CN103947461A - Method for enabling scion variety to acquire virus resistance as well as RNA (Ribonucleic Acid) interference vector pCAMBIA2300-CP and transgenic method - Google Patents

Abstract

The invention discloses a method for enabling a scion variety to acquire virus resistance as well as an RNA (Ribonucleic Acid) interference vector pCAMBIA2300-CP and a transgenic method, belonging to a transgenic technology of plants and application thereof. The method comprises the following steps of firstly, preparing a transgenic stock for resisting virus; secondly, enabling scions to be grafted onto the transgenic stock for growing and developing. The method is characterized in that the virus-resisting transgenic stock is obtained by transferring the RNA interference vector; a target sequence of the RNA interference vector is a gene segment in a target virus genome. The method disclosed by the invention is used for a test that a tomato scion variety acquires the virus resistance, and a good effect is obtained; aiming at a specific embodiment of the tomato, the constructed RNA interference vector is pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP or pCAMBIA2300-CMV5. The invention also provides the improved transgenic method. According to virus-resisting plants obtained by using the method, potential safety hazards of transgenic foods can be effectively avoided; in addition, the acquiring efficiency of virus-resisting transgenic varieties can be greatly increased.

Description

A kind of method and rna interference vector pCAMBIA2300-CP and transgenic method that makes scion variety obtain virus resistance

Female case is for the first time and for the second time in notification of examiner's opinion, and auditor points out that female case exists multinomial invention, does not possess unicity, so applicant determines not divide an application to not obtaining the invention of protection in female case.The application is application number 201110315208.9(denomination of invention: dividing an application a kind of method and rna interference vector and transgenic method that makes scion variety obtain virus resistance).

Technical field

The present invention relates to plant transgenic technology and application thereof, particularly a kind of method and rna interference vector and transgenic method that makes tomato scion variety obtain virus resistance.

Background technology

Plant virus is to cause gardening plant production declining and the bad major reasons of product qualitative change such as fruit tree, vegetables, flowers, and in agricultural production, virus disease is the second largest class disease that is only second to fungi, due to control difficulty, have the title of " plant cancer ".The conventional prophylactico-therapeutic measures of plant virus at present has elimination virus source and traditional medium, applies detoxification technology, chemical control and breeding resistant variety etc., and wherein breeding resistant variety is effective, the most most economical method of control virus disease.RNA perturbation technique be basic plant disease-resistant technology because of features such as its high efficiency, specificitys, in plant virus resistance breeding, represented considerable prospect.

Gene silencing or title RNA disturb (RNA interference; RNAi) refer to due to transgenic sequence or invade virus outward and there is autoploidy highly with the endogenous or exogenous gene sequence being silenced, its transcription product forms double-stranded RNA (double-stranded RNA, dsRNA) structure, thereby the homology of degrading specifically target gene mRNA, make it to occur reticent (Fire A., Xu S., Montgomery M.K., et al.Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans[J] .Nature, 1998,391 (6669): 806-811).Because its interference effect is the post-transcriptional level that occurs in target gene, therefore, also become PTGS (post-transcriptional gene silencing; PTGS).Plant RNA i has the features such as specificity, high efficiency, systematicness and hereditability.Can utilize RNAi technology to carry out gene functional research; Or the specialized character variant that directly utilizes RNAi to create carries out plant improvement.Wherein RNAi technology has obtained good achievement in research aspect plant virus resistance.RNAi is the defense mechanism of ubiquitous exogenous nucleic acid (as virus) invasion in eucaryote; simultaneously existing research further shows that it is to have degraded and have result (the Frank G.R. of pathogenic homology virus (strong strain) due to the RNA silence that induction virus (weak strain) produces that virus produces cross protection; Stuart A.M.and David C.B.Gene Silencing without DNA:RNA-Mediated Cross-Protection between Viruses[J] .Plant Cell; 1999,11:1207-1216).Utilize RNAi to support antiviral conventional strategy to be: the sequence of selecting one section of plant virus gene, with the mode of inverted repeats be built into transcribe after containing double-stranded RNA (the hairpin RNA of hairpin structure, hpRNA) or containing the ihpRNA(intron-hairpin RNA of intron) expression vector, by particle gun, viral vectors transfection or agrobacterium mediation converted, be incorporated on plant gene, expression in vivo dsRNA, directly or indirectly the generation of induction RNAi, plays to antiviral object.And in hairpin structure research, think that ihpRNA expression vector is than high (the Helliwell C of hpRNA expression vector silence efficiency, Waterhouse P.Constructs and methods for high-throughput gene silencing in plants [J] .Methods, 2003,30(4): 289-295).

Gardening plant kind and various in style, is generally standing the threat of virus by the gardening plant offspring of the approach procreation of nourishing and generating.Numerous vegetables of cultivation in producing at present, fruit and flowers all have tens to up to a hundred kinds, almost each kind has several to arrive tens of kinds of virus diseases, virus disease has suppressed growth, the result of plant, reduced the Yield and quality of fruit, plant even causes dead tree, once, by virus infection, will be with poison to be injured lastingly throughout one's life.Utilize technique for gene engineering to improve for each kind, improve its antiviral ability, though feasible, need cost a large amount of manpower and financial resources.Grafting is one of method of many gardening plant breedings, and most fruit trees and Vegetable adopt propagation by grafiting.Grafting can keep the merit of scion variety, can utilize again the advantageous feature of stock.When using graft is bred, the different cultivars in general one species adopts same stock, and even some variety classes in belonging to together also adopts same stock.The multiplex situation of such anvil, makes to improve stock variety than improvement scion variety is many efficiently separately.

So-called botanical system gene silencing refers to: dsRNA, the short distance that the gene silencing signals such as aberrant RNA or siRNA both can have been undertaken by protoplasmic connection is transmitted, also can transmit (Brosnan C.A. by the long distance of the skeleton in plant, Mitter N., Christie M., et al.Nuclear gene silencing directs reception of long-distance mRNA silencing in Arabidopsis[J] .Proc Natl Acad Sci U S A, 2007, 104 (37): 14741-14746), (Kalantidis K., Schumacher H.T., Alexiadis T., et al.RNA silencing movement in plants[J] .Biol Cell, 2008, 100 (1): 13-26), and it is reticent to induce whole plant to produce system.(the Daniel H.C such as Daniel H., Fabio T.S., Miya D.H, et al.Pattern formation via small RNA mobility[J] .Genes & Dev, 2009,23:549-554) research shows that microRNA can be used as a kind of regulation and control of signaling molecule involved in plant development of movement.Direction of transfer about reticent signal in plant exists different reports.(the Palauqui J.C. such as Palauqui, Elmayan T., Pollien J.M., et al.Systemic acquired silencing:transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocks to non-silenced scions[J] .EMBO J, 1997,16 (15): 4738-4745.) take tobacco as examination material, the conduction of finding PTGS is unidirectional, can only be transmitted to from reticent stock the scion of non-silence, and (the Sonoda S.and Nishiguchi M.Graft transmission of post-transcriptional gene silencing:target specificity for RNA degradation is transmissible between silenced and non-silenced plants such as Sonoda, but not between silenced plants[J] .Plant J, 2000, 21 (1): 1-8) research shows, the conduction of PTGS is twocouese, from stock to scion or from scion to stock, all can conduct, but the conduction efficiency of PTGS from scion to stock is starkly lower than the conduction from stock to scion.(the Li Ming such as Li Ming, Jiang Shiling, Wang Youqun, Deng. post-transcriptional silencing signal can be in arabidopsis graft bi-directional [J] fast. Science Bulletin, 2006,51 (2): result 142-147) shows no matter use RNAi type plant as stock or scion, gene silencing signal all can cause the hit minimizing of gene mRNA of corresponding wild type scion or stock, genetic transcription is described after reticent signal can be by grafting face bi-directional in arabidopsis body.But miRNA(micro RNA) or amiRNA (artificial miRNA) also do not find between graft, to transmit, accordingly, inventor's hypothetical system gene silencing direction may be relevant with species or detection level or method, but the relevant reticent signal of siRNA that can be certainly obtains overexpression in transgenosis mode can upwards pass to scion from stock.

In plant, about the initial clue of systemic gene silencing, from tobacco grafting, test.(the Palauqui J.C. such as Palauqui in 1997, Elmayan T., Pollien J.M., et al.Systemic acquired silencing:transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocks to non-silenced scions[J] .EMBO J, 1997,16 (15): 4738-4745) a bud grafting on another plant time, first that the Nitrite reductase of this plant is reticent, on the young shoot of grafting, this gene is also reticent.The gene being silenced in young shoot is identical with the gene being silenced in stock, has sequence-specific.(the Sonoda S.and Nishiguchi M.Graft transmission of post-transcriptional gene silencing:target specificity for RNA degradation is transmissible between silenced and non-silenced plants such as Sonoda, but not between silenced plants[J] .Plant J, 2000,21 (1): research 1-8) has also drawn similar conclusion, and prove after grafting, even if the PTGS that scion obtains can not keep when reticent stock does not exist yet. simultaneously

In recent years, around genetically modified organism breeding, China is realizing in line with international standardsly aspect genetically modified organism safety management and safety evaluatio research, and obtained the progress attracting people's attention.But the related resistance selected marker impact on foodsafety in related gene engineering, groups of people have doubt always, and this subject under discussion has been avoided in the research of this project cleverly, because the systemic resistance that scion obtains, derive from the reticent effect of the microRNA in stock, therefore in theory, in grafting transgene silencing plant scion variety, will not contain resistance marker.In order to improve the ability of the anti-target viral of scion variety, if only need reach the object that strengthens anti-this target viral of scion variety after grafting by improvement stock, this will open up a brand-new approach for the breed improvement of gardening grafting plant.But up to the present, by grafting method, scion variety is obtained in the research of gene silencing effect, target gene be all some genes of plant self, do not see so that research that germ or viral gene are target is reported.

