CN111154731A

CN111154731A - Tomato yellow leaf curl virus isolate TYLCV-BJ and infectious clone construction method and application

Info

Publication number: CN111154731A
Application number: CN202010014216.9A
Authority: CN
Inventors: 李方方; 龚攀; 李�浩; 周雪平
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2020-01-07
Filing date: 2020-01-07
Publication date: 2020-05-15

Abstract

The invention discloses a tomato yellow leaf curl virus isolate TYLCV-BJ, a construction method of infectious clone and application thereof, wherein the whole genome sequence is shown as SEQ ID NO.2 in a sequence table, and the preservation number is CGMCC NO. 19119. 1.4 tandem repeats of TYLCV-BJ genome sequence to pCambia2300 vector, obtain pCambia2300-TYLCV-BJ-1.4DNA recombinant plasmid; introduced into the agrobacterium EHA105, the obtained agrobacterium can successfully infect tobacco and tomato plants. The recombinant vector pCambia2300-TYLCV-BJ-1.4DNA has the following characteristics: 1) the plant infection is achieved, and tobacco, tomato and Arabidopsis plants can be successfully infected; 2) can cause obvious virus symptoms on tobacco, tomato and arabidopsis plants and accumulate the DNA of the virus; 3) the mutant virus gene can be used for researching the functions of virus genes; 4) as a poison source, the method can be used for screening antiviral tomato varieties and antiviral arabidopsis thaliana mutants.

Description

Tomato yellow leaf curl virus isolate TYLCV-BJ and infectious clone construction method and application

Technical Field

The invention relates to the field of genetic engineering, in particular to a tomato yellow leaf curl virus isolate and an infectious clone construction method and application thereof.

Background

Tomato Yellow Leaf Curl Virus (TYLCV) is a single-stranded, circular plant DNA virus belonging to the geminiviridae family, the genus phaseolus viridae. TYLCV can infect various vegetable crops and economic crops of solanaceae and is an important pathogen in agricultural production in China and the world. The pathogenicity and function of a plant virus is generally studied, requiring that an infectious clone of the virus be obtained first.

The infectious cloning of the virus is to construct the virus with infectivity in vitro by means of molecular biology and genetic engineering technology. The known tomato yellow leaf curl virus TYLCV-SH2 has weak infectivity, and is not beneficial to experimental development.

Disclosure of Invention

The invention aims to provide a tomato yellow leaf curl virus isolate TYLCV-BJ, and a construction method and application of an infectious clone.

The tomato yellow leaf curl virus isolate TYLCV-BJ is separated from a tomato sample suspected of being infected by tomato yellow leaf curl virus collected from a Beijing greenhouse in a laboratory, and the whole genome sequence of the tomato yellow leaf curl virus isolate TYLCV-BJ is shown as SEQ ID NO.2 in a sequence table.

The tomato yellow leaf curl virus isolate TYLCV-BJ is introduced into agrobacterium, the strain is preserved in China general microbiological culture Collection center (CGMCC) in 12 and 9 months in 2019, and the registration number is CGMCC No.19119, and the classification and the name are as follows: agrobacterium sp. The preservation date is as follows: 12 and 9 months in 2019. China general microbiological culture Collection center address: xilu No.1 Hospital No.3, Beijing, Chaoyang, North.

The method for constructing the infectious clone of the tomato yellow leaf curl virus isolate TYLCV-BJ comprises the following steps: 1.4 tandem repeats of TYLCV-BJ genomic sequence was constructed into pCambia2300 vector.

The method specifically comprises the following steps:

(1) the T-TYLCV-BJ-DNA is cut by using restriction enzymes EcoRI and BamHI to obtain a DNA fragment of about 1.2kb, which is about 0.4 copy of the genome; connecting to a pCambia2300 vector after cutting EcoRI and BamHI; the recombinant vector pCambia2300-TYLCV-BJ-0.4 was transformed into E.coli DH5a using primers: screening positive clones by TYLCV-BJ-EcoRI-F and TYLCV-BJ-BamH-R; TYLCV-BJ-EcoRI-F and TYLCV-BJ-BamH-R are shown in SEQ ID: no. 5-6; selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing;

