KR101962902B1 - Infectious clone of Chilli leaf curl virus and uses thereof - Google Patents

Abstract

The present invention relates to an infectious clone containing a gene of chill leaf curd virus and a plant infection system using the same. The present invention can easily cause diseases by using recombinant plasmids containing the chill leaf curd virus and transformants, as well as peppers, which are known to be infected with chill leaf curd virus, and various crops such as bean curd or soybean curd. Therefore, the present invention can be applied to various studies such as the host range of chill leaf curd virus and the correlation with the host, thereby preventing the economic loss due to the virus infection in advance.

Description

Infectious clones capable of inoculating chili leaf curd virus and their uses

The present invention relates to an infectious clone containing a gene of chill leaf curd virus and a plant infection system using the same.

For biotechnology research, a lot of techniques are needed, among which transgenic technology is one of the most important technologies that are basically indispensable. Transformation is the introduction of a trait (gene) that does not literally have it, or the removal of the original trait. This allows us to analyze the function of the trait.

In particular, plant transformation technology is an important technology that can be very useful for analyzing the function or expression of a plant gene. It can identify various phenomena involved in the development and differentiation of plants, or develop new functional varieties through introduction of useful genes Has been used as a technology to In general, transformation of plants has been developed based on tissue culture technology. However, when tissue culture is used, there is a disadvantage that time and effort are required because regeneration period is long and somatic cell mutation or natural teratogenesis Such as the appearance of a serious problem has been raised. Thus, a plant transformation technique that does not involve tissue culture has been developed, which involves transforming cells located at the growth point of a plant in the state of growing plants without tissue culture, and then transforming the transformed cells Is a technology that can acquire genetically stable transgenic plants. One technique derived from this technique is the Agro-infiltration method using the Agrobacterium strain.

Agrobacterium tumefaciens has long been known as a soil bacterium that causes Crown gall disease in many dicotyledonous plants. In the 1970s, the Ti plasmid of Agrobacterium was associated with pathogenicity, and T-DNA, a part of the Ti plasmid, was found to integrate into the plant genome. Later, it was found that T-DNA contains hormone synthesis genes (cytokinins and auxins) necessary for the formation of colon carcinomas and these genes are derived from bacteria but expressed in plants. A group of genes located within the toxic region (Vir region) of the Ti plasmid are required for the ablation of T-DNA and their transfer to the plant, and also the right border sequence located at the opposite ends of the T-DNA, It has also been found that border sequences called border sequences are required for their abstinence.

Chilli leaf curl virus is a virus that causes pathogenesis of infected plants such as yellowing or leaf curl. However, a technique for introducing an infectious clone of chili leaf curd virus into a binary vector as an agro-infiltration into a plant to reproduce the infectious activity in plants has not yet been studied sufficiently.

Accordingly, a problem to be solved by the present invention is to provide a recombinant plasmid and a transformed Agrobacterium which can reproduce the infectious activity of Chilli leaf curl virus in a plant.

In addition, a problem to be solved by the present invention is to provide a method for inducing pathology by infecting plants with chili leaf curd virus using the recombinant plasmids and Agrobacterium.

In order to accomplish the above object, the present invention provides a recombinant plasmid comprising the gene of Chilli leaf curl virus of SEQ ID NO: 1. The recombinant plasmid may be an expression vector, that is, a recombinant expression vector, for transforming the gene of chill leaf curd virus into a plant.

The inventors of the present invention prepared a recombinant plasmid containing the gene of chill leaf curd virus shown in SEQ ID NO: 1 while studying a method of infecting various plants with chili leaf curd virus. The inventors of the present invention prepared Escherichia coli and Agrobacterium transformed with the above recombinant plasmids and found that when these transformed Agrobacterium strains were infected with plants, the symptoms of chill leaf curd virus in the plants were markedly prominent Thereby completing the present invention.

The recombinant plasmid of the present invention can contain the gene of chill leaf curd virus. Preferably, the gene of the chill leaf curd virus may be composed of a dimer, which can be prepared by connecting the separated monomers with a recombinant plasmid using different restriction enzymes.

Also, in the present invention, the nucleotide sequence shown in SEQ ID NO: 1 may include the nucleotide sequence shown in SEQ ID NO: 1. The gene equivalent may include a homologous gene having homology with the gene having the nucleotide sequence shown in SEQ ID NO: 1. The "homologous gene" is a gene having a sequence homology of preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, most preferably 99% or more with the nucleotide sequence of SEQ ID NO: 1 May refer to a gene that exhibits substantially the same function as the gene of the chill leaf blade virus of the present invention. Sequence homology can be analyzed by methods known in the art.