Summary of the invention

The present invention is according to the blank in above-mentioned field and demand, provide a kind of tomato plant that makes to obtain the method for resisting virus capable, and the method relates to rna interference vector, improved transgenic method etc., the antiviral plant that the method obtains can effectively evade the potential safety hazard of genetically modified food, and can greatly improve the efficiency that obtains antiviral transformed variety.

Make scion variety obtain a method for virus resistance, its step is as follows:

(1) prepare antiviral transgenosis stock;

(2) scion grafting is grown to described transgenosis stock;

It is characterized in that: described antiviral transgenosis stock obtains for proceeding to rna interference vector, and the target sequence of described rna interference vector is the genetic fragment in target viral genome.

Described target viral refers to cucumber mosaic virus CMV, and described scion variety and transgenosis stock are all tomato variety, and the target sequence of described rna interference vector is as Seq ID No.1, shown in 2,3,4,5 or 6.

Described rna interference vector is pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP or pCAMBIA2300-CMV5.

The antiviral transgenosis stock of described preparation, transgenosis comprises the steps:

(1). tomato sowing, (2). cut cotyledon preculture, (3). the cotyledon after antibacterial screening and culturing Agrobacterium tumefaciems engineering bacteria infects, (4). short differentiation is cultivated, (5). and culture of rootage, is characterized in that:

Before the planting seed of described tomato, through sterile water, infiltrate 5～8 hours; 20% clorox sterilizing 10min, aseptic washing 5 times, each 5min; 30 ℃ of incubator vernalization two days;

The described cotyledon preculture of cutting is before true leaf does not occur, to cut cotyledon to carry out preculture;

Described antibacterial screening and culturing: infected by Agrobacterium tumefaciems and secretly cultivate the cotyledon of 2 days, in culture medium C: pH6.0, Medium Base+2mg/L trans ribosylzeatin+200mg/L Ticarcillin/Clavulanate Acid+100mg/L kanamycin, blade back is illumination cultivation upward, 10d transfers once, until there is green callus or bud point; Explant with bud point is proceeded in culture medium C 1: pH6.0, in Medium Base+1mg/L trans ribosylzeatin+80mg/L kanamycin+200mg/L Ticarcillin/Clavulanate Acid, cultivate 10～14d, wait to break up and sprout;

Described short differentiation is cultivated: the resistant buds screening in micro-organisms is transferred in culture medium C 3: pH6.0, Medium Base+0.5mg/L trans ribosylzeatin+1.5mg/L3-heteroauxin+80mg/L kanamycin+200mg/L Ticarcillin/Clavulanate Acid;

The medium of described culture of rootage is: pH6.0, Medium Base+2mg/LIBA+200mg/L Ticarcillin/Clavulanate Acid.

The rna interference vector that the cucumber mosaic virus gene of take is target, is characterized in that, the target sequence of described rna interference vector is as Seq ID No.1, shown in 2,3,4,5 or 6.

Described rna interference vector is pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP or pCAMBIA2300-CMV5.

Conversion has bacterial strain or the plant cell of above-mentioned rna interference vector.

Described bacterial strain refers to Agrobacterium tumefaciems bacterial strain EHA105.

Described plant cell refers to the explant precursor of transgene tomato stock.

A method of preparing transgene tomato stock, comprises the steps:

(1). tomato sowing, (2). cut cotyledon preculture, (3). the cotyledon after antibacterial screening and culturing Agrobacterium tumefaciems engineering bacteria infects,

(4). short differentiation is cultivated, (5). and culture of rootage, is characterized in that:

Before the planting seed of described tomato, through sterile water, infiltrate 5～8 hours; 20% clorox sterilizing 10min, aseptic washing 5 times, each 5min; 30 ℃ of incubator vernalization two days;

The described cotyledon preculture of cutting is before true leaf does not occur, to cut cotyledon to carry out preculture;

Described antibacterial screening and culturing: infected by Agrobacterium tumefaciems and secretly cultivate the cotyledon of 2 days, in culture medium C: pH6.0, Medium Base+2mg/L trans ribosylzeatin+200mg/L Ticarcillin/Clavulanate Acid+100mg/L kanamycin, blade back is illumination cultivation upward, 10d transfers once, until there is green callus or bud point; Explant with bud point is proceeded in culture medium C 1: pH6.0, in Medium Base+1mg/L trans ribosylzeatin+80mg/L kanamycin+200mg/L Ticarcillin/Clavulanate Acid, cultivate 10～14d, wait to break up and sprout;

Described short differentiation is cultivated: the resistant buds screening in micro-organisms is transferred in culture medium C 3: pH6.0, Medium Base+0.5mg/L trans ribosylzeatin+1.5mg/L3-heteroauxin+80mg/L kanamycin+200mg/L Ticarcillin/Clavulanate Acid;

The medium of described culture of rootage is: pH6.0, Medium Base+2mg/LIBA+200mg/L Ticarcillin/Clavulanate Acid.

The object of the invention is, by the combination of systemic gene silencing and graft technology, first makes stock obtain the resistance to intrusive viruses, and then stock is transduceed its virus resistance to make to graft in the scion variety acquisition virus resistance on this stock to scion.The thinking that the present invention is different from prior art is: structure for transform stock rna interference vector gene silencing to as if the gene of intrusive viruses, and the gene of non-plant itself.

In the present invention, take tomato as stock and scion examination material, take host comparatively widely cucumber mosaic virus CMV carry out concrete verification experimental verification as target virus, experimental data shows, scion tomato has obtained good CMV virus resistance.Based on design of the present invention; the normal experiment technical ability that the guidance of the experimental technique of recording in specification and those of ordinary skills possess; those skilled in the art method of the present invention can be applied to a variety of be easy to be subject to virus infection and can the plant of grafting in, in the scope that this application is all asked for protection in the present invention.That is, method of the present invention is not limited to be applied on the tomato of recording in specific embodiment.

The present invention be take tomato as examination material, with cucumber mosaic virus (Cucumber Mosaic Virus; CMV) be target object, verify design of the present invention.By selecting respectively CMV5 gene OPF fragment and 1 totally 6 ihpRNA plant expression vector that merged 5 genetic fragments, adopt agrobacterium mediation converted tomato, make transformed plant produce siRNA, inoculation CMV filters out the transfer-gen plant of high antiviral.Afterwards with the T0 of resistant plant or T1 on behalf of stock, the not genetically modified tomato of grafting, the siRNA in stock is transported in scion, to strengthen the resistance of scion to CMV.At present, in cultivation, also find no the resistant gene to CMV virus in tomato variety, and also only there is disease tolerance kind in cultivation tomato variety, utilize conventional hybridization method to be difficult to obtain CMV resistance tomato variety.Therefore by the method for RNA interference of transgene, be the effective way that obtains fast CMV resistant material.In recent years, around genetically modified organism breeding, China is realizing in line with international standardsly aspect genetically modified organism safety management and safety evaluatio research, and obtained the progress attracting people's attention.But the related resistance selected marker impact on foodsafety in related gene engineering, groups of people have doubt always.And the present invention has avoided this subject under discussion cleverly, because the systemic resistance that scion obtains, derive from the reticent effect of the microRNA in stock.Therefore in theory, grafting transgene silencing plant scion variety genome and produce female/will not contain resistant maker gene in andro gamete, prevented the drift of antibiotics resistance gene.

The present invention includes following steps:

A. for 5 genes of cucumber mosaic virus (CMV), by comparison tomato est database, choose the fragment in CMV5 gene ORF interval, by PCR and overlapping PCR, build 5 containing CMV specific gene fragment and 1 reticent expression vector of ihpRNA plant that has merged 5 genetic fragments;

B. utilize the genetic conversion system after improvement, by agrobacterium mediation converted tomato plant, detect and obtain transgenic positive plant, cottage propagation transfer-gen plant (T0 generation);

C. by inoculation CMV virus, compare the CMV resistance of different carriers transgenic line, filter out the transgenic line of high antiviral;

D. utilizing resistance cuttage seeding (T0 generation) or T1 is stock for plant, grafting wild type plant (not transfer-gen plant), and inoculation CMV virus, detects the grafting plant that obtains virus resistance;

E. extract the total RNA of stock and scion, be reversed to cDNA, the expression of RT-PCR detection of antibiotics resistant gene.

Accompanying drawing explanation

Fig. 1: cucumber mosaic virus (CMV) genome structure feature

Fig. 2: the vector construction scheme that the present invention adopts

Fig. 3: 5 structures containing CMV gene specific fragment carrier

M2K/15K：Marker2K/15K；

A: cut checking cloning vector pUCCRNAi-1A～CP with PstI/SalI enzyme, the small fragment that cuts out is the inverted repeats that is built into cloning vector;

B: by the inverted repeats from pUCCRNAi-1A～CP enzyme is cut, be built into expression vector and obtain pCAMBIA2300-1A～CP carrier;

C:1～3:PstI/SalI enzyme is cut checking expression vector pCAMBIA2300-1A～CP, and the small fragment that cuts out is the inverted repeats that is built into cloning vector.

Fig. 4: containing the structure of 5 CMV genetic fragment fusion vectors

A.1:Marker be 2K, utilize respectively R1AF/R1AR and R2AF/R2AR primer amplification fragment 1AF and 2AF;

A.2: utilize R1AF/R2AR primer, take 1AF and 2AF mixture is template, and fragment 1A+2A is merged in amplification;

B.1: utilize respectively R2BF/R～RCPF/R primer amplification fragment 2BF, 3AF and CPF;

B.2: utilize R2BF/RCPR primer, take 2BF, 3AF and CPF mixture is template, and fragment 2B+3A+CP is merged in amplification;

C.:CMV5 is for utilizing R1A F/RCP R primer, and take 1A+2A and 2B+3A+CP mixture is template, and fragment CMV5 is merged in amplification;

D.:PstI, PstI/SalI enzyme is cut and is detected pCAMBIA2300-CMV5 carrier.

