tomato RNA virus host factor and the genomic gene of tomato RNA virus host factor.Its genomic gene is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 2 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit.

SEQ ID № in the sequence table: 2 by 6727 based compositions, have 11 exons and 10 introns, 1-158 bit base from 5 ' end is first exon of this genomic gene, 838-928 bit base from 5 ' end is second exon of this genomic gene, 1015-1067 bit base from 5 ' end is the 3rd exon of this genomic gene, 1941-2033 bit base from 5 ' end is the 4th exon of this genomic gene, 2109-2180 bit base from 5 ' end is the 5th exon of this genomic gene, 3052-3131 bit base from 5 ' end is the 6th exon of this genomic gene, 3236-3274 bit base from 5 ' end is the 7th exon of this genomic gene, 3498-3561 bit base from 5 ' end is the 8th exon of this genomic gene, 5842-5895 bit base from 5 ' end is the 9th exon of this genomic gene, 6342-6419 bit base from 5 ' end is the tenth exon of this genomic gene, 6497-6727 bit base from 5 ' end is the 11 exon of this genomic gene, from 5 ' the 9-11 bit base of end be the initiator codon ATG of this genomic gene, from 5 ' the 6587-6589 bit base held is the terminator codon TGA of this genomic gene; 159-837 bit base from 5 ' end is first intron of this genomic gene, 929-1014 bit base from 5 ' end is second intron of this genomic gene, 1068-1940 bit base from 5 ' end is the 3rd intron of this genomic gene, 2032-2108 bit base from 5 ' end is the 4th intron of this genomic gene, 2181-3051 bit base from 5 ' end is the 5th intron of this genomic gene, 3132-3235 bit base from 5 ' end is the 6th intron of this genomic gene, 3273-3497 bit base from 5 ' end is the 7th intron of this genomic gene, 3562-5841 bit base from 5 ' end is the 8th intron of this genomic gene, from 5 ' the 5996-6341 bit base of end be the 9th intron of this genomic gene, from 5 ' the 6420-6496 bit base held is the tenth intron of this genomic gene.

Its cDNA gene is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 3 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit.

SEQ ID № in the sequence table: 3 by 1282 based compositions, and its open reading frame (ORF) is that coding has SEQ ID № in the sequence table: the protein of 1 amino acid residue sequence from 5 ' end 31-897 bit base;

The rigorous condition of above-mentioned height can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized and washed film with 0.1 * SSPE under 65 ℃.

Contain that arbitrary segmental primer also belongs to protection scope of the present invention in expression vector, transgenic cell line and the host bacterium of above-mentioned tomato RNA virus host factor encoding gene and the amplification tomato RNA virus host factor encoding gene.

Another object of the present invention provides a kind of method of cultivating antivirus plant.

The method of cultivation antivirus plant provided by the present invention is that the inverted defined gene fragment of ToTOM1 or the rnai expression carrier of ToTOM1 are imported in the plant, obtains transfer-gen plant.

Can the inverted defined gene fragment of ToTOM1 or the rnai expression carrier of ToTOM1 be imported transformed plant cells or tissue, as agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method etc. according to the ordinary method in the plant genetic engineering field.Solanaceae, Cruciferae or plant cucurbitaceous had both been can be by the plant transformed host.

Tomato RNA virus host factor ToTOM1 provided by the present invention is the associated protein that a kind of RNA viruses is survived in plant materials, can obtain antivirus plant by antisense gene fragment or intravital this proteic encoding gene of the reticent plant of RNA interferential method.The disease resistance experimental result of transfer-gen plant shows, the transgenic Fructus Lycopersici esculenti that changes the ToTOM1 sense-rna has significantly suppressed the accumulation volume of CMV in tomato, compare with contrast non-transgenic plant, disease time is obviously postponed, symptom also significantly alleviates, in addition, the accumulation volume of the transgenic Fructus Lycopersici esculenti plant TMV of the RNA interference plasmid of commentaries on classics ToTOM1 is also compared according to the non-transgenic tomato and is significantly reduced, show that tomato ToTOM1 is the host factor gene of CMV and TMV, can obtain the tomato variety of anti-CMV and TMV by inhibition or reticent ToTOM1.Tomato RNA virus host factor gene ToTOM1 of the present invention and suppress the method for this genetic expression, antivirus plant cultivate and breeding in have bigger practical significance and wide application prospect.

Description of drawings

Fig. 1 is the agarose gel electrophoretogram of 3 ' the RACE product of ToTOM1

Fig. 2 is that the BamH I and the Xho I enzyme of recombinant plasmid that contains 3 ' the RACE product of ToTOM1 cut the evaluation collection of illustrative plates

Fig. 3 is the agarose gel electrophoretogram of 5 ' the RACE product of ToTOM1

Fig. 4 is that the EcoR I enzyme of recombinant plasmid that contains 5 ' the RACE product of ToTOM1 is cut the evaluation collection of illustrative plates

Fig. 5 is the segmental agarose gel electrophoretogram of genomic gene of the ToTOM1 of pcr amplification

Fig. 6 is the agarose gel electrophoretogram that contains the segmental recombinant plasmid of genomic gene of ToTOM1

Fig. 7 is that the enzyme that contains the recombinant plasmid of ToTOM1 gene fragment is cut the evaluation collection of illustrative plates

Fig. 8 is transgenosis plant expression vector pBI121

Fig. 9 is the agarose gel electrophoretogram of the ToTOM1 genomic fragment of pcr amplification

Figure 10 cuts the evaluation collection of illustrative plates for external source fragment enzyme of closure in pUCm-T

Figure 11 cuts the evaluation collection of illustrative plates for the enzyme of the Plant Transformation plasmid pBIT1-2 of ToTOM1

Figure 12 is the segmental agarose gel electrophoretogram of ToTOM1 cDNA that is used to make up the rnai expression plasmid of pcr amplification

Figure 13 cuts the evaluation collection of illustrative plates for the enzyme of recombinant plasmid pUCGAT1 (370)

Figure 14 cuts the evaluation collection of illustrative plates for RNA disturbs the enzyme of intermediate carrier pUCGAToTOM1 (RNAi-370)

Figure 15 cuts the evaluation collection of illustrative plates for the Pst I enzyme of rnai expression plasmid pBIToTOM1 (RNAi-370)

Figure 16 identifies collection of illustrative plates for the PCR that transforms the anti-Kn tomato plant that antisense ToTOM1 is arranged

The Southern hybridization detected result that Figure 17 transforms the positive plant that antisense ToTOM1 is arranged for PCR identifies

Figure 18 is the PCR detected result of 35S, NOS, endogenous ToTOM1 gene and NPTII gene of transfer-gen plant of the expressed rna interference fragment of anti-kantlex

Figure 19 is the Southern hybridization collection of illustrative plates of the independent RNA interference of transgene plant of PCR reacting positive

Figure 20 is inoculation CMV non-transgenic plant after 10 days

Figure 21 is inoculation CMV sense-rna transfer-gen plant after 10 days

Figure 22 is inoculation CMV non-transgenic plant after 25 days

Figure 23 is inoculation CMV antisence RNA transfer-gen plant after 25 days

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, and used tomato variety is " the super headliner " available from the academy of agricultural sciences, Guangxi.