TYLCV-BJ-EcoRI-F：GAATTCCTTGAAGTGCTTTAAATAATG

TYLCV-BJ-BamH-R：AAGTGGATCCCACATAGTGCAAGAC

(2) using restriction enzyme BamHI to cut T-TYLCV-BJ-DNA, and recovering about 2.7kb DNA fragment which is 1 copy of genome; the BamHI-digested DNA fragment of about 2.7kb was ligated into the BamHI-digested pCambia2300-TYLCV-BJ-0.4DNA vector, and the recombinant vector pCambia2300-TYLCV-BJ-1.4DNA was transformed into E.coli DH5a using the following primers: screening positive clones by TYLCV-BJ-FW-F and TYLCV-BJ-FW-R; TYLCV-BJ-FW-F and TYLCV-BJ-FW-R are as shown in SEQ ID: no. 7-8; selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing; after successful verification, the strain is introduced into an agrobacterium EHA105 strain;

TYLCV-BJ-FW-F：ACTGCCTGAATTGAGTGCC

TYLCV-BJ-FW-R：GTACCGGAAGCCCAGAATATAC。

the recombinant vector pCambia2300-TYLCV-BJ-1.4DNA is applied to analyzing the pathogenicity of TYLCV-BJ virus, and is used as a toxicity source for screening antiviral tomato varieties and antiviral Arabidopsis thaliana mutants.

The recombinant vector pCambia2300-TYLCV-BJ-1.4DNA constructed by the above method contains the nucleotide sequence shown in SEQ ID: the sequence shown in No. 1.

The recombinant vector pCambia2300-TYLCV-BJ-1.4DNA constructed by the method of the invention has the following characteristics and advantages:

(1) has higher infectivity than the known tomato yellow leaf curl virus, can successfully infect tobacco, tomato and Arabidopsis plants;

(2) can cause obvious virus symptoms on tobacco, tomato and arabidopsis plants and accumulate the DNA of the virus;

(3) the mutant virus gene can be used for researching the functions of virus genes;

(4) as a poison source, the method can be used for screening antiviral tomato varieties and antiviral arabidopsis thaliana mutants.

The construction of the infectious clone provides a useful tool for researching the function of the TYLCV gene and screening plant varieties resisting TYLCV.

The tomato yellow leaf curl virus isolate TYLCV-BJ and the construction method and application of the infectious clone of the invention are further described in the following description and specific examples with reference to the accompanying drawings.

Drawings

FIG. 1 is a schematic diagram of the construction of a pCambia2300-TYLCV-BJ-1.4DNA invasive cloning (TYLCV-BJ-1.4 DNA for short) vector.

FIG. 2 shows the symptoms of viral infection of plants inoculated with TYLCV-BJ-1.4DNA infectious clones in Nicotiana benthamiana and tomato plants 8, 16 and 24 days later (dpi) and buffer inoculation as a control (Mock);

FIG. 3 shows the virus DNA accumulation after 8 days, 16 days and 24 days of TYLCV-BJ-1.4DNA infectious clone inoculation on Nicotiana benthamiana (A) and tomato (B) plants by real-time quantitative PCR detection, wherein 25sRNA of Nicotiana benthamiana and tomato is used as an internal reference;

FIG. 4(A) TYLCV-BJ-1.4DNA infectious clones after 20 days of inoculation (dpi) into Arabidopsis plants, the plants were infected with symptoms of virus, and buffer was inoculated as a control (Mock); FIG. 4 (B) PCR detection of (A) the presence of virus in systemic leaves of plants.

FIG. 5(A) real-time quantitative PCR detection of the accumulation of viral DNA after 10, 18 and 26 days of tomato inoculation of TYLCV-BJ-1.4DNA and TYLCV-SH2-1.4DNA infectious clones, and tomato 25sRNA was used as an internal control. FIG. 5 (B) Westernblot analysis of the amount of TYLCV virus Capsid Protein (CP) accumulation after 10, 18, and 26 days of tomato inoculation of TYLCV-BJ-1.4DNA and TYLCV-SH2-1.4DNA invasive clones, and the plant Rubisco stained with Coomassie Brilliant Blue (CBB) was used as an internal reference; FIG. 5(C) was performed to examine TYLCV-BJ-1.4DNA and TYLCV-SH2-1.4DNA infectious clones by PCR C1(TYLCV-C1) of TYLCV virus 20 days after inoculation into Arabidopsis thaliana, and it was confirmed that the constructed infectious clone TYLCV-BJ-1.4DNA, but not TYLCV-SH2-1.4DNA, could really and effectively infect Arabidopsis thaliana plants.