The transformant according to the present invention is not only a gene having the nucleotide sequence of SEQ ID NO: 1 but also a modified sequence in which some bases of SEQ ID NO: 1 are substituted, deleted or added, A nucleotide sequence encoding a protein exhibiting an activity equivalent to that of the protein encoded by the nucleotide sequence encoding the protein can be used.

The present invention also provides Escherichia coli transformed with the recombinant plasmid and a Escherichia coli mixture comprising the Escherichia coli .

The present invention also provides Agrobacterium tumefaciens transformed with the above recombinant plasmids and Agrobacterium tumefaciens mixture comprising Agrobacterium tumefaciens .

In the present invention, the above-mentioned Agrobacterium tumefaciens can be deposited with the deposit number KACC 95135P, which was deposited on October 12, 2016 at the KACC (Agricultural Microorganism Resource Center).

In addition, the present invention provides a plant transformed with a recombinant plasmid containing the gene of SEQ ID NO: 1 and exhibiting infection activity of chill leaf curd virus. The plant cell into which the recombinant plasmid of the present invention is introduced is not particularly limited to a specific form so long as the cell can be regenerated as a plant. These cells may include, for example, cultured cell suspension, protoplasts, leaf sections or callus, and the like. The subject plants according to the present invention may include red pepper, peel, or soybean plants, and may further include tobacco, rice, corn, sugarcane, barley, or wheat. More specifically, the chili leaf viral infected plant according to the present invention can be obtained by transforming a plant with a recombinant plasmid containing the gene of chill leaf viral virus of SEQ ID NO: 1 and then transforming the plant by induction of callus, rooting and soil purification ≪ / RTI >

In addition, the present invention provides a method for inducing pathology by infecting a plant with a chill leaf curd virus using the recombinant plasmid of SEQ ID NO: 1. The introduction of the recombinant plasmid into a plant can be carried out by a method known in the art. For example, but not limited to, Agrobacterium mediated methods, particle gun bombardment, silicon carbide whiskers, sonication, heat shock, An electroporation method or a precipitation method using PEG (polyethylenglycol) may be used.

Preferably, in the present invention, a method of using Agrobacterium tumefaciens to induce pathology of chill leaf curd virus in a plant may be used. Such an Agro-infiltration method may refer to a method for introducing a gene into a plant to express it or for producing a desired protein in a plant. Agro-infiltration can be a method of transferring a desired gene to a plant cell by injecting a suspension of Agrobacterium having the gene to be transferred into a plant leaf by applying a pressure using a needle-free syringe. This has the advantage of being quick and convenient compared to traditional plant transformation.

As used herein, the term "transformation" may mean that a foreign DNA or RNA is absorbed into a cell and the genotype of the cell is changed. Host cells include, but are not limited to, plant cells, prokaryotic cells, yeast cells or insect cells.

In the present invention, 'expression vector' may mean a plasmid, virus or other mediator known in the art to which the gene according to the present invention can be inserted or introduced. A gene according to the present invention may be operably linked to an expression control sequence and the operably linked gene sequence and expression control sequence may be contained in an expression vector containing a selection marker and a replication origin.

The present invention can easily cause diseases by using recombinant plasmids containing the chill leaf curd virus and transformants, as well as peppers, which are known to be infected with chill leaf curd virus, and various crops such as bean curd or soybean curd.

Therefore, the present invention can be applied to various studies such as the host range of chill leaf curd virus and the correlation with the host, thereby preventing the economic loss due to the virus infection in advance.

Figure 1 shows the preparation of a recombinant plasmid which can be used as an infectious clone of chill leaf curd virus.
FIG. 2 shows the results of infectious clones of chili leaf curd virus infected to the experimental host, tobacco, to confirm the pathogenesis.
FIG. 3 is a result of confirming the infection by assaying DNA extracted from tobacco infected with chili leaf curd virus using a polymerase chain reaction.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

Example 1: Generation of ChiLCuV gene

With the help of Nongwoo seed India PVT. LTD, DNA of Capsicum annuum specimen suspected to be infected with Gemini virus was obtained at farmhouse in Bangalore, India. Rolling circle amplification was performed using GE Healthcare's TempliPhiTM 100 amplification kit to isolate the DNA expected to be gemini virus by electrophoresis on the transferred agarose gel. Then, pGEM-3zf (+) vector was ligated with T4 DNA ligase, transformed into Escherichia coli strain DH5α, and cultured at 37 ° C. The plasmid was extracted from DH5α using AccuPrepⓡ Nano-Plus plasmid small extraction kit of BIONEER Inc., and sequenced analysis was requested from Macrogen Inc. to obtain the nucleotide sequence (SEQ ID NO: 1). Using the Basic Local Alignment Search Tool (BLAST), a biological nucleic acid information retrieval tool provided by the National Center for Biotechnology Information (NCBI), the nucleotide sequence is referred to as Chilli leaf curl virus (ChiLCuV) .