The clone of the full length cDNA sequence of embodiment 1, tomato host factor gene ToTOM1

1, the clone of ToTOM1 3 ' end cDNA

Search according to GenBank with Arabidopis thaliana AtTOM1[gi:9967414] have the cDNA sequence of two forward primers amplifications of tomato est sequence BE458681 (528nt) [gi:9502983] design ToTOM1, the 3 ' end of certain homology, primer sequence is as follows:

Tomato?Tom1-A：5’CTCCCTTTGTGCTTCC-TATGGTCT?3’；

Tomato Tom1-1:5 ' GGGTACCCGAGTATGGCTGGACAAC 3 ' utilizes the cDNA sequence of the synthetic ToTOM1 3 ' end of 3 ' RACE System for Rapid Amplication of cDNA Ends test kit (Invitrogen company, catalog number (Cat.No.) 18373-027).Extract total RNA of tomato, its first chain cDNA is synthesized in reverse transcription, cDNA is a template with this first chain, under the primer AUAP:5 ' GGCCACGCGTCGACTAGTAC3 ' guiding that primer Tomato Tom1-A and mentioned reagent box provide, carry out the PCR first time, again with the first time PCR product be template, under the guiding of primer Tomato Tom1-1 and primer AUAP, carry out the PCR second time, reaction finishes the back PCR is carried out the detection of 1.2% agarose gel electrophoresis, detected result is (swimming lane M is GeneRuler 1kb DNA Ladder, and swimming lane 1 is 3 ' the RACE product of ToTOM1) as shown in Figure 1, shows the specific band that amplifies an about 1000bp of length.Reclaim this specific PCR product, it is connected with carrier pCR2.1-TOPO (Invitrogen company), to connect product transformed into escherichia coli DH5 α, after screening, select positive colony upgrading grain, carrying out double digestion with restriction enzyme BamHI and Xho I identifies, enzyme is cut qualification result, and (swimming lane M is GeneRuler 1kb DNA ladder as shown in Figure 2, swimming lane 1 is 3 ' the RACE PCR fragment of ToTOM1, swimming lane 2-5 is that the BamH I and the Xho I enzyme that contain the segmental recombinant plasmid of 3 ' RACE PCR of ToTOM1 are cut product), 3 ' the RACE PCR fragment that shows the ToTOM1 of the about 1000bp of length of being cloned into correctly is inserted among the carrier TOPO TA, with this recombinant vectors called after pCToT1-3.PCToT1-3 is carried out determined dna sequence, sequencing result shows that the dna fragmentation length of being inserted is 1077bp, have SEQ ID № in the sequence table: 3 the dna sequence dna from 5 ' end 206-1282 position, 3 ' end of this dna fragmentation has the poly that length is 15 bases (A) tail.

2, the clone of ToTOM1 5 ' end cDNA

What search according to GenBank has the cDNA sequence of two forward primer amplifications of tomato est sequence BE458681 (528nt) [gi:9502983] design ToTOM1, the 5 ' end of certain homology with Arabidopis thaliana ATOM1, and primer sequence is as follows:

Tomato?Tom1-2：5’CCACCATATAGCAGAAAGCCCAAGG-3’；

Tomato?Tom1-B：5’TCCTGAGCTTATCTGTTGGTAAACTCCTAGCCT-3’

Utilize the cDNA sequence of the synthetic ToTOM1 5 ' end of SMARTTMRACE cDNA Amplification test kit (Clontech company, catalog number (Cat.No.) K1881-1).Extract total RNA of tomato, its first chain cDNA is synthesized in reverse transcription, cDNA is a template with this first chain, under the guiding of the primer UPM:5 ' CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT 3 ' that primer Tomato Tom1-2 and mentioned reagent box provide, carry out the PCR first time, be template with the PCR product first time (diluting 100 times) again, under the guiding of primer Tomato Tom1-B and primer NUP:5 '-AAGCAGTGGTATCAACGCAGAGT-3 ', carry out the PCR second time, reaction finishes the back PCR product is carried out the detection of 1.2% agarose gel electrophoresis, detected result is (swimming lane M is that 100bp DNA Ladder Plus swimming lane 1 is 5 ' the RACE product of ToTOM1) as shown in Figure 3, shows the specific band that amplifies an about 500bp of length.Reclaim this specific PCR product, it is connected with carrier TOPO TA, to connect product transformed into escherichia coli DH5 α, after screening, select positive colony upgrading grain, carry out enzyme with restriction enzyme EcoR I and cut evaluation, enzyme is cut qualification result, and (swimming lane M is GeneRuler 1kb DNA ladder as shown in Figure 4, swimming lane 1 is 5 ' the RACEPCR fragment of ToTOM1,3 ' the RACE PCR fragment of ToTOM1, swimming lane 2-5 is that the EcoR I enzyme that contains the segmental recombinant plasmid of 5 ' RACE PCR of ToTOM1 is cut product), the purpose fragment that shows the about 500bp of length of being cloned into correctly is inserted among the carrier TOPO TA, with this recombinant vectors called after pCToT1-5.PCToT1-5 is carried out determined dna sequence, and sequencing result shows that the dna fragmentation length of being inserted is 448bp, has SEQ ID № in the sequence table: 3 the dna sequence dna from 5 ' end 1-448 position.

3, the acquisition of ToTOM1 full-length cDNA

5 ' RACE PCR fragment and 3 ' RACE PCR fragment to step 1 and step 2 acquisition are carried out sequential analysis, analytical results shows that two fragments have the overlap that a segment length is 243nt, there is the restriction enzyme site of a restriction enzyme Mun I at the 279th bit base place that 5 ' the RACE PCR segmental 5 ' that this overlap obtains in step 2 holds, and the restriction enzyme site of a restriction enzyme Xha I is arranged on the sequence of carrier pCToT1-3 and pCToT1-5.Utilize two restriction enzyme sites of Mun I and Xba I that the cDNA of 3 ' RACE and 5 ' RACE is coupled together, obtain the full-length cDNA of ToTOM1.This full-length cDNA is checked order, and sequencing result shows that this sequence has SEQ ID № in the sequence table: 3 nucleotide sequence, and SEQ ID № in the sequence table: 3 are made up of 1282 Nucleotide, and 3 ' end has the poly that length is 15 bases (A) tail.With Vector NTI software the cDNA sequence of ToTOM1 total length is carried out sequential analysis, analytical results shows that its open reading frame (ORF) is for holding the 31-897 bit base from 5 ', its 5 ' end non-coding region length is 30 bases, 3 ' end non-coding region length is 385 bases, SEQ ID № in the code sequence tabulation: 1 amino acid residue sequence, ToTOM1 and Arabidopis thaliana AtTOM1 amino acids coding residue sequence are carried out homology relatively, and ToTOM1 and the homology of Arabidopis thaliana AtTOM1 on amino acid levels are 74.9%.Use Kyte ﹠amp; The method of Doolittle (Kyte ﹠amp; Doolittle, A simple method for displaying the hydropathiccharacter of a protein, J Mol Biol, 157 (1): 105-132) hydrophobicity of ToTOM1 encoded protein matter is analyzed, the result shows that ToTOM1 encoded protein matter has the zone of high hydrophobicity, infers that this albumen is the transmembrane protein of a kind of 6-7 of having membrane spaning domain.

The clone of embodiment 2, tomato ToTOM1 genomic fragment

According to the full length cDNA sequence of acquired tomato ToTOM1 and coding region thereof from 5 ' end 23-45 bit base sequence with from the genome sequence of 5 ' end 1035-1012 bit base sequences Design primer amplification ToTOM1, primer sequence is as follows:

ToTOM?1-D：5’-GAGCTGAAATGGCTAGGTTGCCG-3’；

ToTOM 1-E:5 '-CGTTGAATCTTTGCCTTTCCGCAG-3 ' is a template with total DNA of tomato, under the guiding of primer ToTOM1-D and primer ToTOM1-E, carry out pcr amplification, reaction finishes the back PCR is carried out the detection of 0.8% agarose gel electrophoresis, (swimming lane M is GeneRuler 1kb DNA ladder to detected result as shown in Figure 5, swimming lane 1 is the genomic fragment of the ToTOM1 of pcr amplification), show the specific band that amplifies an about 6.7kb of length.Reclaim this specific amplification products, it is cloned among the carrier pCR2.1-TOPO (Invitrogen company), it is carried out 0.8% agarose gel electrophoresis detects, (swimming lane 1 is CK:pCR2.1-TOPO to detected result as shown in Figure 6, swimming lane 1-6 is the recombinant plasmid that contains the ToTOM1 genomic fragment), carry out enzyme with restriction enzyme Sac I and Xba I then and cut evaluation, enzyme is cut qualification result, and (swimming lane M is GeneRuler 1kb DNA ladder as shown in Figure 7, swimming lane 1 is cut product for the Sac I and the Xba I enzyme that contain the segmental recombinant plasmid of ToTOM1 genomic gene), the purpose fragment that shows the about 6.7kb of length of being cloned into correctly is inserted among the carrier pCR2.1 TOPO, will contain the segmental recombinant plasmid called after of this purpose pT1DE-9.PT1DE-9 is carried out determined dna sequence, sequencing result shows that the genomic gene of ToTOM1 has SEQ ID № in the sequence table: 2 polynucleotide sequence, this sequence is by 6727 based compositions, the full length cDNA sequence of itself and ToTOM1 is compared, comparison result shows that the genomic gene of ToTOM1 has 11 exons and 10 introns, 1-158 bit base from 5 ' end is first exon of this genomic gene, 838-928 bit base from 5 ' end is second exon of this genomic gene, 1015-1067 bit base from 5 ' end is the 3rd exon of this genomic gene, 1941-2033 bit base from 5 ' end is the 4th exon of this genomic gene, 2109-2180 bit base from 5 ' end is the 5th exon of this genomic gene, 3052-3131 bit base from 5 ' end is the 6th exon of this genomic gene, 3236-3274 bit base from 5 ' end is the 7th exon of this genomic gene, 3498-3561 bit base from 5 ' end is the 8th exon of this genomic gene, 5842-5895 bit base from 5 ' end is the 9th exon of this genomic gene, 6342-6419 bit base from 5 ' end is the tenth exon of this genomic gene, 6497-6727 bit base from 5 ' end is the 11 exon of this genomic gene, from 5 ' the 9-11 bit base of end be the initiator codon ATG of this genomic gene, from 5 ' the 6587-6589 bit base held is the terminator codon TGA of this genomic gene; 159-837 bit base from 5 ' end is first intron of this genomic gene, 929-1014 bit base from 5 ' end is second intron of this genomic gene, 1068-1940 bit base from 5 ' end is the 3rd intron of this genomic gene, 2032-2108 bit base from 5 ' end is the 4th intron of this genomic gene, 2181-3051 bit base from 5 ' end is the 5th intron of this genomic gene, 3132-3235 bit base from 5 ' end is the 6th intron of this genomic gene, 3273-3497 bit base from 5 ' end is the 7th intron of this genomic gene, 3562-5841 bit base from 5 ' end is the 8th intron of this genomic gene, from 5 ' the 5996-6341 bit base of end be the 9th intron of this genomic gene, from 5 ' the 6420-6496 bit base held is the tenth intron of this genomic gene.

The acquisition of embodiment 3, transgenic Fructus Lycopersici esculenti plant

One, the structure of plant expression vector

Used binary expression vector is pBI121 (Clontech) in the present embodiment, its physical map as shown in Figure 8, have the essential sequence that T-DNA integrates, as selectable marker gene, control by the CaMV 35S promoter from the foreign gene that multiple clone site is inserted with kalamycin resistance gene.

1, the structure that contains the segmental plant expression vector of ToTOM1 genomic gene antisense

According to the cDNA sequence of embodiment 2 clone's tomato ToTOM1, design a pair of special primer Tomato Tom1-1 (5 '-GGGTACCCGAGTATGGCTGGACAAC-3 ') and Tomato Tom1-2 (5 '-CCACCATATAGCAGAAAGCCCAAGG-3 ').Total DNA with tomato is a template, under the guiding of primer Tomato Tom1-1 and primer Tomato Tom1-2, carry out pcr amplification, reaction finishes the back PCR product is carried out the detection of 0.8% agarose gel electrophoresis, (swimming lane M is 1Kb DNA Marker to detected result as shown in Figure 9, swimming lane 1 is a pcr amplification product), show the specific band that amplifies an about 2.6kb of length.Reclaim this specific amplification products and carry out the two ends order-checking, sequencing result shows that this dna fragmentation is one section nucleotide fragments of ToTOM1.With the purified rear clone of specific amplification products of the ToTOM1 that reclaims in carrier pUCm-T (Shanghai life worker), and carry out enzyme with restriction enzyme Kpn I and cut evaluation, enzyme is cut qualification result, and (swimming lane M is 1Kb DNA Marker as shown in figure 10, swimming lane 1 is connected product for reclaiming fragment with the forward of pUCm-T, swimming lane 2 is cut product for reclaiming fragment with the reverse Kpn I enzyme that is connected product of pUCm-T, swimming lane 3 is cut product for the recovery fragment is connected product with the forward of pUCm-T Kpn I enzyme), show that this gene fragment is connected among the carrier pUCm-T with forward and reverse form respectively, with the recombinant plasmid called after pUT1-2 that wherein oppositely connects.The ToTOM1 fragment that is cloned among the pUT1-2 is downcut with restriction enzyme EcoR V and Xba I, after gel electrophoresis, reclaim this dna fragmentation, be connected on the carrier pBI121 of Sma I and XbaI double digestion, obtain the Plant Transformation plasmid pBIT1-2 of ToTOM1, it is carried out enzyme with restriction enzyme HindIII cut evaluation, enzyme is cut qualification result, and (swimming lane M is 1kb DNA Marker as shown in figure 11, the recombinant plasmid pBIT1-2 of swimming lane 1 for cutting without enzyme, swimming lane 2 is cut product for the HindIII enzyme of pBIT1-2), the dna fragmentation that shows ToTOM1 correctly is connected among the carrier pBI121, has obtained to make up the plant expression vector of correct ToTOM1.

2, the structure of the RNAi interference expression plasmid of tomato ToTOM1

According to two primers of full length cDNA sequence design of tomato ToTOM1, primer sequence is as follows:

ToTOM1-RNAi-2F (879-899): CCTC AGATCTGCACAATACCACCCAAT (line part base is a Bgl II recognition site);

ToTOM1-RNAi-2R (1258-1227): CCTC ACTAGTAAAGGAGATCCAGAACATC (line part base is a Spe I recognition site)