Detailed Description

The tomato yellow leaf curl virus isolate TYLCV-BJ and the infectious clone construction method comprise the following steps:

(1) taking a tomato sample suspected of being infected with geminivirus from a greenhouse;

(2) extracting DNA of a tomato sample by using CTAB;

(3) taking DNA of 100ng tomato sample, amplifying a DNA fragment of about 500bp by using a geminivirus degenerate primer PA/PB, connecting the DNA fragment with a gold holo-pEASY-Blunt Simple Cloning T vector (T vector for short), transforming a recombinant vector into escherichia coli DH5a, and screening positive clones by using universal primers M13-F and M13-R (shown as SEQ ID: No. 12-13); selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing; obtaining the sequence SEQ ID: no. 1;

M13-F：TGTAAAACGACGGCCAGT

M13-R：CAGGAAACAGCTATGACC

PA：TAATATTACCKGWKGVCCSC

PB：TGGACYTTRCAWGGBCCTTCACA

*B＝C,T or G，K＝G or T，R＝Aor G，S＝C or G，V＝A，C or G，W＝Aor T，Y＝Cor T

(4) according to SEQ ID: no.1DNA sequence, a pair of primer pairs TYLCV-BJ-BamHI-F/TYLCV-BJ-BamHI-R containing 15nt complementarity in between were designed as shown in SEQ ID: no. 3-4; amplifying DNA of a tomato sample to obtain a DNA fragment of about 3.0kb, connecting the DNA fragment with a T vector, transforming a recombinant vector into escherichia coli DH5a, and screening positive clones by using universal primers M13-F and M13-R; selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing; obtaining the full-length sequence of the virus, i.e. SEQ ID: no.2 shows

TYLCV-BJ-BamHI-F：atgtgggatccacttctaaatgaatttcct

TYLCV-BJ-BamHI-R：aagtggatcccacatagtgcaagac

(5) The T-TYLCV-BJ-DNA was digested with the restriction enzymes EcoRI and BamHI to obtain a DNA fragment of about 1.2kb (approximately 0.4 copy of the genome); connecting to a pCambia2300 vector after cutting EcoRI and BamHI; the recombinant vector pCambia2300-TYLCV-BJ-0.4 was transformed into E.coli DH5a using the following primers: screening positive clones by TYLCV-BJ-EcoRI-F and TYLCV-BJ-BamH-R; TYLCV-BJ-EcoRI-F and TYLCV-BJ-BamH-R are shown as SEQ ID: no. 5-6; selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing;

TYLCV-BJ-EcoRI-F：gaattccttgaagtgctttaaataatg

TYLCV-BJ-BamH-R：aagtggatcccacatagtgcaagac

(6) as shown in FIG. 1, T-TYLCV-BJ-DNA was digested with the restriction enzyme BamHI, and a DNA fragment of about 2.7kb (1 copy of the genome) was recovered; the BamHI-digested DNA fragment of about 2.7kb was ligated into the BamHI-digested pCambia2300-TYLCV-BJ-0.4DNA vector, and the recombinant vector pCambia2300-TYLCV-BJ-1.4DNA was transformed into E.coli DH5a using the following primers: screening positive clones by TYLCV-BJ-FW-F and TYLCV-BJ-FW-R; TYLCV-BJ-FW-F and TYLCV-BJ-FW-R are as shown in SEQ ID: no. 7-8; selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing; after successful verification, the strain is introduced into an agrobacterium EHA105 strain;

TYLCV-BJ-FW-F：actgcctgaattgagtgcc

TYLCV-BJ-FW-R：gtaccggaagcccagaatatac

(7) activating agrobacterium, inoculating agrobacterium liquid containing pCambia2300-TYLCV-BJ-1.4DNA plasmid to wild type Nicotiana benthamiana and tomato plants, observing plant symptoms as shown in figure 2, and determining that the constructed infectious clonal virus has infectivity;

as shown in fig. 3, total DNA on the nicotiana benthamiana plant and the new leaf of the tomato plant was extracted, and real-time quantitative PCR analysis was performed to determine that the constructed infectious clonal virus could be truly and effectively replicated and infected in the tomato and tobacco plants;

as shown in FIGS. 4 and 5, total DNA on new leaves of Arabidopsis plants was extracted and PCR analysis was performed to confirm that the constructed infectious clonal viruses could really and effectively infect Arabidopsis plants.