Example 2: Construction of a primer set for infectious clones and blacks of chili leaf curd virus

Primers necessary for the infectious clone production of ChiLCuV, and primers necessary for testing the infection of the plants were prepared. A total of four primers (F1, R1, F2, R2) are required for the production of Gemini virus infectious clones. In addition, two primers for the polymerase chain reaction (PCR) used as the gemini virus assay method are required. Based on the nucleotide sequence of ChiLCuV identified by sequencing, four primers (Table 1) with HindIII (AAGCTT), BamHI (GGATCC) and SpeI (ACTAGT) added to the restriction enzyme (Table 1) Two primers (Table 2) were prepared and ordered.

Example 3: Construction of ChiLCuV infectious clone

PCR was performed with a primer set based on the ChiLCuV-pGEM-3zf (+) vector and ChiLCuV base sequence to amplify ChiLCuV monomers having restriction enzymes Hin dIII, Bam HI, Spe I and Bam HI at their ends. Each of the ChiLCuV monomers was cloned into pGEM T-easy vector and the plasmid was extracted after increasing the amount in DH5α. Two ChiLCuV monomers were isolated by treating the restriction enzymes Hin dIII, Bam HI and Spe I.

In the same manner, the pCAMBIA1303 vector having the restriction enzymes Hin dIII and Spe I was prepared, and the three genes were ligated to T4 DNA ligase. The thus generated ChiLCuV-pCAMBIA1303 plasmid was again amplified from E. coli strain DH5α and extracted, and it was confirmed by the restriction enzyme treatment that the plasmid was normally produced.

The last confirmed plasmid was transformed into Agrobacterium tumafaciens GV3101 strain to complete an infectious clone. The process for producing a recombinant plasmid using an infectious clone of chili leaf curd virus is shown in Fig.

Example 4: Confirmation of infectivity of ChiLCuV infectious clone

To confirm the infectivity of the prepared ChiLCuV infectious clones, Nicotiana benthamiana , a plant susceptible to plant viruses, was cultivated for 2 weeks after germination. The tip of the prepared cigarette was punctured and punctured, and ChiLCuV was infected by injecting a Agrobacterium culture containing a ChiLCuV infectious clone. Then, the tobacco plants were cultivated for 3 weeks to confirm the infectivity. Three weeks later, the infected plants were visually observed, and the genomic DNA was extracted from the young leaves of the plant and PCR was performed to confirm whether the virus was properly infected in the plant body. The experimental results are shown in FIG. 2 and FIG.

As shown in Fig. 2, unlike the healthy plants, infected plants were found to have a disease that the leaves were dried and the growth was reduced. Further, in the PCR result shown in Fig. 3, DNA of chill leaf curd virus was detected in infected plants. This confirmed that the diseased plant was clearly infected with chill leaf curd virus.

From the above experimental results, it can be confirmed that the chili leaf viral infectious clone prepared in the present invention can effectively cause disease in plants.