With the plasmid that contains tomato ToTOM1 full-length cDNA is template, under the guiding of primer ToTOM1-RNAi-2F (879-899) and primer ToTOM1-RNAi-2R (1258-1227), carry out pcr amplification, obtain two ends and contain the cDNA fragment of the ToTOM1 of restriction enzyme Bgl II and Spe I recognition site respectively, called after TT1, (swimming lane M is GeneRuler 100bp DNAladder to 1.2% agarose gel electrophoresis detected result of this dna fragmentation as shown in figure 12, swimming lane 1 is TT1), show the dna fragmentation of the 370bp that increased, consistent with expected results.Reclaim this fragment, (construction process: with the total DNA of potato is template, at primer GA-F:5 '-AGG to the rna interference vector pUCGA through same enzyme double digestion with restriction enzyme Bgl II and Spe I double digestion rear clone with it GAGCTC CTCGAG ACTAGT AGATCTGGTACGGACCGTACTACTCTATTCG-3 ' (line part base is followed successively by the recognition site of restriction enzyme Sac I, Xho I, Spe I and Bgl II) and primer GA-R:5 '-AGG GGATCCCarry out pcr amplification under the guiding of CTATATAATTTAAGTGGAAAAAAAGGTTAAC-3 ' (line part base is the recognition site of restriction enzyme BamHI), obtain first intron fragment (199bp) of potato GA20 oxidase gene, this fragment is cut with Sac I and BamH I enzyme, be connected with carrier pUC18 (TaKaRa company) through same enzyme double digestion, with the recombinant vectors called after pUCGA that obtains) on, obtain containing this and reclaim segmental recombinant vectors, called after pUCGAT1 (370), this recombinant vectors is carried out enzyme with restriction enzyme Pst I cut evaluation, (swimming lane M is GeneRuler 100bp DNA ladder for result such as Figure 13, swimming lane 1 is cut product for the Pst I enzyme of pUCGA, swimming lane 2 is cut product for the Pst I enzyme of pUCGAT1 (370)) shown in, show that this recovery dna fragmentation correctly connects among the carrier pUCGA.After with restriction enzyme Xba I and BamHI pUCGAT1 (370) being carried out double digestion, be connected interstitial granules during the recombinant RNA that obtains ToTOM1 disturbs, called after pUCGAToTOM1 (RNAi-370) again with through Bgl II with the TT1 of Spe I double digestion.Disturb intermediate carrier to carry out enzyme to this recombinant RNA and cut evaluation with restriction enzyme Pst I, (swimming lane M is GeneRuler 100bp DNA ladder to the result as shown in figure 14, swimming lane 1 is cut product for the Pst I enzyme of pUCGAT1 (370), and swimming lane 2 is cut product for the PstI enzyme of pUCGAToTOM1 (RNAi-370)).The RNA interference plasmid pUCGAToTOM1 (RNAi-370) that is connected with the RNA interference fragment TT1 of ToTOM1 is cut the back with restriction enzyme Sal I enzyme to be mended flat, carrying out enzyme with restriction enzyme Spe I again cuts, behind 1.2% agarose gel electrophoresis, reclaim the small segment of the about 900bp of length, be connected on the carrier pBI121 of restriction enzyme EcoR V and Xba I double digestion reclaiming fragment, the RNAi that obtains tomato ToTOM1 disturbs plant expression plasmid, called after pBI121ToTOM1 (RNAi-370), it is carried out enzyme with restriction enzyme Pst I cut evaluation, (swimming lane M1 is GeneRuler 100bp DNA ladder to the result as shown in figure 15, swimming lane M2 is GeneRuler 1kb DNA ladder, swimming lane 1 is cut product for the Pst I enzyme of pBI121, swimming lane 2 is cut product for the Pst I enzyme of pBIToTOM1 (RNAi-370)), show the RNAi interference plant expression plasmid that has obtained to make up correct tomato ToTOM1.

Two, the genetic transformation of tomato

1, three parents are in conjunction with plant expression plasmid pBIT1-2 is imported Agrobacterium

The intestinal bacteria that will contain plant expression plasmid pBIT1-2 respectively carry out three parents with intestinal bacteria that contain helper plasmid pRK2073 and Agrobacterium EHA105 and combine (Rogers S.G., Horsch R.B., and Fraley R.T.1986.Gene transfer in plant:production of transformed plants using Ti-plasmidvectors.Methods Enzymol., 118:627-640), screen at the LA flat board that contains 50mg/L Rifampin (Rif) and 50mg/L kantlex, obtain containing Agrobacterium-mediated Transformation of plant expression plasmid pBIT1-2.

2, the genetic transformation of tomato

1) infects explant with the Agrobacterium EHA105 that contains expression plasmid pBIT1-2

The Agrobacterium that contains plant expression plasmid pBIT1-2 that step 1 obtains is rule on the YEB flat board that contains 50mg/L Rifampin (Rif) and 50mg/L kantlex, place 28 ℃ of constant temperature to cultivate about 24h, picking list colony inoculation is in containing identical antibiotic YEB liquid nutrient medium after growing bacterium colony, and 28 ℃ of constant temperature shaking tables (200 rev/mins) are cultivated about 24h to OD ₆₀₀Be 04-0.6, change in the aseptic centrifuge tube that the centrifugal 10min of 3000rpm abandons supernatant liquor, the thalline of collecting is cleaned once with the MS nutrient solution and suspend again, be used for the conversion of tomato after diluting 50 times.With reference to people's such as JavierPozueta-Romero method (Pozueta-romero, J., Houlne, G.,

L., et al.2001.Enhanced regeneration of tomato and pepper seedling explants forAgrobactereium-mediated transformation.Plant cell, Tissue and organ culture., 67:173-180) preparation Flamingo Bill explant, concrete grammar is: the seed of tomato is separated one by one, with distillation washing 3 times, also ceaselessly stirred 2 minutes with 80% alcohol immersion then, other adds 4-6 and drips 100% Tween-80, remove ethanolic soln, again with sterilized water washing 2-3 time: adding available chlorine is that 1% NaClO solution and 4-6 drip 100%Tween-80 and stirred on agitator 15 minutes, NaClO solution is gone, with aseptic washing 2 times, repeat secondary again, become golden yellow until the color of tomato seeds by brown, with aseptic water washing 6-10 time, on aseptic filter paper, dry.Drying the back is equipped with the seed access in the 1/2MS substratum culturing bottle of (containing 1.5% sucrose), in 25-28 ℃ illumination box, cultivated 7 days, again culturing bottle is placed in the super clean bench, uncap, and the moisture in the additional culturing bottle, aseptic seedling was cultivated 15 hours under open environment, side cotyledon with the aseptic seedling of cultivating all cuts together with terminal bud and peripheral meristem from petiole base then, only stay a side cotyledon, in addition big a part of root system of aseptic seedling is cut that only to keep length be that the radicle of 2-3cm is as explant.

Explant is put into the MS liquid nutrient medium (adding the Syringylethanone that final concentration is 100 μ mol/L in addition) that activatory contains the Agrobacterium EHA105 of expression plasmid pBIT1-2, ceaselessly shook 10 minutes, take out twice of aseptic water washing in back, put into the MS big culture dish of the 15cm diameter of culture medium (on the basis of MS minimum medium, adding zeatin 0.15mg/L and indolylacetic acid 0.05mg/L) altogether then one by one, seal, in illumination box, cultivated 2 days.

2) induction

Cultivate after 2 days, explant after the Agrobacterium EHA105 that will contain expression plasmid pBIT1-2 transforms is transferred and (has been added ZT 0.15mg/L on the basis of MS minimum medium in the differentiation screening culture medium, IAA 0.05mg/L, Km 50mg/L and Cef 200mg/L), 2-3 week cultivated in continuation in illumination box, culture condition is 25-28 ℃, illumination in 15 hours, 9 hours dark.

3) the taking root of transfer-gen plant, hardening and transplanting

To in the differentiation screening culture medium, downcut from callus by the normal plant of growth (long) to highly about 2-3cm, insert in the root media and (on the basis of MS minimum medium, added Km 50mg/L, Cef 150mg/L, NAA 0.2mg/L), 25-28 ℃, illumination in 15 hours, dark condition was cultivated until taking root down in 9 hours.When the root system for the treatment of regrowth is about 3cm with the covered opening of culturing bottle and keep the skin wet, at 25-28 ℃, illumination condition be 15 hours/all over the world, placed 3-4 days, then plant is extracted at leisure, clean root with agar, be transplanted in the soil, the humidity that keeps soil, and temperature is controlled at 25-30 ℃.

With the RNAi interference expression plasmid conversion tomato plant of above-mentioned same method with tomato ToTOM1.

Three, the Molecular Identification of transfer-gen plant

1, the Molecular Identification of sense-rna transfer-gen plant

Obtain 19 strain kantlex (Kn) resistance sense-rna transfer-gen plants altogether.Before potted plant, seedling is carried out the PCR detection of foreign gene, concrete grammar is: the transgenic Fructus Lycopersici esculenti plant leaf of getting anti-Kn, extract total DNA of tomato plant blade with the CTAB method, and as template, under primer Tomato-ToTOM1-1 and guiding according to primer sequence: 5 '-AATCTTCGTCAACATGGTGGAGCAC-3 ' of 35S promoter sequences Design, carrying out PCR detects, (swimming lane M is lambda/HindIII+EcoRI to the result as shown in figure 16, swimming lane 1-19 is the pcr amplification product of template for conversion total DNA of the different transfer-gen plants of antisense ToTOM1 being arranged, swimming lane 20 positive contrasts, with plasmid pBIT1-2 is the pcr amplification product of template), show to have in 19 strains in the 12 strain transgenic plant to amplify the external source target gene fragment that size is about 3300bp.With positive transgenic Fructus Lycopersici esculenti plant called after T1, T2, T3, T4, T5, T6, T7, T8, T9, T10, T11, the T12 that PCR identifies, the swimming lane 1,2,3,4,7,8,9,10,13,14,17 and 19 among the corresponding Figure 16 of numbering difference.