It is evident from FIG. 5(A) that the accumulation of viral DNA was much higher for TYLCV-BJ than for TYLCV-SH2 virus 10 days after inoculation; FIG. 5(C), detecting TYLCV-BJ-1.4DNA and TYLCV-SH2-1.4DNA infectious clone by PCR C1(TYLCV-C1) of TYLCV virus 20 days after inoculation into Arabidopsis thaliana, confirmed that the constructed infectious clone TYLCV-BJ-1.4DNA, but not TYLCV-SH2-1.4DNA, could really and effectively infect Arabidopsis thaliana plants. The primers used were TYLCV-C1-F and TYLCV-C1-R (SEQ ID: Nos. 10-11), and the sequence of TYLCV-BJ-C1 was amplified as SEQ ID: no. 9.

TYLCV-C1-F:atgcctcgtttatttaaac

TYLCV-C1-R:ttacgccttattggtttcttc

In conclusion, the constructed pCambia2300-TYLCV-BJ-1.4DNA infectious clone is beneficial to further researching the functions of virus proteins and the pathogenicity of viruses and is used as a toxic source for screening antiviral tobacco and tomato varieties.

The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solution of the present invention by those skilled in the art should fall within the protection scope defined by the claims of the present invention without departing from the spirit of the present invention.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> tomato yellow leaf curl virus isolate TYLCV-BJ, and construction method and application of infectious clone

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>541

<212>DNA

<213> PA/PB amplification Sequence (Artificial Sequence)

<400>1

taatattacc ggaggcccgc gccttttctt tttatgtggt ccccacgagg gttccacaga 60

cgtcactgtc aaccaatcaa attgcatcct caaacgttag ataagtgttc atttgtcttt 120

atatacttgg tccccaagta gtttgtcttg cactatgtgg gatccacttc taaatgaatt 180

tcctgaatct gttcacggat ttcgttgtat gttagctatt aaatatttgc agtccgttga 240

ggaaacttac gagcccaata cattgggcca cgatttaatt agggatctta tatctgttgt 300

aagggcccgt gactatgtcg aagcgaccag gcgatataat catttccacg cccgtctcga 360

aggttcgccg aaggctgaac ttcgacagcc catacagcag ccgtgctgct gtccccattg 420

tccaaggcac aaacaagcga cgatcatgga cgtacaggcc catgtaccgg aagcccagaa 480

tatacagaat gtatcgaagc cctgatgttc ctcgtggatg tgaaggccca tgcaaagtcc 540

a 541

<210>2

<211>2781

<212>DNA

<213> TYLCV-BJ full length Sequence (Artificial Sequence)