Fig. 5: the tomato transgenosis step after the improvement that the present invention adopts

Fig. 6: the PCR of transgene tomato detects (part strain detects in batches)

M:Marker2K; +: plasmid pCAMBIA2300-1A is template; CK: transgene tomato MoneyMaker is not mould 1A～CMV5-1～9: represent to take Actin1PF/IntornR as primer the band that the corresponding transgenic line of different target carrier is template amplification

Fig. 7: the Southern hybridization check of transgene tomato part strain

M:Marker15K; +: plasmid pCAMBIA2300-1A is template (enzyme does not cut entirely); CK: transgene tomato MoneyMaker is not template; T01A～CMV5.1～2: represent the corresponding transgenic line Southern hybridization of different target carrier band

Fig. 8: the RT-PCR of Transgenic Tomato Plants detects

M:Marker2K; +: plasmid pCAMBIA2300-1A is template; CK: transgene tomato MoneyMaker is not template; T01A～CMV5.1～2: represent to take respectively 1AF～CPF and R1AF(T0CMV5) be upstream primer, IntronR is downstream primer, the band of the corresponding transgenic line of different target carrier that increases

Fig. 9: the cottage propagation of transgene tomato and CMV attack the antiviral T0 of poison screening for strain

CK: be Transgenic Tomato Plants MoneyMaker not; T01A～CP.1～2 and T0CMV5.1～5: represent different transgenic line cuttage seeding, identifying virus resistance after inoculation CMV virus, in figure, strain is the part high resistance strain filtering out

Figure 10: the breeding in transgene tomato T1 generation and CMV attack the antiviral T1 of poison screening for strain

CK: be Transgenic Tomato Plants MoneyMaker not; T11A.1～CMV5.1: represent different transgenic line T1 generation, identifying virus resistance after inoculation CMV virus

Figure 11: the graft technology that the present invention adopts

Figure 12: after grafting, the RT-PCR of antibiotics resistance gene NptII detects

M:Marker2K; +: plasmid pCAMBIA2300-1A is template; CK: transgene tomato MoneyMaker is not template; T01A～CMV5.1～2: represent to take that the upper figure of PCR band that NptIIF/R is template amplification as the corresponding transgenic line of the different target carrier of primer shows in scion the expression without NptII gene

Embodiment

Embodiment 1., for cucumber mosaic virus (CMV) gene, by comparison tomato est database, builds the reticent expression vector of 6 ihpRNA plants;

Cucumber mosaic virus (Cucumber mosaic virus, CMV) is Bromoviridae (Bromoviridae) Cucumovirus (Cucumovirs) member.CMV is strand justice RNA virus.Gene element is RNA1, RNA2 and RNA3, and Genome Size is respectively 3389nt, 3035nt and 2197nt, is coated in respectively among three virions, and wherein RNA3 is containing subgenomic RNA 4, total length 1000nt.RNA1 code nucleic acid replicase; RNA polymerase (the RNA-dependent RNA polymerase that two albumen: RNA of RNA2 coding rely on, RdRP) and 2b albumen, RdRP is relevant with infecting of virus, 2b protide, like a kind of viral movement protein, has and experimental results show that 2b albumen can weaken the silence of the viral gene of RNA mediation; RNA3 a kind of motion albumen 3A albumen of encoding, its concrete function is not quite clear but relevant with the transmission between virocyte; The RNA4 virus capsid protein of encoding: CP albumen.The genomic specific features of CMV is as Fig. 1.

The present invention is directed to 5 genes of cucumber mosaic virus (CMV), by comparison tomato est database, choose the fragment in CMV5 gene ORF interval as (as shown in Seq ID No.1,2,3,4,5), by PCR and overlapping PCR, build 5 containing CMV specific gene fragment and 1 reticent expression vector of ihpRNA plant that has merged 5 genetic fragments, concrete steps are as follows:

5 primers that fragment is used respectively that increase, underscore is the restriction enzyme site for introducing partly:

1AF：5'-ATT GTCGACTGGATGCGTCCTGTGC-3'

1AR：5'-ATC GGATCCTTGGGCGGACTTCTTG-3'；

2AF：5'-AAT GTCGACTGTCCAACGCCAACC-3'

2AR：5'-AGG GGATCCTTCGTTGTACCTACTC-3'

2BF：5'-ATT GTCGACTGGCTCGTATGGTGGA-3'

2BR：5'-GAG GGATCCGCGAACCAATCTGTAT-3'；

3AF：5'-ATA GTCGACAGCCCTGAAGCCATTA-3'

3AR：5'-AGA GGATCCAAAGACCCTTCAGCAT-3'；

CPF：5'-ATT GTCGACCTTTGTAGGGAGTGA-3'

CPR：5'-ATC GGATCCTTTACGGACTGTCA-3'；

The overlapping PCR primer that fragment is used is merged in amplification:

R1A F：5'-TAT GTCGACTGTGCCCGAGGGTATTG-3'

R1A R：5'-TCAGTAGCACGGTTTAAATTTACAGATCACGCATTCAC-3'

R2A F：5'-GTGAATGCGTGATCTGTAAATTTAAACCGTGCTACTGA-3'

R2A R：5'-TTCTTCGCCTCCACCATACGCTTGATGAAAAGAGTCGTCGT-3'

R2B F：5'-ACGACGACTCTTTTCATCAAGCGTATGGTGGAGGCGAAGAA-3'

R2B R：5'-TCCACTGATGCTGAAGGGTCTGATAGAACGGTAGGAAGCG-3'

R3A F：5'-CGCTTCCTACCGTTCTATCAGACCCTTCAGCATCAGTGGA-3'

R3A R：5'-CGAGTTAATCCTTTGCCGAACACGGTCGTATTGCTTCCTT-3'

RCP F：5'-AAGGAAGCAATACGACCGTGTTCGGCAAAGGATTAACTCG-3'

RCP R：5'-ATC GGATCCATCTATTACCCTAAAGCCAC-3'

Cloning vector detects primer:

M13+：5'-AGGGTTTTCCCAGTCACG-3'

M13-：5'-GTGTGAAATTGTTATCCGCTC-3'

Expression vector detects primer:

Actin1PF：5'-CCTCAGCATTGTTCATCGGTAGTT-3'

IntronR：5'-TGTGTCACTCAAAACCAGATAAAC-3'

Cloning vector: pUCCRNAi, be documented in (Luo, A., Qian, Q., Yin, H.et al. (2006) EUI1, encoding a putative cytochrome P450monooxygenase, regulates internode elongation by modulating gibberellin responses in rice.Plant Cell Physiol.47,181 – 191.) in, also there is preservation in this laboratory, from the applying date, in 20 years, can provide for experimental study to the public.

Plant expression vector: pCAMBIA2300-Actin1-ocs, is documented in (Fang, J., Chai, C., Qian, Q., Li, C., Tang, J., Sun, L., Huang, Z., Guo, X., Sun, C.and Liu, M.2008.Mutations of genes in synthesis of the carotenoid precursors of ABA lead to pre-harvest sprouting and photo-oxidation in rice.The Plant Journal.2,177-189), also there is preservation in this laboratory, from the applying date, in 20 years, can provide for experimental study to the public.

In the present invention, utilize two groups of isocaudarners in pUCCRNAi to cut site XhoI/SalI and BglII/BamHI, the forward and reverse sequence of the fragment by the fragment in the CMV5 that chooses and obtain through pcr amplification gene ORF interval as shown in Seq ID No.1,2,3,4,5 is building up to respectively in two groups of restriction enzyme sites of pUCCRNAi, and forward and reverse sequence of each fragment is building up to respectively RNAi cloning vector pUCCRNAi-1A, 2A, 2B, 3A, the CP that obtains having inverted repeats in two groups of restriction enzyme sites; By overlapping PCR, the Partial Fragment in 5 fragments shown in Seq ID No.1,2,3,4,5 is connected together and obtains the fragment shown in Seq ID No.6, the forward and reverse sequence construct of the fragment shown in Seq ID No.6 is obtained to RNAi cloning vector pUCCRNAi-CMV5 in two groups of restriction enzyme sites of pUCCRNAi, and primer is overlapping PCR primer above.

By the inverted repeat district of cloning vector pUCCRNAi-1A, 2A, 2B, 3A, CP, CMV5, after cutting with restriction endonuclease SalI/PstI enzyme, be connected in plant expression vector pCAMBIA2300-Actin1-ocs, vector construction scheme as shown in Figure 2, plant expression vector pCAMBIA2300-1A, the 2A, 2B, 3A, CP, the CMV5 enzyme that obtain having ihpRNA are cut, enzyme is cut checking as Fig. 3, shown in 4.Sequencing result also shows the structure correct position of selected forward and reverse sequence.

The plant expression vector that structure is obtained is transferred in competent escherichia coli cell, expands and cultivates, and extracts plasmid for Agrobacterium-mediated Transformation.Operate as follows:

Step 1.pUCCRNAi carrier segments enzyme is cut and is reclaimed

Extract pUCCRNAi plasmid in Escherichia coli (a small amount of of plasmid DNA is extracted kit).Get 5ul plasmid, utilize XhoI and BagII restriction endonuclease, adopt 50ul enzyme to cut system, 37 ℃ of enzymes are cut and are spent the night, and reclaim the plasmid fragment that enzyme is cut 3K left and right length in product; Adopt the ultraviolet spectrometry of DNA/RNA to detect the concentration that fragment is reclaimed in agarose gel electrophoresis analysis judgement.Recovery fragment label is XhoI/BagII-pUCCRNAi.