The positive transfer-gen plant that PCR is identified carries out potted plant, extracts its total DNA after 4 week, cuts after the separation of 0.7% agarose gel electrophoresis is transferred on the Hybond membrane by downward capillary tube technique, with P with Sal I enzyme ³²The PCR fragment that primer: 5 '-AATCTTCGTCAACATGGTGGAGCAC-3 ' with on Tomato-ToTOM1-1 and the 35S promoter of mark obtains is carried out Sonthern hybridization, the result is shown in Figure 17 as scheming, and (swimming lane M is 1kb DNA marker, swimming lane CK is the non-transgenic plant, swimming lane T1-T12 is different transgenic line), show except the hybrid belt that endogenous ToTOM1 occurs in (among the figure shown in the arrow), the hybrid belt that also has external source ToTOM1, all PCR detect the male plant all the segmental insertion of external source ToTOM1.Judge that by the difference in size that Sal I endonuclease bamhi shows the exogenous genetic fragment of transfer-gen plant over half is inserted into chromosomal different loci, promptly belongs to different transgenic lines.The insertion clip size of part plant close (as T1, T3) is difficult for judging, carries out hybridization analysis again after also need cutting with other enzyme and could determine.But, the karyomit(e) base number of tomato is huge, and it is minimum that foreign gene is inserted into the possibility of same position, so resulting transfer-gen plant might all be different strain systems.It is single copies that Figure 17 also demonstrates most of transfer-gen plants, is two copies (T4, T9, T10) but 3 strains are arranged.

2, the evaluation of RNA interference of transgene plant

Obtain the RNA interference of transgene plant of the anti-kantlex of 93 strains altogether.The preliminary PCR of potted plant previous crops detects, amplification NPTII under the guiding of primer Kam-R:5 '-GATCTGGATCGTTTCGCATG-3 ' and primer Kam-F:5 '-AAGGCGATAGAAGGCGATGC-3 ', amplification NOS under the guiding of primer NOS-F:5 '-TGCTACCHAHCTCHAATTTC-3 ' and NOS-R:5 '-ACGACGGCCAGTGAATTCCC-3 ', primer 35S-F:5 '-AATCTTCGTCAACATGGTGGAGCAC-3 ' and ToTOM1-RNAi-2F (guiding under amplification 35S, amplification ToTOM1 under the guiding of primer TA-TOM1-1:5 '-GGGTACCCGAGTATGGCTGGACAAC-3 ' and TA-TOM1-2:5 '-CCACCATATAGCAGAAAGCCCAAGG-3 ', the NPTII of 63 strain resistant plants wherein, NOS, 35S and endogenous ToTOM1 gene test are positive, (swimming lane M is GeneRuler 100bp DNA ladder to the part detected result as shown in figure 18, swimming lane 1-5 is that the 35S of resistant plant detects that (swimming lane 1-5 is followed successively by MLC-ToTOM1-RNAi-370-11,-49,-71,-79,-80), swimming lane 6-10 is that (swimming lane 6-10 is followed successively by MLC-ToTOM1-RNAi-370-11 in the NOS detection,-49,-71,-79,-80), swimming lane 11-15 is that (swimming lane 11-15 is followed successively by MLC-ToTOM1-RNAi-370-11 in endogenous ToTOM1 detection,-49,-71,-79,-80), swimming lane 16-20 is that (swimming lane 16-20 is followed successively by MLC-ToTOM1-RNAi-370-11 in the NPTII gene test,-49,-71,-79 ,-80).Carry out positive plant potted plant.Use the same method after one month and detect, the result only has 3 strains (MLC-TOTOM1-RNAi370-71 ,-79 and-80) to still have positive signal in 32 strains.Extract be positive total DNA of transfer-gen plant of this 3 strain, with EcoR I complete degestion after 0.7% agarose gel electrophoresis separate, transfer on the Hybond membrane by downward capillary tube technique, disturb the TT1 fragment to carry out Sonthern hybridization with the RNA of P32 mark, (swimming lane M is GeneRuler 1kb DNAladder to the result as shown in figure 19, swimming lane ck (-) cuts product for the EcoR I enzyme of non-transgenic tomato, ck (+) cuts product for the EcoR I enzyme of pBITOTOM1RNAi-370, swimming lane 1 is MLC-TOTOM1-RNAi370-80, swimming lane 2 is MLC-TOTOM1-RNAi370-79, swimming lane 3 is MLC-TOTOM1-RNAi370-71), show except the endogenous hybrid belt of 4.2kb, a second hybrid belt that varies in size all appears in all transfer-gen plants, proves that the RNA interference fragment has been incorporated on the tomato dna group.

The disease resistance of embodiment 4, transfer-gen plant detects

One, the disease resistance of sense-rna transfer-gen plant experiment

Adopting frictional inoculation method, with cucumber mosaic virus (CMV) embodiment 3 all 5-6 leaf phase transgenic Fructus Lycopersici esculentis of acquisition are carried out frictional inoculation, is contrast with the non-transgenic tomato of isometric growth phase.

1, symptom performance

Inoculation CMV after 10 days, not genetically modified tomato seedling contrast begins to occur flower leaf paresthesia, the obvious chlorosis of the blade that newly grows (Figure 20), and transfer-gen plant act normally (Figure 21); In the time of 25 days, the symptom of contrast non-transgenic plant is very serious, and the blade that newly grows is chlorosis almost completely, and young leaves deformity (Figure 22).Though the transfer-gen plant of this moment is reveal any symptoms also, comparison is according to will obviously alleviating, and blade is some chlorisis (Figure 23) only.

2, the mensuration of transgenic Fructus Lycopersici esculenti plant inner virus relative quantity

With Chenopodium amaranticolor is withered spot host, measures transgenic Fructus Lycopersici esculenti plant inner virus relative content with biological quantitative method.After inoculating 20 days, get the part young leaves (about 0.5g) of tomato plant and wear into homogenate, be inoculated into the blade of withered spot host plant Chenopodium amaranticolor respectively, each processing connects 2 blades, establishes 2 repetitions, adds up the number of withered spot after five days and carries out significance of difference analysis.The result is as shown in table 1, shows with the transgenic Fructus Lycopersici esculenti to be inoculation source, and the withered spot number that forms on Chenopodium amaranticolor all significantly is lower than the contrast tomato plant that grows directly from seeds.Wherein the withered spot number (34.5/leaf) of transfer-gen plant T9 formation only is 29% of contrast (119/leaf).The quantity of the withered spot that different transgenic lines forms on Chenopodium amaranticolor has evident difference, exceeds nearly 1 times as the withered spot number (68.5/leaf) of T1 plant than T9 plant (34.5/leaf).Withered patch test shows that the CMV concentration of antisense ToTOM1 tomato will be starkly lower than the non-transgenic tomato.