<400>2

accggatggc cgcgcctttt ctttttatgt ggtccccacg agggttccac agacgtcact 60

gtcaaccaat caaattgcat cctcaaacgt tagataagtg ttcatttgtc tttatatact 120

tggtccccaa gtagtttgtc ttgcactatg tgggatccac ttctaaatga atttcctgaa 180

tctgttcacg gatttcgttg tatgttagct attaaatatt tgcagtccgt tgaggaaact 240

tacgagccca atacattggg ccacgattta attagggatc ttatatctgt tgtaagggcc 300

cgtgactatg tcgaagcgac caggcgatat aatcatttcc acgcccgtct cgaaggttcg 360

ccgaaggctg aacttcgaca gcccatacag cagccgtgct gctgtcccca ttgtccaagg 420

cacaaacaag cgacgatcat ggacgtacag gcccatgtac cggaagccca gaatatacag 480

aatgtatcga agccctgatg ttcctcgtgg atgtgaaggc ccatgtaaag tccagtctta 540

tgagcaacgg gatgatatta agcatactgg tattgttcgt tgtgttagtg atgttactcg 600

tggatctgga attactcaca gagtgggtaa gaggttctgt gttaaatcga tatatttttt 660

aggtaaagtc tggatggatg aaaatattaa gaagcagaat cacactaatc aggtcatgtt 720

cttcttggtt cgtgatagaa ggccttatgg aaacagccca atggattttg gacaggtttt 780

taatatgttc gataatgagc ccagtaccgc aaccgtgaag aatgatttgc gggataggtt 840

tcaagtgatg aggaaatttc atgctacagt tattggtggg ccctctggaa tgaaggaaca 900

ggcattagtt aagagatttt ttagaattaa cagtcatgta acttataatc atcaggaggc 960

agccaagtat gagaaccata ctgaaaacgc cttgttattg tatatggcat gtacccatgc 1020

ctctaatcca gtgtatgcaa ctatgaaaat acgcatctat ttctatgatt caatatcaaa 1080

ttaataaaat ttatatttta tatcatgagt ttctgttaca tttattgtgt tttcaagtac 1140

atcatacaat acatgatcaa ctgctctgat tacattgtta attgaaatta caccaagact 1200

atctaaatac ttaagaactt gatatctaaa tactcttaag aaacgaccag tctgaggctg 1260

taatgtcgtc caaattcgga agttgagaaa acatttgtga atccccaata tcttcctgat 1320

gttgtggttg aatcttatct gaatggaaat gatgtcgtgg ttcattagaa atggcctctg 1380

gctgtgttct gttatcttga aatagagggg attgtttatc tcccagataa aaacgccatt 1440

ctctgcttga ggagcagtga tgagttcccc tgtgcgtgaa tccatgattg ttgcagttga 1500

tgtggaggta gtatgagcag ccacagtcta ggtctacacg cttacgcctt attggtttct 1560

tcttggctat cttgtgttgg accttgattg atacttgcga acagtggctc gtagagggtg 1620

atgaaggttg cattcttgag agcccaattt ttcaaggata tgtttttttc ttcgtctaga 1680

tattccctat atgaggaggt aggtcctgga ttgcatagga agatagtggg aattccccct 1740

ttaatttgaa tgggcttccc gtactttgtg ttgctttgcc agtccctctg ggcccccatg 1800

aattccttga agtgctttaa ataatgcggg tctacgtcat caatgacgtt gtaccacgca 1860

tcattactgt acacctttgg gcttaagtct agatgtccac ataaataatt atgtgggcct 1920

agagacctgg cccacattgt cttgcctgtt ctgctatcac cctcaatgac aatacttatg 1980

ggtctccatg gccgcgcagc ggaagatacg acgttctcgg cgacccactc ttcaagttca 2040

tctggaactt gattaaaaga agaagaaaga aatggagaaa cataaacttc taaaggagga 2100

ctaaaaatcc tatctaaatt tgaacttaaa ttatgaaatt gtaaaatata gtcctttggg 2160

gccttctctt ttaatatatt gagggcctcg gatttactgc ctgaattgag tgcctcggca 2220

tatgcgtcgt tggcagattg ctgacctcct ctagctgatc tgccatcgat ttggaaaact 2280

ccaaaatcaa tgaagtctcc gtctttctcc acgtaggtct tgacatctgt tgagctctta 2340

gctgcctgaa tgttcggatg gaaatgtgct gacctgtttg gggataccag gtcgaagaac 2400

cgttggttct tacattggta cttgccttcg aattggataa gcacatggag atgtggttcc 2460

ccattctcgt ggagttctct gcaaactttg atgtattttt tatttgttgg ggtttctagg 2520

ttttttaatt gggaaagtgc ttcctcttta gagagagaac aattgggata tgttaggaaa 2580

taatttttgg catatagttt aaataaacga ggcatgttga aatgaattgg tgtccctcaa 2640

agctctatgg caatcggtgt atcggtgtct tacttatacc tggacaccaa atggctattt 2700

ggtaattttg taaaagtaca ttgcaataca aaattcaaaa ttcaaaaatc aaatcattaa 2760

agcggccatc cgtataatat t 2781

<210>3

<211>30

<212>DNA

<213>TYLCV-BJ-BamHI-F(Artificial Sequence)

<400>3

atgtgggatc cacttctaaa tgaatttcct 30

<210>4

<211>25

<212>DNA

<213>TYLCV-BJ-BamHI-R(Artificial Sequence)

<400>4

aagtggatcc cacatagtgc aagac 25

<210>5

<211>27

<212>DNA

<213>TYLCV-BJ-EcoRI-F(Artificial Sequence)

<400>5

gaattccttg aagtgcttta aataatg 27

<210>6

<211>25

<212>DNA

<213>TYLCV-BJ-BamH-R(Artificial Sequence)

<400>6

aagtggatcc cacatagtgc aagac 25

<210>7

<211>19

<212>DNA

<213>TYLCV-BJ-FW-F(Artificial Sequence)

<400>7

actgcctgaa ttgagtgcc 19

<210>8

<211>22

<212>DNA

<213>TYLCV-BJ-FW-R(Artificial Sequence)

<400>8

gtaccggaag cccagaatat ac 22

<210>9

<211>1074

<212>DNA

<213>TYLCV-BJ-C1(Artificial Sequence)