Step 2.CMV gene PCR fragment enzyme is cut and is reclaimed

Utilize primer 1AF/R～CPF/R, with containing on the complete genomic infectious clone carrier of CMV, by following PCR method, obtain respectively 5 CMV genetic fragments, be recorded as respectively 1A, 2A, 2B, 3A and CP; Its accuracy of sequence verification;

The dilution of primer: synthetic primer is directly added to deionized water, and to be mixed with final concentration be 10umol/L.

In PCR pipe, add successively following composition	50ul system	25ul system
			10×PCR Buffer with Mg2+	5ul	2.5ul
Template DNA	2ul	0.4-1ul
			10mM dNTP (mixing)	4ul	2ul
10uM primers F/primer R	2ul	1ul
			Taq enzyme	1ul	0.5ul
ddH2O	Mend to 50ul	Mend to 25ul

(2) after mixing, slightly centrifugal to managing at the end, PCR pipe is put into PCR instrument, cover heat lid.First preheating heat lid before amplification.

(3) following amplification condition

94 ℃ of 3min denaturations, 94 ℃ of 30sec sex change; 50-68 ℃ of 30sec annealing; 72 ℃ of 1min extend (object fragment was greater than 500bp with 1 minute, was less than 500bp with 40 seconds), 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations

Purifying reclaims PCR product and obtains 5 CMV genetic fragments respectively.Respectively get 20ul and reclaim fragment, utilize SalI and BamHI restriction endonuclease, adopt 50ul enzyme to cut system, 37 ℃ of enzymes are cut 6h, reclaim enzyme and cut the plasmid fragment of sequence length shown in corresponding Seq ID No.1～5 in product.Get 1ul and reclaim fragment, carry out gel electrophoresis judgement and reclaim quality.It is SalI/BamHI-1A, SalI/BamHI-2A, SalI/BamHI-2B, SalI/BamHI-3A, SalI/BamHI-CP that CMV reclaims fragment label.

The connection of step 3.pUCCRNAi-1A～CPF and conversion Escherichia coli

Get 4ul XhoI/BagII-pUCCRNAi and 8ul SalI/BamHI-1A, SalI/BamHI-2A, SalI/BamHI-2B, SalI/BamHI-3A, SalI/BamHI-CP carries out in succession respectively:

	Reaction system	Reaction system
			10×T4DNA Ligation Buffer	2ul	5ul
T4DNA Ligase(1U/ul)	2ul	5ul
			Enzyme cuts back to close rear PCR fragment	8ul	20ul
Carrier (50-400ng)	4ul	10ul
			Aseptic deionized water	Supply 20ul	Supply 50ul

Flick, mix, slightly centrifugal.16 ℃ of connection 20h that spend the night react to obtain and connect product.65 ℃ of 10min deactivations.

Get 10ul and connect product, by method (the 8. conversion of e. coli plasmid dna), transform Escherichia coli competence (competence Escherichia coli Trans5a Chemically Competent Cell is purchased from Beijing Quanshijin Biotechnology Co., Ltd)

(1) in the competence Escherichia coli of getting ready in every control, (100ul/ pipe), adds 1-10ug plasmid DNA 3ul, and (connect product and be no more than competent 1/10) flicks and mix.

(2) mixture being placed in to ice-water bath keeps flicking and mixing during 30min.

In (3) 42 ℃ of water-baths, thermal shock transforms 60sec, then proceeds to rapidly and puts 2min on ice, notes not shaking centrifuge tube.

(4) on superclean bench, add 37 ℃ of 500ul LB liquid nutrient mediums that temperature is bathed of aseptic nonreactive, mix.

(5) 37 ℃ of 200rpm vibration preculture 1h, obtain plasmid DNA transformed bacteria liquid.(during prepare be with antibiotic flat board)

(6) the centrifugal 5min of 4000rpm removes supernatant 400ul, and the remaining 50ul painting flat board of getting screens, and while being coated with flat board, take final concentration 50mg/L ampicillin (Amp) as antibiotic-screening positive transformant.

(7) with the choicest of 20ul rifle, get positive single bacterium colony, join in the 1ml LB liquid nutrient medium containing Amp, 250rpm37 ℃ of shaking table cultivated 6h; Get 2ul bacterium liquid, by the PCR method of step 2 and system (utilize cloning vector detect primer M13+/-detect transformant, positive findings is that CMV genetic fragment length adds 360bp, selects PCR test positive transformed bacteria, sequence verification; Obtain, for Escherichia coli positive bacteria liquid, being labeled as respectively pUCCRNAi-1AF, pUCCRNAi-2AF, pUCCRNAi-2BF, pUCCRNAi-3AF, pUCCRNAi-CPF.

Step 4.pUCCRNAi-1A～CPF carrier segments enzyme is cut and is reclaimed

Extract respectively pUCCRNAi-1AF in Escherichia coli, pUCCRNAi-2AF, pUCCRNAi-2BF, pUCCRNAi-3AF, pUCCRNAi-CPF plasmid.

Get respectively 5ul plasmid, utilize SalI and BamHI restriction endonuclease, adopt 50ul enzyme to cut system, 37 ℃ of enzymes are cut and are spent the night, and reclaim the plasmid fragment that enzyme is cut 3K left and right length in product; Get 1ul and reclaim fragment, utilize the ultraviolet spectrometry detection of method DNA/RNA and the concentration that fragment is reclaimed in agarose gel electrophoresis analysis judgement.5 are reclaimed fragment and are labeled as respectively SalI/BamHI-pUCCRNAi1AF, SalI/BamHI-pUCCRNAi2AF, SalI/BamHI-pUCCRNAi2BF, SalI/BamHI-pUCCRNAi3AF, SalI/BamHI-pUCCRNAiCPF.

The connection of step 5.pUCCRNAi-1A～CP and conversion Escherichia coli

By carrier and the genetic fragment method of attachment in step 3, get and in step 4, obtain carrier enzyme and cut back to close 5 kinds of CMV genes that obtain in fragment and step 2, respectively by combining

SalI/BamHI-pUCCRNAi1AF+SalI/BamHI-1A、

SalI/BamHI-pUCCRNAi2AF+SalI/BamHI-2A、

SalI/BamHI-pUCCRNAi2BF+SalI/BamHI-2B、

SalI/BamHI-pUCCRNAi3AF+SalI/BamHI-3A、

SalI/BamHI-pUCCRNAiCPF+SalI/BamHI-CP, connects, and adopts 20ul system after adding other components, and 16 ℃ of connections are spent the night;

Get 10ul and connect product, transform Escherichia coli competence (the same step 3) of method, get 2ul positive bacteria liquid and adopt 50ul system by method, utilize cloning vector to detect primer (M13+/-) and carry out PCR and detect transformant positive (positive findings is that 2 * CMV genetic fragment length adds 360bp); Select the positive transformed bacteria of PCR, sequence verification; Be verified the positive transformed bacteria of result, be labeled as respectively pUCCRNAi-1A, pUCCRNAi-2A, pUCCRNAi-2B, pUCCRNAi-3A, pUCCRNAi-CP.

Step 6.pCAMBIA2300-Actin1-ocs carrier segments enzyme is cut and is reclaimed

Extract pCAMBIA2300-Actin1-ocs plasmid in Escherichia coli.Get 5ul plasmid,, with SalI and PstI restriction endonuclease, adopt 50ul enzyme to cut system, 37 ℃ of enzymes are cut and are spent the night, and reclaim the plasmid fragment that enzyme is cut 10Kb left and right length in product; Get 1ul and reclaim fragment, utilize the ultraviolet spectrometry detection of DNA/RNA and the concentration that fragment is reclaimed in agarose gel electrophoresis analysis judgement.

Recovery fragment label is SalI/PstI-pCAMBIA2300.

Step 7.1A～CP ihpRNA fragment enzyme is cut and is reclaimed

PUCCRNAi-1A, pUCCRNAi-2A, pUCCRNAi-2B, pUCCRNAi-3A, pUCCRNAi-CP plasmid in positive transformed bacteria in extraction step 5.Get 5ul plasmid, with SalI and PstI restriction endonuclease, adopt 50ul enzyme to cut system, 37 ℃ of enzymes are cut and are spent the night, and reclaim enzyme and cut the small fragment of 700bp left and right length in product (ihpRNA fragment adds intron fragment containing forward and reverse CMV gene specific fragment); Get 1ul and reclaim fragment, utilize the ultraviolet spectrometry of DNA/RNA to detect the concentration that fragment is reclaimed in agarose gel electrophoresis analysis judgement.5 are reclaimed fragment and are labeled as respectively SalI/PstI-1A, SalI/PstI-2A, SalI/PstI-2B, SalI/PstI-3A, SalI/PstI-CP.

The connection of step 8.pCAMBIA2300-1A～CP and conversion Escherichia coli

Get SalI/PstI-1A, SalI/PstI-2A, SalI/PstI-2B, SalI/PstI-3A, SalI/PstI-CP that SalI/PstI-pCAMBIA2300 that 4ul step 6 obtains and 8ul step 7 obtain and carry out being respectively connected of carrier and genetic fragment, method is with step 3.