The biology of table 1 antisense ToTOM1 gene tomato on withered spot host Chenopodium amaranticolor quantitatively

Strain system	Withered spot mean number	????t Value	????t 0.05	????t 0.01	Significance
						????CK	??119.5
????T1	??68.5	????7.408	????2.365	????3.499	Extremely remarkable
						????T2	??45.5	????7.300	????2.365	????3.499	Extremely remarkable
????T3	??63.5	????7.743	????2.365	????3.499	Extremely remarkable
						????T4	??37.5	????11.62	????2.365	????3.499	Extremely remarkable
????T5	??37.5	????9.133	????2.365	????3.499	Extremely remarkable
						????T6	??38.5	????11.38	????2.365	????3.499	Extremely remarkable
????T9	??34.5	????8.933	????2.365	????3.499	Extremely remarkable
						????T10	??38.0	????8.759	????2.447	????3.707	Extremely remarkable

Two, the disease resistance of expressed rna interference fragment transfer-gen plant experiment

Adopt frictional inoculation method, with tobacco mosaic virus (TMV) (TMV) the 3 strain RNA interference of transgene plant (5-6 leaf phase) that embodiment 3 obtains are carried out inoculation experiments, with be in the isometric growth phase the non-transgenic tomato be contrast, observe and the record result, the result shows that inoculation is after 10 days, the non-transgenic tomato seedling presents mottled symptom, and transfer-gen plant does not have any symptom performance.Inoculate after 70 days, the non-transgenic plant still shows as mottled symptom, and transfer-gen plant does not still have any symptom performance.After 75 days, take by weighing new leave (third from the bottom the new leave) 0.1g of transfer-gen plant and adjoining tree, measure the interior viral level of transfer-gen plant with the DAS-ELISA method, concrete grammar is: sample adds the 1ml bag and is cushioned liquid (0.015 M Na ₂CO ₃, 0.035 M NaHCO ₃, pH9.6) wear into homogenate, detect after diluting 1000 times, detected result is as shown in table 2, shows that the concentration of TMV in all transfer-gen plants all is starkly lower than the non-transgenic plant.

The DAS-ELISA of the TMV of table 2 expression ToTOM1 RNA interference fragment transfer-gen plant is quantitative

Strain system	Average OD value	Standard error (S.E.)	Standard deviation (S.D.)	Significance
					Non-transgenic plant (contrast)	????1.982	????0.0015	????0.0026
?MLC-TOTOM1-RNAi-370-71	????0.328	????0.0012	????0.0020	Extremely remarkable
					?MLC-TOTOM1-RNAi-370-79	????0.231	????0.0012	????0.0026	Extremely remarkable
?MLC-TOTOM1-RNAi-370-80	????0.491	????0.0015	????0.0021	Extremely remarkable

Sequence table

<160>3

<210>1

<211>288

<212>PRT

＜213〉tomato belongs to tomato (Lycopersicon esculentum Miller)

<400>1

Met?Ala?Arg?Leu?Pro?Leu?Gly?Ser?Ser?Pro?Ile?Asp?Ile?Ala?Gly?Pro

1???????????????5???????????????????10??????????????????15

Val?Thr?Asn?Trp?Trp?Asp?His?Val?Asn?Glu?Ser?Val?Gln?Trp?Gln?Asp

20??????????????????25??????????????????30

Gly?Ile?Phe?Tyr?Ser?Leu?Cys?Ala?Ser?Tyr?Gly?Leu?Val?Ser?Ala?Val

35??????????????????40??????????????????45

Ala?Leu?Ile?Gln?Leu?Ile?Arg?Ile?Asp?Leu?Arg?Val?Pro?Glu?Tyr?Gly

50??????????????????55??????????????????60

Trp?Thr?Thr?Gln?Lys?Val?Phe?His?Leu?Met?Asn?Phe?Val?Val?Asn?Gly

65??????????????????70??????????????????75??????????????????80

Val?Arg?Ala?Ile?Val?Phe?Gly?Phe?His?Lys?His?Val?Phe?Leu?Leu?His

85??????????????????90??????????????????95

Tyr?Lys?Val?Leu?Thr?Leu?Ala?Ile?Leu?Asp?Leu?Pro?Gly?Leu?Leu?Phe

100?????????????????105?????????????????110

Phe?Ser?Thr?Phe?Thr?Leu?Leu?Val?Leu?Phe?Trp?Ala?Glu?Ile?Tyr?His

115?????????????????120?????????????????125

Gln?Ala?Arg?Ser?Leu?Pro?Thr?Asp?Lys?Leu?Arg?Ile?Ser?Tyr?Ile?Ala

130?????????????????135?????????????????140

Ile?Asn?Gly?Ala?Ile?Tyr?Phe?Ile?Gln?Ala?Cys?Ile?Trp?Val?Tyr?Leu

145?????????????????150?????????????????155?????????????????160

Trp?Ile?Asn?Asp?Asn?Ser?Thr?Val?Glu?Phe?Ile?Gly?Lys?Ile?Phe?Met

165?????????????????170?????????????????175

Ala?Val?Val?Ser?Val?Ile?Ala?Ala?Leu?Gly?Phe?Leu?Leu?Tyr?Gly?Gly

180?????????????????185?????????????????190

Arg?Leu?Phe?Leu?Met?Leu?Arg?Arg?Phe?Pro?Ile?Glu?Sar?Lys?Gly?Arg

195?????????????????200?????????????????205

Arg?Lys?Lys?Leu?His?Glu?Val?Gly?Ser?Val?Thr?Ala?Ile?Cys?Phe?Thr

210?????????????????215?????????????????220

Cys?Phe?Leu?Ile?Arg?Cys?Phe?Val?Val?Val?Leu?Ser?Ala?Phe?Asp?Ser

225?????????????????230?????????????????235?????????????????240

Asp?Ala?Ser?Leu?Asp?Val?Leu?Asp?His?Pro?Val?Leu?Asn?Leu?Ile?Tyr

245?????????????????250?????????????????255

Tyr?Leu?Leu?Val?Glu?Ile?Leu?Pro?Ser?Ala?Leu?Val?Leu?Tyr?Ile?Leu

260?????????????????265?????????????????270

Arg?Lys?Leu?Pro?Pro?Lys?Arg?Val?Ser?Ala?Gln?Tyr?His?Pro?Ile?Ser

275?????????????????280?????????????????285

<210>2

<211>6727

<212>DNA

＜213〉tomato belongs to tomato (Lycopersicon esculentum Miller)