<400>9

atgcctcgtt tatttaaact atatgccaaa aattatttcc taacatatcc caattgttct 60

ctctctaaag aggaagcact ttcccaatta aaaaacctag aaaccccaac aaataaaaaa 120

tacatcaaag tttgcagaga actccacgag aatggggaac cacatctcca tgtgcttatc 180

caattcgaag gcaagtacca atgtaagaac caacggttct tcgacctggt atccccaaac 240

aggtcagcac atttccatcc gaacattcag gcagctaaga gctcaacaga tgtcaagacc 300

tacgtggaga aagacggaga cttcattgat tttggagttt tccaaatcga tggcagatca 360

gctagaggag gtcagcaatc tgccaacgac gcatatgccg aggcactcaa ttcaggcagt 420

aaatccgagg ccctcaatat attaaaagag aaggccccaa aggactatat tttacaattt 480

cataatttaa gttcaaattt agataggatt tttagtcctc ctttagaagt ttatgtttct 540

ccatttcttt cttcttcttt taatcaagtt ccagatgaac ttgaagagtg ggtcgccgag 600

aacgtcgtat cttccgctgc gcggccatgg agacccataa gtattgtcat tgagggtgat 660

agcagaacag gcaagacaat gtgggccagg tctctaggcc cacataatta tttatgtgga 720

catctagact taagcccaaa ggtgtacagt aatgatgcgt ggtacaacgt cattgatgac 780

gtagacccgc attatttaaa gcacttcaag gaattcatgg gggcccagag ggactggcaa 840

agcaacacaa agtacgggaa gcccattcaa attaaagggg gaattcccac tatcttccta 900

tgcaatccag gacctacctc ctcatatagg gaatatctag acgaagaaaa aaacatatcc 960

ttgaaaaatt gggctctcaa gaatgcaacc ttcatcaccc tctacgagcc actgttcgca 1020

agtatcaatc aaggtccaac acaagatagc caagaagaaa ccaataaggc gtaa 1074

<210>10

<211>19

<212>DNA

<213>TYLCV-C1-F(Artificial Sequence)

<400>10

atgcctcgtt tatttaaac 19

<210>11

<211>21

<212>DNA

<213>TYLCV-C1-R(Artificial Sequence)

<400>11

ttacgcctta ttggtttctt c 21

<210>12

<211>18

<212>DNA

<213>M13-F(Artificial Sequence)

<400>12

tgtaaaacga cggccagt 18

<210>13

<211>18

<212>DNA

<213>M13-R(Artificial Sequence)

<400>13

caggaaacag ctatgacc 18

Claims

1. A tomato yellow leaf curl virus isolate TYLCV-BJ, characterized in that: the whole genome sequence is shown as SEQ ID NO.2 in the sequence table.

2. A strain comprising the tomato yellow leaf curl virus isolate TYLCV-BJ of claim 1.

3. The strain of claim 2, which has a preservation number of CGMCC NO.19119 and a preservation date of: 12 and 9 months in 2019.

4. Method for the construction of an infectious clone of the tomato yellow leaf curl virus isolate TYLCV-BJ according to claim 1, characterized in that: 1.4 tandem repeats of TYLCV-BJ genomic sequence was constructed into pCambia2300 vector.

5. The method for constructing the TYLCV-BJ infectious clone of tomato yellow leaf curl virus isolate as claimed in claim 4, comprising the following steps:

(1) the T-TYLCV-BJ-DNA is cut by using restriction enzymes EcoRI and BamHI to obtain a DNA fragment of about 1.2kb, which is about 0.4 copy of the genome; connecting to a pCambia2300 vector after cutting EcoRI and BamHI; the recombinant vector pCambia2300-TYLCV-BJ-0.4 was transformed into E.coli DH5a using primers:

screening positive clones by TYLCV-BJ-EcoRI-F and TYLCV-BJ-BamH-R; TYLCV-BJ-EcoRI-F and TYLCV-BJ-BamH-R are shown in SEQ ID: no. 5-6; selecting positive clones, and culturing; extracting and culturing plasmids of target clones; verification by DNA sequencing;

TYLCV-BJ-EcoRI-F：GAATTCCTTGAAGTGCTTTAAATAATG

TYLCV-BJ-BamH-R：AAGTGGATCCCACATAGTGCAAGAC

TYLCV-BJ-FW-F：ACTGCCTGAATTGAGTGCC

TYLCV-BJ-FW-R：GTACCGGAAGCCCAGAATATAC。

6. the pCambia2300-TYLCV-BJ-1.4DNA recombinant plasmid obtained by the construction method of claim 5.

7. The recombinant vector pCambia2300-TYLCV-BJ-1.4DNA of claim 6 for use in analyzing the pathogenicity of TYLCV-BJ virus, screening tomato varieties for virus resistance as a source of toxicity, and screening Arabidopsis mutants for virus resistance.