Agricultural Biotechnology Research Institute KACC95135P 20161012

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Infectious clone of Chilli leaf curl virus and uses thereof <130> P16-283 / 2016-0489-10-A <160> 1 <170> KoPatentin 3.0 <210> 1 <211> 2757 <212> DNA <213> Unknown <220> <223> Chilli leaf curl virus <400> 1 accggatggc cgcgattttt tttaccgtgg accccaccac gcacgtgctg acaaagacat 60 gtgcaccaat taaaatcgtc cctcatagct tagttatttc atggtccccc ctataaactt 120 gggctccaag tactgcactc ttaccaatgt gggatccatt agtaaacgag tttcctgaaa 180 ccgttcacgg ttttaggtgt atgttagcag ttaaatatct gcagctacta gaaaatacat 240 atgctccaga cactctgggg tacgatttaa tcagggattt gatctccgtt attagggcta 300 agaattatgt ccaagcgacc agcagatata atcatttcca cgcccgcctc gaaggtacgc 360 cgccgtctca acttcgacag cccttatgcc agccgtgctg ctgcccccac tgtccgcgtc 420 acaaaggccc gagcatgggt gaacaggccc atgaacagga agcccaggat gtacaggatg 480 tacagaagcc cagatgttcc taggggttgt gaaggcccat gtaaggtcca gtcttttgag 540 tctagacacg atgtagttca tatagggaag gttatgtgta ttagtgatgt tacccgtggt 600 cgtattaggg aagatatgga tggatgagaa tatcaagact aagaatcaca cgaatagtgt gatgtttttc 720 cttgtccgtg atcgtcgtcc tgttgataaa ccacaagatt ttggagaggt tttcaacatg 780 tttgacaacg agcctagcac tgccactgtg aagaatatgc atagagatcg ttatcaggtt 840 ttgaggaaat ggcacgcaac ggttactggt ggacagtacg cgtcgaagga acaggcatta 900 gttaagaagt tcgttagggt taataattat gttgtgtata accagcagga agctggtaaa 960 tatgagaatc atactgagaa tgcattgatg ttgtacatgg cgtgtactca cgcctctaat 1020 cctgtgtatg ctaccttaaa gatacggatc tatttctatg attcagtatc gaattaataa 1080 agattgaatt ttattatatt tgaactttgt acatgaattg tttgtgctaa tacattccat 1140 aatacatggt tgacagctct aagtacattg tttatactaa ttacagcaaa attatttaaa 1200 tacgtataca cttgtgtcct aaataccctt aagaaatgac cagtctgagg ctgtaaggtc 1260 gtccagattc ggaaggttag aaaacatttg tgtatcccca acgctttcct caggttgtga 1320 ttgaaccgta tctgcacggt gatgatgtct tggttcctca ggaatggccg gttgtggtgc 1380 tcggttatct tgaaatacag gggatttgtt atctcccaaa taaacacgcc attctctgcc 1440 tgagctgcag tgatgggttc ccctgtgcgt gaatccatag ccgtggcagc gtaatgcgat 1500 gaaatatgaa cagccgcagt ctaggtcaac tcgacgacgc ctggtccccc tcttggccag 1560 cctgtgctgc actttgattg gaacctgagt agagtgggcc ttcgagggtg atgaaggtcg 1620 cattctttaa agcccaattt ttgagtgcgc tatttttctc ttcatccaag aactctttat 1680 agctggaatt gggtcctgga ttgcagagga agatagcggg aattccacct ttaatttgaa 1740 ctggctttcc gtattttgtg ttggattgcc agtccctttg ggcccccatg aattccttaa 1800 agtgctttag gtagtgggga tcgacgtcat caatgacgtt gtaccaggcg tcattactgt 1860 agacctttgg gctaaggtcg agatgtccac acaaatagtt gtgtggacct agtgacctgg 1920 cccacattgt cttgcccgtt ctactatcgc cctctatcac aatacttatg ggtctcaatg 1980 gccgcgcagc ggcaccgaga acattctcgg cagcccattc atcaagttcc tctggaactt 2040 gatcgaaaga agaagaacaa aaaggagaaa cataaacctc caacggaggc gtaaaaatcc 2100 tatctaaatt agcacttaaa ttatgaaatt gtaatacaaa atctttggga gctttctccc 2160 ttaatatatt gagggccgca gctttggacc ctgaattgat tgcctcggca tatgcgtcgt 2220 tggcagactg ctgacctcct ctagctgatc ttccatcgac ttggaaaact ccaaaatcaa 2280 tgaagtctct gtctttttcc acataggcct tgacatctga cgagctttta gctccctgaa 2340 tgttcggatg gaaatgtgct gacctggttg gggaaacgag gtcgaagaat cggttgtttt 2400 ggcatttgaa tttaccttcg aattgtatga ggacgtggag atgaggttcc ccattttcat 2460 gtaattcgcg acaaaccctg atgaacaatt tattagtggg ggtgcttagg ttttgaagtt 2520 gggaaagtgc ttcttcttta gtgagggaac actgtggata tgttaagaaa taatttttag 2580 catatatttg aaaacgtttt ggaggagcca tgttgacttg gtcaattggt actcaacaaa 2640 cttggctatg caatcggtga atggtactca atatatagtg tgagtaccaa atggcaaatt 2700 tgtaatttgt caactttaat tcaaattccc gagaatcgcg gccatccgta taatatt 2757

Claims (6)

After amplification of the monomer of chili leaf curd virus by polymerase chain reaction using primers F1 (AAGCTTATTAGTAAACGAGTTTCCTGAAACC), R1 (GGATCCCACATTGGTAAGAGT), F2 (GGATCCATTAGTAAACGAGTTTC), and R2 (ACTAGTCACATTGGTAAGAGTGCAGTAC)
A truncated monomer using Hind III and Bam HI restriction enzymes, and a truncated monomer using Bam HI and Spe I restriction enzymes in a recombinant plasmid.
A dimer of Chilli leaf curl virus represented by SEQ ID NO: 1 A recombinant plasmid containing the gene. An Escherichia coli transformed with the recombinant plasmid of claim 1. The recombinant plasmid of claim 1 Agrobacterium transformed with tyumeo Patience (Agrobacterium tumefaciens). 4. The Agrobacterium tumefaciens according to claim 3, wherein the Agrobacterium tumefaciens is deposited at KACC 95135P. A plant transformed with the recombinant plasmid of claim 1 and exhibiting the infection activity of chill leaf curd virus. A method for inducing pathology by infecting a plant with a virus against chili leaf using the Agrobacterium tumefaciens of claim 3.

Images