<400>2

gagctgaaat?ggctaggttg?ccgcttgggt?cgtcgccgat?tgacatcgcc?ggtccggtga?????60

ccaactggtg?ggaccacgtc?aacgaatccg?ttcagtggca?agatgggatt?ttctactccc????120

tttgtgcttc?ctatggtctt?gtttcagcag?ttgccctagt?aagtttctct?ttctcttcca????180

ttctcttttt?ctgctctgta?gatatgtaaa?gattggtttt?ttctttcctt?tttgtgaatt????240

tcacgatcaa?agtagagttt?gggagctgaa?atgccggaat?tgatgttaga?tgatttatat????300

tttcaactcc?tactaatttg?atgttgagat?gcagttgata?gaattgcagt?gtctagttca????360

tgtataaagt?caagtacttg?ctgttagttg?tttttttttt?cgtaacttct?gttaaaaatg????420

gaaaatcttg?gttggtcaac?tgtaggaatg?aaataatgga?gtagggaatc?agacgagaat????480

gtttgattac?caagtgcaat?ttaggggttt?ccattaagac?aaattacggt?atattttgtg????540

cttttttatg?tcgctaataa?aagtttggag?cagtggactg?actggttaat?catacttctg????600

gtaggttcgg?ttagatggtt?agtatttggg?agtactcctt?ttgtgtgtgc?ttgtgaagct????660

tatgaccttt?tccaataagt?agataagttt?cattgaaggg?tgttttttca?tactttgatt?????720

aatatgtgtt?tcagatacag?tatttaccta?atactgcatg?tgtagagaac?tgttttcctc?????780

gtggtgcttg?cttagtcgca?ggacttttgg?ttgagtctat?gagttaacta?tgtgcagatt?????840

caattaatac?gaattgattt?gagggtaccc?gagtatggct?ggacaacaca?aaaggtgttc?????900

catctgatga?actttgttgt?aaatggaggt?aaagcggact?cagactaaac?aaaccgtcca?????960

gctctttttc?ttaatctgga?attttgtttt?aaatgcaaat?cttttgtttt?tcagttcgtg????1020

caattgtctt?tggatttcac?aaacatgttt?ttctgctcca?ttataaggta?atattctttc????1080

ttaaaagtaa?cttttcaatt?gtcaatattt?tttcttaatt?atgttcagtt?tgttttcaat????1140

agaacgcgac?aatatatgca?aacctgaata?tattgccttt?gttcttatca?gccatttaac????1200

ttttccccaa?ataatggttc?ttttcctata?gtgcgtcaac?ttacatagga?actatcaaaa????1260

atcaaaatta?ggtcagaact?gtacctagaa?aatttatcac?ctgatgggac?cattttcaag????1320

gcaagtgcat?gcatgttact?tttgctgatt?ggagctgtag?gctttcttat?atctttgaca????1380

ctcttaactt?tgagcttaat?ttgacatttt?agattcctta?ccttctaatt?tatttattcg????1440

gaaggtcatc?ctgctctctt?acagctagta?caatccaata?gcagttcagc?aatccttgtt????1500

tgttaatgtg?tgagctaatt?ggattgaaag?cacattagta?tatacattct?gtctttcaga????1560

ttccagtttg?aagcttatca?cctagttact?catcttttac?ttgccctaaa?attttggttt????1620

gactgtgatg?ggccgatgac?attgttcaag?tgcttagttc?ctctgcagcc?agcaacaccg????1680

tagtgttacc?atgtcaatcc?tttagctttg?actatcattt?tattgagatg?aattttctgt????1740

tagcaataac?gaatctactg?aaagcacctc?ccctttacga?cttccgtgat?ctctttcctt????1800

catttgggtg?ggctactaat?ggccccgtcc?ctttttagcc?cgataactta?agaagtagaa????1860

ataattaaca?tgcccacaac?tgcctcttaa?actgctgcct?aattgttaac?ctgatgttag????1920

atttgcttca?cgataaccag?gtgctgactc?tggcaatatt?ggacctacca?gggctccttt????1980

tcttttcaac?attcacactc?cttgttctat?tttgggctga?gatatatccc?caggcaagtg????2040

aagttatagc?atcttgcagg?caaactgtaa?atctattgat?tctaaccctt?gcatttatgt????2100

aatggcaggc?taggagttta?ccaacagata?agctcaggat?ttcttatatt?gccattaatg????2160

gtgccatata?cttcattcag?gtttgctaca?aatgtatccc?ctgctcatac?gctattggac????2220

atcatggttg?ttcatatgga?aatataatcg?atcaagtatt?attacttatt?tttattttgt????2280

ctctagtaat?atgtgaattc?ctttaagatt?cttttacgcc?agtcaaaccc?atctactttt????2340

gggttctatt?tgataacccc?ttgtattttg?gtggtgacag?gggtggatta?gtgtagaagt????2400

tatgggttca?actgaaaaag?ggttcctgga?acccaacatt?agctcaaacc?ctgtatatat????2460

gttaaaaatt?ttgtaaacaa?gtaaacataa?tagattttga?acccactaaa?tcaatcgggt????2520

tgtggtagaa?tttctgagac?acataaagtt?cgaatcctgg?agccgcctca?ttgatctgtg????2580

ggcatatgtg?tgcttctcaa?tatgtggaat?tctgagatat?tcttctttct?caaaatgtta????2640

tgccgggtta?acctggggta?acatgctagg?agaaaagttt?aattcggagc?tctccatcta????2700

cttccattat?caaatattca?tagcttggtt?ccggttatac?ctttaattat?tttttcgaga????2760

accgatggaa?tatctttcca?agaccttgca?ataaattttt?acagaaccat?atgcaaattt????2820

agccttgaaa?tagggctaga?ttctcctaat?ccccatcccc?tgagaaccct?atctcttccc????2880

tttcctaaag?gatagagcat?ttctaaataa?ataaagatgt?ccattgttct?tgatttcttg????2940

gtgaacattt?cctatcgacc?cgcttgtctc?aaaagctaag?aatcttcttc?agtcttcctg????3000

gttttatctc?aggtaataaa?ctaaatacaa?ctgaaaaatc?gtttttgtca?ggcctgtatc????3060

tgggtttacc?tctggatcaa?tgacaatagc?acagtggaat?tcattgggaa?gatatttatg????3120

gcagttgtat?ctcttatata?tcaattttct?ccttttgccc?tattttactg?aaggttagat????3180

ctgctttcaa?agttattgct?ttctttaacc?ttgcatgttt?attgggcagt?gtatcagtta????3240

ttgcagcctt?gggctttctg?ctatatggtg?gaaggtgaat?taagctctaa?ttttctctgg????3300

gcattaatct?tctaaagcat?tattgagatt?atcagttatt?gcagccttgg?gctttctgct????3360

atatggtgga?agggaattta?agttctaatt?ttctctgggc?atttatcttc?taaagcatta????3420

ttgatgattc?ttagatgacc?ttagacatga?ttaaatttca?ttgtttttct?tggggaattg????3480

gtttttacaa?tcatcaggtt?atttctcatg?ctgcggcgct?tccctattga?atctaaaggg????3540

aggagaaaga?agcttcatga?ggtttgtgta?ctatacatct?gtcttcctct?ttctttttct????3600

ttttttcttt?tcttttaact?ggtaaagatt?tttacacttt?tatcttctta?ctttatgtat????3660

acagaggtta?gtgctgtagt?ttggcataga?atacgtttgc?atgtaaggca?taagatgtat????3720

tcctcacaaa?cttaagttct?ccctacagca?ccgagaggga?gaaacttttt?aaacatgaag????3780

tttgattaat?ttccttgtcc?taagaagtcc?tgctaattgt?tctgctatat?tataatctta????3840

acttgtgggt?gaatgactgc?tatatttagt?ccagataaca?tttaagtgga?gagataagag????3900

taaggctatc?tctgagattg?tataatttaa?ttctaaaatg?ataattaaca?agaacagatg????3960

gaaccttgtt?atgacattct?tattcagaca?tttttattca?gtgcgtgaag?gggtaacctt????4020

ttggtcatgg?atccactaaa?ctgtcaaagg?ctggtgcata?cttctttttc?tatttagttt????4080

gtgtcacata?atttgtttga?cttacaccat?aagctcaact?ccagcaaatt?attaatttct????4140

gtagctgcta?tctgatggga?ctgttcaaag?ttgtttggat?atacatagac?agaagatgtc????4200

aagtaataaa?gattgcctaa?caaaatgagc?aggaatgtaa?caaattataa?catacaacat????4260

tagggtacca?actgttgatg?tctcccttct?ctagattcct?cttttttgat?gattaagtaa????4320

gattttatta?aaccatctgc?agcaccaaca?aggtgtaaga?gtgcccgata?gtagctagaa????4380

atttattcct?ttaacaatat?aaggagtcaa?ttaactccac?tatatggtca?aaatcactag????4440

cagcatcctg?cttcaaaaat?tcatgttctg?taagcatttc?aatgggcatt?actaaaggta????4500

attaaaggaa?cgtatgcttt?aatcctgaaa?gcagctgcag?ttccctttct?atattaacca????4560

tctgaaataa?catagagaga?ttctgtaagt?tcctctgtat?attttttaat?aaggtcctct????4620

gtttcttctt?tattccctgc?attgtcatct?ttgtactgcc?tctaccaggc?atcatccaaa????4680