Get respectively 10ul and connect product, transform Escherichia coli competence, operation is with the record of step 3;

Get 2ul transformed bacteria liquid, adopt 50ul system, utilize expression vector to detect primer Actin1PF/IntronR(upstream primer Actin1PF and be matched with expression vector Actin1 promoter region, downstream primer IntronR is matched with in ihpRNA structure in Intron) carrying out PCR, to detect transformant positive, (positive findings is that CMV genetic fragment length adds 323bp left and right);

Select the positive transformed bacteria of PCR, 1:1000 joins 50ml containing in the LB liquid nutrient medium of Amp by volume, and 250rpm37 ℃ of shaking table cultivated 12h; Extract plasmid, gained plasmid is labeled as respectively pCAMBIA2300-1A, pCAMBIA2300-2A, pCAMBIA2300-2B, pCAMBIA2300-3A, pCAMBIA2300-CP.

Step 9. builds pCAMBIA2300-CMV5 carrier

Take respectively pUCCRNAi-1A and pUCCRNAi-2A plasmid is template, utilizes respectively primer R1AF/R1AR and R2AF/R2AR amplified fragments 1AF and 2AF, reclaims fragment 1AF and 2AF that PCR product obtains purifying; Take fragment 1AF and 2AF equal amount of mixture is template, utilizes R1AF/R2AR primer, and pcr amplification goes out fragment 1A+2A, reclaims the fragment 1A+2A that PCR product obtains purifying.

Take respectively pUCCRNAi-2B, pUCCRNAi-3A and pUCCRNAi-CP plasmid is template, utilizes primer R2BF/R2BR, R3AF/R3AR, RCPF/RCPR amplified fragments 2BF, and 3AF and CPF reclaim the fragment 2BF that PCR product obtains purifying, 3AF and CPF; Take fragment 2BF, 3AF and CPF equal amount of mixture is template, utilizes R2BF/RCPR primer, and pcr amplification goes out fragment 2B+3A+CP, reclaims purifying.

Take fragment 1A+2A and 2B+3A+CP equal amount of mixture is template, utilizes R1AF/RCPR primer, and pcr amplification goes out fragment CMV5, reclaims purifying in addition.

Operation by upper 3 steps obtains pUCCRNAi-CMV5, by the operation enzyme of step 4, cut pUCCRNAi-CMV5F and obtain SalI/BamHI-pUCCRNAiCMV5F, by step 5 obtain cloning vector pUCCRNAi-CMV5 and and by the method for step 7, obtain SalI/PstI--CMV5, the SalI/PstI--CMV5 that the SalI/PstI-pCAMBIA2300 in step 6 and step 7 are obtained obtains expression vector pCAMBIA2300-CMV5 according to the operation of step 8.

The functional verification of embodiment 2.RNA interference carrier

Material:

ZT(Trans-Zeatin-Riboside, trans ribosylzeatin), Tim(Timentin, Ticarcillin/Clavulanate Acid), folic acid, As(acetyl butanone), Kan(kanamycin), IAA (3-indolyl acetic acid), IBA (3-indolebutyric acid), MS salt(M0404) all purchased from Sigma company.

Tomato variety: MoneyMaker, this kind is CMV susceptible kind.

Medium preparation: (unit: L)

(1) 1/2MS:pH5.81/2MS salt+15g| sucrose+6.5g| agar

(2) culture medium A: pH5.8MS salt+30g| sucrose

(3) medium B:pH5.8MS salt+30g| sucrose+6.5g| agar+1mg|ZT

(4) medium Base:pH6.0MS salt+20g| sucrose+6.5g| agar+100mg| inositol+0.1mL|10000 * folic acid

(5) culture medium C: pH6.0Medium Base+2mg|ZT+200mg|Tim+100mg|Kan

(6) culture medium C 1:pH6.0Medium Base+1mg|ZT+80mg|Kan+200mg|Tim

(7) culture medium C 3:pH6.0Medium Base+0.5mg|ZT+1.5mg|IAA+80mg|Kan+200mg|Tim

(8) medium D:pH6.0Medium Base+2mg|IBA+200mg|Tim

Method:

6 kinds of plant expression vector pCAMBIA2300-1A, 2A, 2B, 3A, CP, CMV5 with ihpRNA that embodiment 1 obtains and identified, all target fragment Seq ID No.1～6 wherein, solgenomics.net/ compares with tomato est database http://, all fragments and tomato EST all, without complete complementary region more than continuous 20nt, have guaranteed that the siRNA that RNAi carrier forms in genetically modified plants can target tomato plant important gene like this.

Step 1. is prepared transfer-gen plant

In the inventive method, to existing tomato genetic conversion system (Frary, A.and Van Eck, J.2005.Organogenesis From Transformed Tomato Explants.Transgenic plants:methods and protocols.141-150.) improve, shortened transformation time.Its key step is as follows: see (Fig. 5):

(1) sowing 6-7d: seed infiltrates 5～8h with sterile water; 20% clorox sterilizing 10min; Aseptic washing 5 times, each about 5min; 30 ℃ of incubator vernalization two days; Treat that seed shows money or valuables one carries unintentionally, point is sowed in 1/2MS medium, then proceeds to 26～28 ℃ of illumination boxs and cultivates about 5d, and cotyledon just can start to launch.Improvement place: after soaking, vernalization can be shortened and sprouts about 1 week, and sprouts neatly.

(2) cut cotyledon preculture 2d: before true leaf does not occur, just emerged kind of skin and while not launching completely, by cotyledon two tip cut-off 1-2mm of cotyledon, again from middle crosscut one cutter, each cotyledon is cut into two, is collected in the culture dish containing culture medium A each approximately 50～80.Outwell culture medium A, with scalpel, carefully leaf dish (not crushing) dialled on aseptic filter paper, after blotting, be connected to the medium B that is coated with filter paper, cotyledon blade face upward, low light level preculture 2d.Improvement place: by the cotyledon of collecting period of the present invention, after differentiation efficiency will occur higher than true leaf far away.

(3) preparation of engineering bacteria:

A. regulate electric shock instrument, making its electric pulse is 25uF, and voltage is 2.5KV, and resistance is 400 Ω.

B. from-70 ℃ of refrigerators, take out Agrobacterium EHA105 competent cell, be placed in and make its thawing on ice.

C. add 1ul plasmid in 50ul EHA105 competent cell, mix gently.

D. the bottom that above-mentioned mixing suspension is added to electric shock cup, puts electric shock cup into electric shock instrument rapidly.

E. by the parameter of setting in a, start the electric pulse to cell.After electric shock, take out as early as possible sample, add 1ml nonreactive YEB medium.

F. the bacterium liquid obtaining in e is proceeded in 1.5ml centrifuge tube to 28 ℃ of 200rpm vibration preculture 3h.

G. get 50-100ul bacterium liquid and be coated on the YEB medium that is added with antibiotic Kan and rifampin (Rif), cultivate 2-3 days for 28 ℃, until bacterium colony grows.

Attention: all operations is preferably on ice and carries out, electric shock cup electric shock is before in precooling on ice.

H. micro-wave oven fusing LB solid culture medium, is cooled to, behind 50 ℃ of left and right, add corresponding antibiotic (being generally Amp) on superclean bench.

I. after bed board 20ml/ piece, at planar surface, add the IPTG(50mg/ml of 16ul), the X-gal of 40ul (20mg/ml), is evenly coated with and opens with aseptic elbow glass bar, and lucifuge is placed in superclean bench 1h, makes the dimethylformamide that dissolves X-gal volatilize clean as far as possible.

J. on flat board, add transformed bacteria liquid, with aseptic elbow glass bar, be evenly coated with and open, (4 ℃ of preservations of residue bacterium liquid).

K. dull and stereotyped forward is placed 1h, and bacterium liquid is absorbed.Then be inverted in incubator, 37 ℃ of 12-16h have been cultured to clear bacterium colony and have occurred.

L. after growing blue hickie, be positioned over 4 ℃ of refrigerators, make it abundant colour developing (hickie may positive clone, chooses to do to expand and is bacterium colony PCR after cultivating or plasmid PCR/enzyme is cut detection).

(4) engineering bacteria infects and cultivates altogether 2d: engineering bacteria shifts to an earlier date 2d line, then chooses under 26 ℃ of dark conditions of single bacterium and shakes bacterium 16h left and right to OD600=0.6～0.8.5000rpm, centrifugal 5min collects bacterium liquid, by culture medium A, is adjusted to OD600=0.5 left and right, adds the AS that final concentration is 300uM.Infect the leaf dish explant 10min that preculture is crossed, aseptic filter paper blots, and blade back is placed in (not crushing) upward, and to be coated with the medium B of filter paper upper, 26 ℃ of dark 2d that cultivate.

(5) antibacterial screening and culturing 7-10d: proceed in culture medium C, blade back is illumination cultivation upward; Once, within about 2 weeks, just can there is under normal circumstances green callus or bud point in 10d switching.Treat that in callus, bud point occurs.Band bud point explant is proceeded to C1 and cultivate 10～14d, within 2～3 weeks, just can break up and sprout successively.Improvement place: high concentration ZT(2mg/L) be beneficial to division, may cause negative regeneration bud to escape antibiotic but split speed is too fast, reduce in time ZT in C1 medium of the present invention and can prevent situation here by higher Kan concentration (100mg/L) in C.

(6) 10～20d is cultivated in short differentiation: treat that regeneration bud grows about 0.5cm.Cut albefaction explant part resistant buds is proceeded to fresh C3.The leaf dish not sprouting, part meeting albefaction, brownization of cut ends and nothing go out more sign, and this type of leaf dish should be removed in time.Have the leaf dish that grows regeneration bud ability, general otch there will be little callus, and differentiation is sprouted then.Improvement place: easily form for a long time lopsided bud in ZT, the present invention improves culture medium C 3 containing low concentration ZT and increased growth hormone IAA, can effectively promote differentiation and the growth of normal bud.

(7) culture of rootage 15～30d: grow to after 1cm until resistant buds stem, reject callus, cut and insert medium D culture of rootage.Improvement place: antibiotic Kan is remarkable to plant Rooting effect, the present invention added with antibiotic Kan not in root media, can effectively improve rooting rate.