caatcccaaa?ccggtttaga?aatatacacc?aagttatcca?tatgaatttg?caacgtagga????4740

gtaactgtcc?aaatgattta?aagccctctt?tgcagtagta?ggatctggtg?gagaagtgaa????4800

atcttccctc?tgtgctgggc?tatcataang?tacttatgtt?tcattaaggg?taatacccaa????4860

aaancagcca?ctttgggagt?agctctggtc?ctccaaagtc?atcttccatg?actattagag????4920

ccaatattac?cacattcttc?cttaacaact?aactgtatca?tgctttaggt?gagaagttcg????4980

catcatccaa?tgatccattt?ccatcactcc?ccctaattta?acaactagca?cacacagact????5040

gtacctagtg?ttgatgattt?ttttaagaaa?aaaattgatg?atttattcta?cattggagat????5100

tccagcattc?tcctttggag?ggttctccaa?tggtacgtcg?aacactcttt?gttgatgaca????5160

agattatatt?aacttgggaa?gagttatttc?agagttctgg?tttccagtca?tttgtcttgc????5220

catagtttgt?tcttctgctg?ttatccactt?tgacctttcc?atctctgcaa?actctcccca????5280

tggatttccg?attcatcttc?ctaatacaac?tccataagat?gtgactgctt?tactgcatca????5340

ttgtccatca?attccatatt?aatctttgat?catcccttcc?acatcttctc?tttgttttcc????5400

atggccattt?gaacttaaaa?gacaataaat?agtctgaagc?tcttcactac?tagtggctga????5460

tttccttttc?ttctctgttg?atgaataaac?aggaaaaaaa?atatcttaga?ttagtctgac????5520

tagatggaaa?ctcaatatta?acatatgatg?tttctgaaga?aagaatcttt?tttatcatta????5580

tttgtgaacc?taaggagttc?ttttgttctt?caatgatcat?tagtgaccaa?ctcaagaaaa????5640

tgatttattg?gtctatctga?ttgttctaac?atcgtcttct?acatcaccaa?ccattaaatg????5700

atgctgctgt?gaatatgttt?gtgttatctg?aagttctaat?gaattgtttc?taggcatatg????5760

catgcatgat?aggtcatggc?ttataattct?taacatctct?tactgtaaat?catctgatct????5820

aatgtatgta?tgtgaacaca?ggttggatcg?gtgactgcca?tatgtttcac?ctgtttcctc????5880

attagatgct?ttgtggttgt?aaggctttat?gtacctgttt?ctttctccct?atgctggtca????5940

acctttttat?catcccaagt?ataacagtgt?cctaagctcc?attattaagc?ttttgcaaaa????6000

ctgggttaac?caaaattaag?ccacttctta?agcttttttt?acggggaagg?tccaagcaag????6060

gaaattgagt?ttttacccca?tcgggtgctt?ttagtttgta?agaggtgaaa?ccattaggct????6120

atctttatga?aataaagggt?tgcaacctat?gccttccttc?aggcttcagt?caaaccataa????6180

cttactcctg?ggaacaaata?ataggaaaag?gtagactaga?gaataggaac?atgatcaaaa????6240

aaagagaaag?cataggttta?aagtaaagct?aaaccggcct?caaatctcta?actctcatgc????6300

acatgagctt?gttttctatg?tctaatcttg?gttcgctgca?ggttgtgtta?tctgcttttg????6360

attctgacgc?atctcttgac?gtcttggatc?atcctgtttt?gaatctgata?tactacctgg????6420

tatgtatcat?tttcgttatt?tcatgttcct?tgcgcttact?gctttgtctg?agtgatcaca????6480

ttcttctctg?tggcagctgg?tagaaattct?tccttcagct?cttgtgctgt?acatcctgcg????6540

aaaactgcct?ccaaaaagag?tgtctgcaca?ataccaccca?atcagttagc?tgcagcagaa????6600

ttttatcgtt?agtgatacac?gttcccatgg?tttctgttgc?agaagctaac?tggagttgtt????6660

caggaaaagt?gaaactgcaa?aaggatattc?ggttgcaata?attctgcgga?aaggcaaaga????6720

ttcaacg??????????????????????????????????????????????????????????????6727

<210>3

<211>1282

<212>DNA

＜213〉tomato belongs to tomato (Lycopersicon esculentum Miller)

<400>3

acaacaagat?aagcggaggg?gagagctgaa?atggctaggt?tgccgcttgg?gtcgtcgccg??????60

attgacatcg?ccggtccggt?gaccaactgg?tgggaccacg?tcaacgaatc?cgttcagtgg?????120

caagatggga?ttttctactc?cctttgtgct?tcctatggtc?ttgtttcagc?agttgcccta?????180

attcaattaa?tacgaattga?tttgagggta?cccgagtatg?gctggacaac?acaaaaggtg?????240

ttccatctga?tgaactttgt?tgtaaatgga?gttcgtgcaa?ttgtctttgg?atttcacaaa?????300

catgtttttc?tgctccatta?taaggtgctg?actctggcaa?tattggacct?accagggctc?????360

cttttctttt?caacattcac?actccttgtt?ctattttggg?ctgagatata?tcaccaggct?????420

aggagtttac?caacagataa?gctcaggatt?tcttatattg?ccattaatgg?tgccatatac?????480

ttcattcagg?cctgtatctg?ggtttacctc?tggatcaatg?acaatagcac?agtggaattc?????540

attgggaaga?tatttatggc?agttgtatca?gttattgcag?ccttgggctt?tctgctatat?????600

ggtggaaggt?tatttctcat?gctgcggcgc?ttccctattg?aatctaaagg?gaggagaaag?????660

aagcttcatg?aggttggatc?ggtgactgcc?atatgtttca?cctgtttcct?cattagatgc?????720

tttgtggttg?tgttatctgc?ttttgattct?gacgcatctc?ttgacgtctt?ggatcatcct?????780

gttttgaatc?tgatatacta?cctgctggta?gaaattcttc?cttcagctct?tgtgctgtac?????840

atcctgcgaa?aactgcctcc?aaaaagagtg?tctgcacaat?accacccaat?cagttagctg?????900

cagcagaatt?ttatcgttag?tgatacacgt?tcccatggtt?tctgttgcag?aagctaactg?????960

gagttgttca?ggaaaagtga?aactgcaaaa?ggatattcgg?ttgcaataat?tctgcggaaa????1020

ggcaaagatt?caacgctttt?ttggcagttg?ttaaaacaga?ggttaagctg?ttttgcttac????1080

attatattgt?ttctgtggtt?ttagtgtgaa?gcatgagaca?aataagtgtt?ccccacgtct????1140

gtgaaaaatc?ctagtcatga?tgtaatgacg?cagagggtaa?atctcagtat?cgccattgta????1200

ctggcatgtt?gtaactatga?tgttctggat?ctcctttact?gcaatgactg?atgtcctttg????1260

tttggtcaaa?aaaaaaaaaa?aa?????????????????????????????????????????????1282

Claims (10)

1, a kind of tomato RNA virus host factor is the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 1;

2) with SEQ ID № in the sequence table: 1 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of supporting the virus replication effect.

2, the encoding gene of the described tomato RNA virus host factor of claim 1.

3, encoding gene according to claim 2 is characterized in that: its genomic gene is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 2 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit.

4, encoding gene according to claim 2 is characterized in that: its cDNA gene is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 3 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit.

5, the expression vector that contains claim 2 or 3 or 4 described encoding genes.

6, the transgenic cell line that contains claim 2 or 3 or 4 described encoding genes.

7, the host bacterium that contains claim 2 or 3 or 4 described encoding genes.

8, a kind of method of cultivating antivirus plant is that the inverted defined gene fragment of ToTOM1 or the rnai expression carrier of ToTOM1 are imported in the plant, obtains transfer-gen plant.

9, method according to claim 8 is characterized in that: described by the plant of plant transformed host for Solanaceae, Cruciferae or cucurbit section.

10, claim 2 or the 3 or 4 described encoding genes application in cultivating antivirus plant.

Images