(8) cultivate in field: transplant and slowly open bottle cap in first 3 days, wrap after proceeding to sterilizing compost with transparent plastic bag, progressively open plastic sack after 1 week, transplant to land for growing field crops.Clorox wiping blade to be detected for 2d before PCR detects, blade carries out subsequent detection after cleaning with sterile water again.

The effect comparison of aforesaid operations method of the present invention and existing common method:

(1): after soaking, vernalization can be shortened and sprouts about 1 week, and sprouts neatly.

(2): by the cotyledon of collecting period of the present invention, after differentiation efficiency will occur higher than true leaf far away.

Adopt the cotyledon collected in period of the present invention " before true leaf does not occur, cotyledon just emerged kind of skin and while not launching completely " differentiation efficiency reaches 100%(and occurs Bud Differentiation number/leaf dish number) and each leaf dish can differentiate 2 above sprouts; 2d after true leaf occurs, investigation differentiation efficiency is 50%; 5d after true leaf occurs, investigation differentiation efficiency is below 10%.

(3): in C1 medium of the present invention, reduce in time ZT and by higher Kan concentration, can effectively prevent false positive in C.

Resistant buds false positive rate (the false positive bud number/Bud Differentiation number) average out to 24% that adopts the inventive method to obtain; If utilize 2mgZT false positive rate 40%.Attention: the present invention adopts Kan concentration to be applicable to MoneyMaker kind, and we have tested beautiful spring of tomato variety and mic-Tom, and its suitable concentration is respectively 50mg/L and 75mg/L.

(4): the present invention improves culture medium C 3 containing low concentration ZT and increased growth hormone IAA, can effectively promote differentiation and the growth of normal bud.

The inventive method resistant buds abnormal rate (lopsided bud number/resistant buds number) is 5%, and do not add IAA and differentiation after bud be placed in 1mg/L ZT bud always abnormal rate up to 22%.

(5): Kan is on the impact of taking root.

The present invention has tested variable concentrations to the impact of taking root, and due to transgenic positive bud limited amount, selected bud is the bud that the cotyledon that do not infect differentiates, each 20.100mg/L concentration Kan plant rooting rate (plant number/sprout number of taking root after 2 weeks) 10%(2 strain); 75mg/L concentration Kan plant rooting rate 40%(8 strain); 50mg/L concentration Kan plant rooting rate 60%(12 strain); 0mg/L concentration Kan plant rooting rate 90%(18 strain).After 2 weeks, in 1 month, the plant that do not take root under 100mg/L concentration Kan does not take root always, and yellow leaf or bleach; 3 strains and the long root of 2 strains under 75mg/L and 50mg/L concentration Kan, have been increased respectively; Under 0mg/L concentration Kan, remain 2 strains and also occurred root.

Step 2. fast PCR detects.

The PCR that utilizes GenStar quick-speed plant PCR kit and specification to carry out genetically modified plants detects, and uses primer to be:

Actin1PF：5' CCTCAGCATTGTTCATCGGTAGTT 3'，

IntronR:5'TGTGTCACTCAAAACCAGATAAAC 3', and

NptIIF：5' GATACCGTAAAGCACGAGGAA 3'

NptIIR：5' TGACTGGGCACAACAGACAAT 3'

The PCR that application special primer antagonism plant carries out viral gene detects.

Take NptIIF and NptIIR as primer, carry out the detection of NptII resistant maker gene, amplification object fragment should be 673bp fragment.

The intron IntronR in carrier promoter region design upstream primer Actin1PF and carrier of take is downstream primer, and amplification object fragment detects Insert Fragment, according to determining positive transfer-gen plant as the testing result of Fig. 6.

Step 3. transfer-gen plant Southern hybridization analysis

To the positive plant detecting through PCR, get its tender leaf, by CTAB method, extract total DNA, with EcoR I enzyme, cut, carry out Southern hybridization analysis, further determine the integration of external source object fragment in different transfer-gen plants.Operate as follows:

Probe mark:

Take to the DNA of the positive plant detecting through PCR is template, with dUTP(Roche) mixture carries out increase the to obtain probe of dUTP digoxigenin labeled of secondary PCR.

The a large amount of enzymes of genome are cut:

(1) enzyme is cut system:

The about 100ul of genomic DNA 60ug

10×Buffer H 60ul

Restriction endonuclease (EcoRI) 30ul

Final volume 600ul

(2) 37 ℃ of temperature are bathed and are spent the night; Get 5ul enzyme and cut product electrophoretic analysis, detect enzyme and cut effect;

(3) after enzyme cuts entirely, add the absolute ethyl alcohol (20 ℃) of 0.1 times of volume (60ul) 3mol/L NaAc and 2 times of (1200ul) volumes, after mixing, in-20 ℃, place 2h;

(4) 12000rpm, 4 ℃ of centrifugal 10min, carefully abandon supernatant; Add 1ml75% ethanol to wash one time, in super-clean bench, dry up precipitation, be dissolved in 30ul ddH2O standby.

(5) with the Ago-Gel of 0.5 * TBE preparation 1%, gel thicknesses is about 0.5cm left and right; Adding the about 10ug of detection sample: 30ul() DNA enzyme cuts concentrate and adds 6 * bromjophenol blue solution; 120V voltage (being about 6V/cm) electrophoresis 5min, after treating that bromjophenol blue enters in glue, is down to 100V(by voltage and is about 4V/cm), electrophoresis 2h.

DNA sex change:

(1) bromjophenol blue migrates to apart from glue hole 8-10cm(3/4) left and right stops electrophoresis, from glue groove, takes out blob of viscose, and redundance beyond blob of viscose swimming lane is cut, and accurately measures the length of glue and wide, cuts one jiao of gel as mark;

(2) glue is contained in large culture dish, soaks unrestrained Denaturation solution, and on shaking table, gentleness is shaken 15min * 2 time, makes DNA sex change;

(3) glue is washed a little with ddH2O, put into Nenutralization solution and do not have glue 15min * 2 time (not shaking).The film of transferring film/fixedly:

(1) utilize whatman grinding tool (TurboBlotter ^tMtransfer implement), fold on request, put 4 layers of large blotting paper well, then put 5 layers of 4*7cm blotting paper, top layer is put 2 layers of smooth blotting paper; Smooth blotting paper top is put a nylon membrane (2*SSC steeps 5min in advance) that is slightly greater than below blotting paper well and is carefully driven the bubble between nylon membrane and smooth blotting paper away with glass rod; Take out gel, carefully the outstanding gel of Jiao Kongchu is cut flatly with blade, glue hole is upwards placed on absorbent cloth center.With glass rod, drive bubble between gel and filter paper away; Cut one 3 times to the wide salt bridge paper of glue, cover on glue, and 20 * SSC in grinding tool ditch is linked up, a blotting paper of covering on it in folding two ends;

(2) after transferring film 4h, take out nylon membrane, be put on a filter paper, with pencil, on nylon membrane, indicate position and the sample number in point sample hole;

(3) take out nylon membrane, in conjunction with the one side of DNA upwards, lie against on the filter paper that a 10 * SSC soaks crosslinked twice of UV-crosslinked 1200*100uj/cm2.

Prehybridization, hybridization:

(1) prehybridization: nylon membrane is put into hybrid pipe, add the hybridization solution of appropriate 30ml42 ℃ preheating, 42 ℃ of prehybridization 30min in hybrid heater;

(2) probe sex change: get appropriate probe (adding about 25ng probe in the hybridization solution of 1ml), add ddH2O to 100ul, 95 ℃ of 5min, are placed in rapidly on ice;

(3) probe of sex change is joined to the hybridization solution of 42 ℃ of preheatings, mix gently, prevent that bubble from deepen background;

(4) pour out prehybridization solution, add hybridization solution, jog, 41 ℃ (NptII) hybridized 4h or spent the night.

Wash film and color developing detection:

(1) film of having hybridized is taken out and puts into size to fit, clean plastic casing, under room temperature with low rigorous film washing liquid rinsing 2 times (shaking gently during rinsing), 5min at every turn;

(2) with 68 ℃ of rinsings twice of the rigorous film washing liquid of height of 68 ℃ of preheatings, each 15min;

(3) Washing buffer rinsing 3min gently;

(4) add 50ml1 * blocking solution room temperature to foster 30min;

(5) add 20ml Anti-body solution room temperature reaction 30min;

(6) with Washing buffer, wash film 2 times, each 15min;

(7) add 20ml Detection buffer balance 2-5min;

(8) film is placed in to a clean culture dish, adds the addition of C olor substrate solution, lucifuge colour developing 16h, does not shake; Outwell nitrite ion, add TE buffer rinsing 5min to stop chromogenic reaction.

Main agents and preparation:

(1) 20 * SSC: take 175.3g NaCl and 88.2g sodium citrate, be dissolved in 800ml distilled water, adjust pH to 7.0 with HCl, be settled to 1L with distilled water, autoclaving, room temperature preservation;

(2) 1M Tris-HCl(pH8.0): take 12.114g Tris-base, be dissolved in 80ml distilled water, with HCl, adjust after pH to 8.0, with distilled water, be settled to 100ml, autoclaving, room temperature preservation;

(3) 0.5M EDTA(pH8.0): take 18.61g EDTA, be dissolved in 80ml distilled water, with NaOH, adjust after pH to 8.0, with distilled water, be settled to 100ml, autoclaving, room temperature preservation;

(4) TE Buffer: get 1M Tris-HCl(pH8.0) 5ml, 0.5M EDTA(pH8.0) 1ml, with distilled water, be settled to 500ml, adjust PH to 8.0, autoclaving, room temperature preservation;

(5) 10%SDS: take 10g SDS, be dissolved in 90ml distilled water, be heated to 68 ℃ of dissolvings, adjust pH to 7.2 with hydrochloric acid, be settled to 100ml;

(6) Maleic Acid Buffer: take 11.067g maleic acid and 8.766g NaCl and be dissolved in 800ml distilled water, solid with NaOH() adjust pH to 7.5, with distilled water, be settled to 1L, autoclaving, room temperature preservation;

(7) after Washing Buffer:Maleic Acid Buffer sterilizing, add 0.3% (v/v) polysorbas20;

(8) Detection Buffer: take 1.1688g NaCl and be dissolved in 100ml distilled water, add 20ml1M Tris-HCl(pH8.0), with NaOH, adjust after pH to 9.5, with distilled water, be settled to 200ml, autoclaving, room temperature preservation;

(9) sex change liquid I (Denaturation solution): 16g NaOH, 58.43g NaCl are settled to 1L, autoclaving, room temperature preservation;

(10) sex change liquid II (Nenutralization solution): 58.43g NaCl, 0.5M Tris-HCl(pH7.2) 500ml is settled to 1L, autoclaving, room temperature preservation.

(11) low rigorous film washing liquid: 20 * SSC is diluted with distilled water into 2 * SSC, and by 100:1(2 * SSC:10%SDS) add 10%SDS, be made into 2 * SSC/0.1%SDS;

(12) high rigorous film washing liquid: 20 * SSC is diluted with distilled water into 0.5 * SSC, and by 100:1(2 * SSC:10%SDS) add 10%SDS, be made into 0.5 * SSC/0.1%SDS;

(13) Blocking Solution: 10 * Blocking solution is diluted to 10 times (fresh preparation) with Maleic Acid Buffer;

(14) Antibody Solution: by the centrifugal 5min of Anti-Digoxigenin-AP10000rpm, by Blocking Solution dilution for 1:5000;

(15) Color substrate solution: NBT/BCIP is pressed to Detection Buffer dilution for 1:50 (200ul:10ml), keep in Dark Place;

The present invention obtains the positive transformed plant of 63PCR (wherein 1A9,2A11,2B12,3A8, CP13, CMV510) altogether, and part southern results of hybridization, as Fig. 7, finds that positive plant exists mainly with multicopy form.

The RT-PCR of step 4. transfer-gen plant siRNA precursor detects

To the positive tomato transgenic line of process step 2 Molecular Detection, extract RNA, cDNA is synthesized in reverse transcription, utilize 1AF～CMV5 and IntronR for primer, RT-PCR detects the expression of siRNA precursor, result, as Fig. 8, shows that the precursor of each positive strain has expression, proves that constructed plant expression vector is successfully transformed in tomato and has obtained expression.

Embodiment 3. cottage propagation transfer-gen plants are determined the resistance of each target gene transgenic line.

Because transgenic positive plant T0 is for forwarding to land for growing field crops survives and need to reserve seed for planting from desinfection chamber, be not suitable for direct virus inoculation.Therefore the present invention adopts the mode of cuttage to carry out nutrition to expand numerously, can address this problem.Meanwhile, because being nourishes and generates, cuttage expansion is numerous can provide the more stock material with genetic background for follow-up grafting.

Step 1. plant to be planted is grown to certain altitude, maternal plant is used for obtaining seed, get the lateral bud that axil portion grows, or get the stem section with a knot, lateral bud or stem section are collected in clean triangular flask, add the sterile water 50ml containing 0.2mg/L IBA, after 1～2 week, new root (stem section is slightly slow) can be sent in lateral bud bottom.Plant after taking root is proceeded in the medium after sterilizing, be placed in greenhouse and cultivate.It is all positive that fast PCR detects cuttage seeding.

While launching etc. cuttage seeding 4 leaves, for follow-up virus inoculation, detect.

Determining of the inoculation system of step 2. cuttage seeding CMV virus

By following GB maneuver, cuttage seeding (is contrasted to MoneyMaker; MM) virus inoculation, a lot of cuttage seeding non-evident sympton generation afterwards in 21 days, and after 50～60 days, just there is classical symptom.Think that this is because cuttage seeding is with respect to seedling, spent the virgin phase to come to the ripening period, its resistance to sick ability has had certain raising.For shortening qualification time and obtaining reliable disease resistance result, the present invention changes frictional inoculation (twice) into (1 week, interval) continuous three times, observes and finds that all contrast cuttage seeding all occur symptom about 30 days.Therefore determine, cuttage seeding after separation survives from maternal plant, treats that cuttage plant 4 leaves start to inoculate CMV virus, every multiple connection in a week once, totally 3 times, the 30 " Invest, Then Investigate " CMV virus resistances of growing.

Operating procedure:

(1) preparation 0.03mol/L, pH8.0 phosphate buffer.A:0.03mol/L disodium phosphate soln: take 10.74 grams of Na2HPO4 and be dissolved in 1000mL water, shake up.B:0.03mol/L potassium dihydrogen phosphate: take 4.08 grams of potassium dihydrogen phosphates and be dissolved in 1000mL water and shake up.By B liquid allotment A liquid pH value, be 8.0.

(2) preparation of virus: tomato CMV virus, in the upper breeding of common cigarette " the withered spot three lives ", is adopted down and weighed after virus morbidity, adds phosphate buffer in the ratio of 1:5, smashs to pieces, and double gauze is used after filtering immediately.

(3) inoculation method: inoculate for the first time when tomato grows to 2 true leaves, frictional inoculation (spreads the surface to plant waiting with duster by diamond dust (600 order); Adopt frictional inoculation method, fully clean finger dips inoculation suspension, and on blade face, slight friction causes microtrauma, and 1st～2 true leaves of every strain inoculation, rinse unnecessary viral juice on blade face with clear water after inoculation immediately.Inoculation twice, interval 3d～5d.Be seeded in greenhouse and carry out, the indoor temperature of inoculating the same day is 26 ℃～30 ℃, and later day temperature is controlled at 24 ℃～30 ℃ as far as possible, is not less than 20 ℃ night, conventional illumination, normal cultivation management.

(4) state of an illness investigation and grade scale

Other division of tomato virus disease state of an illness level that table 1 cucumber mosaic virus causes

	symptom is described
		0	without illness.
1	the vein of lobus cardiacus is bright arteries and veins, and 1～2 true leaf presents floral leaf.
		3	middle and upper part blade floral leaf.
5	most blade floral leaves, minority leaf malformation or obviously shrinkage.
		7	the heavy floral leaf of most blades, partial blade deformity, elongated, plant is obviously downgraded.

9	the heavy floral leaf of nearly all blade, most leaf malformations, fern leaf.Plant is seriously downgraded, even withered.

(5) control time: about 21d carries out after inoculation.

(6) state of an illness is recorded: each state of an illness rank of identifying plant is recorded in investigation, and calculates disease index.Disease index calculates by following formula:

$\mathrm{DI}=\frac{\mathrm{\Σ}(s\×n)}{N\×S}\×100$

In formula: DI---disease index;

∑---each state of an illness rank represents the summation that numerical value is counted product with each corresponding state of an illness rank plant;

S---each state of an illness level else represents numerical value;

N---other plant number of each state of an illness level;

N---investigate total plant number;

S---the highest state of an illness level else represents numerical value.

(7) evaluation of resistance: when susceptible control material reaches its corresponding susceptible degree (DI >=50), this batch of evaluation is considered as effectively.The disease index mean value repeating for 3 times according to expert evidence is determined its resistance level, and the criteria for classifying sees the following form.

The evaluation criterion of tomato to Cucumber Mosaic Virus resistance

Disease index (DI)	Evaluation of resistance
		DI＝0	Immunity Immune(I)
0＜DI＜10	High resistance Highly resistant(HR)
		10≤DI＜30	Disease-resistant Resistant(R)
30≤DI＜50	In anti-Moderately resistant(MR)
		50≤DI＜70	Susceptible Susceptible(S)
70≤DI≤100	High sense Highly susceptible(HS)

Step 3. transgenic line cuttage seeding virus resistance is identified

After virus inoculation, T0 is carried out to virus resistance evaluation for transgene tomato as stated above.Be specially, each T0, for transgenosis maternal plant cottage propagation 10 about strains, adds up resistance result after virus inoculation, and result is as following table (Fig. 9):

In table, result can be found out, all transgenic lines all have the CMV virus resistance of higher degree, and wherein major part is high resistance plant, and CMV5 is also not obvious with respect to other strains, possible reason is that investigated transgenosis high resistance strain is a lot, and its advantage does not embody.

Note: most high resistance plant are immunization type (asymptomatic) by classified calculating formula, but we repeat CMV virus to be detected in strain (cuttage strain) in the part of these plant, just content is very low, in view of the RNAi gene silencing phenomenon that is post-transcriptional level, we think that transfer-gen plant is different from proper immune plant, and it can not guarantee that CMV does not infect plant completely.Therefore, we unify to be classified as high resistance type by this type of disease-resistant strain.

Result proves, it is highly effective utilizing RNA that transgenosis produces to disturb antagonism CMV virus.For ease of final-period management, each strain is renumberd by resistance to (T0 represents T0 generation, and 1A represents the target gene that transfer-gen plant is corresponding, and 1～9 represents corresponding strain for T01A1～9 grade; Next number principle is identical therewith).

Embodiment 4. identifies that T1 is for plant virus resistance; The resistant plant (T0 and T1 generation) of take is stock, grafting wild type plant; Inoculation CMV virus, detects the grafting plant that obtains virus resistance.

Step 1. couple T1 is for attacking poison screening

In the present invention, it is the mode with self propagated that tomato is reserved seed for planting, and T1 is for having selfing restructuring and separated phenomenon in tomato.Therefore, be necessary T1 to carry out Molecular Identification and virus inoculation evaluation for seed.We on behalf of examination material, obtain seed with resistant plant T0, and seed propagation obtains T1 for plant, by the method for fast PCR, identify the plant of transgenic positive wherein, for follow-up virus resistance, identify, the method inoculation CMV by embodiment 3 steps 2, identifies its antiviral ability.Result is as following table:

Resistance	MM	T11A.1	T12A.1	T12B.1	T13A.1	T1CP.1	T1CMV5.1
								High resistance (HR)	-	13	11	13	7	8	13
Disease-resistant (R)	-	-	2	2	1	-	1
								In anti-(MR)	-	1	1	-	-	-	2
Susceptible (S)	-	-	1	-	-	-	-
								High sense (HS)	-	-	-	-	-	-	-
Add up to	20	14	15	15	8	8	16

The present invention attacks poison by T1 for the CMV of plant, though find that resistance trait is separated to some extent, most of positive T1 plant have very high CMV resistance equally.

Step 2. transgenosis T0 and T1 be the resistance research to grafting plant CMV as stock for plant

For whether checking CMV resistance can keep in scion, the present invention utilizes the transgenosis T0 of high resistance type and T1 on behalf of stock grafting susceptible kind (MoneyMaker; MM).Grafting method, as Figure 11.

For T0 generation, we have chosen the cuttage seeding of all high resistance plant, and each strain expands numerous 5 strains, is used as stock.Grafting non-transgenic plant, susceptible kind (MM) scion.Treat that bud grows to 3～4 leaves and opens, start to carry out virus inoculation evaluation by the inoculum system, method of cuttage seeding CMV virus.For T1 generation, because progeny plant strain is too many, we have only chosen part strain and have tested.

Grafting operation is as follows:

With reference to (Shaharuddin, N.A., Han, Y., Li, H.and Grierson, D.2006.The mechanism of graft transmission of sense and antisense gene silencing in tomato plants.FEBS Lett.28-29,6579-86.)

(1) cultivate tomato plant, after stock grows to 20～30cm height, truncated terminal bud (about 5cm), with blade from otch top down, the approximately long mouth of 1.5～2cm of riving.

(2) get the bud (approximately 3～5cm) of scion variety, top stays 2 true leaf places, with blade, stem is whittled into wedge shape downwards, two tangent planes of wedge shape require smooth, tangent plane length should be consistent with the degree of depth of stock otch, scion is inserted in stock otch immediately, slightly firmly be seated, with Grafting clip, fix (or wrapping up with preservative film).

(3) plant grafting puts disposable plastic bag or puts into the airtight hut of plastics, to keep plant periphery humidity.After grafting, note observing greenhouse temp. and humidity, temperature remains on 23～25 ℃ of left and right, and humidity keeps 85%～90%.

(4) grafting start progressively to take a breath after 3～4 days (progressively raising plastic sack), after grafting 5～10 days, grafting wound healed completely, and scion lobus cardiacus has " guttation " phenomenon, after 10 days, carry out normal management, as suitably imposed rich water, strengthening the control of insect pest and leaf diseases etc.At grafting plant growing period, lateral bud can be sprouted by the axil place of stock true leaf, should erase in time these lateral buds, prevents that lateral bud from producing harmful effect to scion.

Found that (as following table), T0 has represented different virus resistance for different grafting strains, and major part is high resistance.But with respect to transfer-gen plant (stock), grafting plant (scion) CMV resistance corresponding to part declines to some extent, and this may be relevant with RNA silence signal transmission efficiency, transgenosis Insert Fragment copy number (or siRNA expression), graft union degree and the scion sprout growth conditions of different plants.Grafting result shows, the high resistance CMV virus transfer-gen plant of take is the susceptible scion variety of stock grafting, can effectively improve the virus resistance of scion variety.The T1 stock of high resistance can be given the very high virus resistance of scion (Figure 10) equally.Further prove that by the mode of improvement stock, utilizing graft technology is the effective ways that improve scion variety virus resistance.

Step 3. Molecular Detection stock and scion antibiotics resistance gene.

The present invention improves the method for plant virus resistance, mainly adopts the mode of grafting transgenosis stock to realize.This method, can avoid again another great problem about Transgene-safty aspect cleverly simultaneously, reduces or avoid the possibility of antibiotics resistance gene drift.

The present invention be take scion leaf as examination material, take rotaring gene plant blade as contrast, extracts RNA separately, and cDNA synthesize in reverse transcription, and the expression for the method detection NptII gene of template by RT-PCR of take, and verifies the transgene component of scion in grafting strain.

Result is as Figure 12, in scion without the transcript of NptII.Analyze theoretically, in scion, without genetic transformation process, can not have the antibiotic resistance marker gene of using in plant expression vector.Therefore,, in the sexual gamete that can guarantee to produce at scion variety, also can not there is antibiotic resistance marker gene.

110 Agricultural University Of Hunan

120 1 kinds of method and rna interference vector pCAMBIA2300-CP and transgenic methods that make scion variety obtain virus resistance

130 P11551NYDHN

160 30

170 PatentIn version 3.3

210 1

211 276

212 DNA

213 fragment 1A

400 1

tggatgcgtc ctgtgcccga gggtattgtt tattctgtcg gttataatga acgcggttta 60

ggtccgaagt ctgatggaga gctttacatt gtcaatagtg aatgcgtgat ctgtaacagt 120

gaatctttat ccactgtcac gcgttctctt caagctccaa ccgggaccat tagtcaagtt 180

gacggagttg ctggttgtgg gaaaaccacg gcaattaaat ccatttttga gccgtccact 240

gacatgatcg ttaccgcgaa caagaagtcc gcccaa 276

210 2

211 277

212 DNA

213 fragment 2A1

400 2

tgtccaacgc caaccatcgc gattcctccg gatttaaacc gtgctactga tcgtgttgat 60

atcaatttag ttcaatccat ttgtgactcg actctgccca ctcgtagtat tacgacgact 120

cttttcatca agtgttcgtc gaaagtgcag actattctat agatctggat catgttagac 180

ttcgacagtc tgatcttatt gcaaaaattc cagattcagg gcatatgata ccggttctga 240

acaccgggag cggtcacaag agagtaggta caacgaa 277

210 3

211 259

212 DNA

213 fragment 2B

400 3

tggctcgtat ggtggaggcg aagaagcaga gacgaaggtc tcacaaacag aatcgacggg 60

aacgaggtca caaaagtccc agcgagagag cgcgttcaaa tctcagacta ttccgcttcc 120

taccgttcta tcaagtggat ggttcggaac tgacagggtc atgccgccat gtgaacgtgg 180

cggagttacc cgagtctgag gcctctcgtt tagagttatc ggcggaagac catgattttg 240

acgatacaga ttggttcgc 259

210 4

211 239

212 DNA

213 fragment 3A

400 4

aaagaccctt cagcatcagt ggaaactgtt cgagtaacag cacataacac ttgagggaca 60

ctcatgtatc cttttgagca taattcacca acatcatatc cagacttaaa gaaggaagca 120

atacgaccgt gggttacttc gggaacgagg ggccggactg aaatagcatt atcagcgcgc 180

atccaatgat gccggcctag gtcacactca gtagccattt tcttaatggc ttcagggct 239

210 5

211 211

212 DNA

213 fragment CP

400 5

tttacggact gtcacccaca cggtagaatc aaatttcggc aaaggattaa ctcgaatttg 60

aatgcgcgaa acaagcttct tatcatattc cgtgactgaa tcaggtagta acaacctttt 120

accgtaataa gacccacggt ctatttttgg tggctttagg gtaatagatg tgaacgtgta 180

cccaggtcta cagcgttcac tccctacaaa g 211

210 6

211 600

212 DNA

213 merge fragment CMV

400 6

ctgtgcccga gggtattgtt tattctgtcg gttataatga acgcggttta ggtccgaagt 60

ctgatggaga gctttacatt gtcaatagtg aatgcgtgat ctgtaaattt aaaccgtgct 120

actgatcgtg ttgatatcaa tttagttcaa tccatttgtg actcgactct gcccactcgt 180

agtattacga cgactctttt catcaagcgt atggtggagg cgaagaagca gagacgaagg 240

tctcacaaac agaatcgacg ggaacgaggt cacaaaagtc ccagcgagag agcgcgttca 300

aatctcagac tattccgctt cctaccgttc tatcaagacc cttcagcatc agtggaaact 360

gttcgagtaa cagcacataa cacttgaggg acactcatgt atccttttga gcataattca 420

ccaacatcat atccagactt aaagaaggaa gcaatacgac cgtgttcggc aaaggattaa 480

ctcgaatttg aatgcgcgaa acaagcttct tatcatattc cgtgactgaa tcaggtagta 540

acaacctttt accgtaataa gacccacggt ctatttttgg tggctttagg gtaatagatg 600

Claims (4)

1. make scion variety obtain a method for virus resistance, its step is as follows:

(1) prepare antiviral transgenosis stock;

(2) scion grafting is grown to described transgenosis stock;

It is characterized in that: described antiviral transgenosis stock obtains for proceeding to rna interference vector, the target sequence of described rna interference vector is the genetic fragment in target viral genome, described target viral refers to cucumber mosaic virus CMV, described scion variety and transgenosis stock are all tomato variety, and the target sequence of described rna interference vector is as shown in Seq ID No.5.

2. the rna interference vector that the cucumber mosaic virus gene of take is target, is characterized in that, the target sequence of described rna interference vector is as shown in Seq ID No.5.

3. transform the bacterial strain of rna interference vector described in the requirement 2 of having the right.

4. bacterial strain according to claim 3, its starting strain is transgenosis Agrobacterium tumefaciems bacterial strain EHA105.