KR101345890B1 - Agrobacterium tumefaciens species of ＫＡＣＣ９５０８３Ｐ capable of reconstituting infection activity of Cucumber mosaic virus in plant - Google Patents

Abstract

The present invention relates to a mixture of Agrobacterium tumefaciens which can reproduce the infectious activity of Cucumber mosaic virus ( CMV ) in plants, and more particularly, the present invention relates to Cucumber mosaic virus (Cucumber mosaic virus; CMV), each transformed with SEQ ID NO: 1 to SEQ ID NO: 3 which can reproduce an active infection in plants Agrobacterium of Solarium to-mepa sieon switch (Agrobacterium tumefaciens ) to provide an Agrobacterium tumefaciens mixture comprising three species. It also provides the Agrobacterium Tumefaciens under accession number KACC95081P, KACC95082P or KACC95083P.

Description

Agrobacterium tumefaciens species of KAC893P capable of reconstituting infection activity of Cucumber mosaic virus in plant}

The present invention relates to Agrobacterium tumefacience capable of reproducing the infectious activity of Cucumber mosaic virus (CMV) in plants.

Numerous technologies are required for biotechnology research, and among them, transformation technology is one of the important technologies that are essentially indispensable. Transformation literally means introducing a trait (gene) that it does not have or removing a trait that it has. Through this, the function of the trait can be analyzed.

In particular, plant transformation technology is an important technology that can be very usefully used for analyzing the function or expression of plant genes. It identifies various phenomena that are involved in the development and differentiation of plants, or develops new functional varieties through the introduction of useful genes. It has been used as a technology. In general, plant transformation has been developed based on tissue culture technology, but when using tissue culture, there is a disadvantage that requires a lot of time and effort due to a long regeneration period. Serious problems, such as the appearance of, have been raised. Therefore, a plant transformation technology that does not undergo tissue culture has been developed, which transforms the cells located at the growth point site as the plant grows without undergoing tissue culture, and then transforms the stem redifferentiating from the transformed cells. It is a technology that can obtain a genetically stable transgenic plant by obtaining the seed. Derived from this technology is the Agro-infiltration method using the Agrobacterium strain.

Agrobacterium tumefaciens tumefaciens ) has long been known as a soil bacterium that causes Crown gall disease in many dicotyledonous plants. In the 1970s, it was found that Agrobacterium's Ti plasmid was associated with pathogenicity, and that T-DNA, part of the Ti plasmid, was integrated into the plant genome. Later, it was found that T-DNA contains hormone-synthesizing genes (cytokinin and auxin) necessary for the formation of myohead carcinoma, and these genes are derived from bacteria, but expressed in plants. A group of genes located in the virulence region (Vir region) of the Ti plasmid are required for the resection of T-DNA and their migration to plants, and also the right border sequence and the left side located at the opposite ends of the T-DNA. It has also been found that border sequences, termed border sequences, are required for the ablation.

Cucumber mosaic virus ( CMV ) was first reported in 1916 (Doolittle, S, The mosaic diseases of cucurbits, USDA Agri. Bull (1961) 879:69). CMV is a multiparticulate virus with a ball-shaped three-segment genome with a diameter of 28-30 nm. It exhibits mosaic symptoms on leaves in cucumbers (Cucumis sativus), etc., and the fruit becomes smaller and deformed, leading to a significant drop in yield as well as product value. CMV has a very wide host range and is distributed throughout the world.

The CMV genome consists of three positive-sense single-stranded RNAs (RNA1, RNA2 and RNA3) and RNA4 derived from RNA3. RNA1 and RNA2 are pathogenic and encode proteins 1a and 2a, respectively, involved in viral replication. RNA3 encodes 3a protein and coat protein ( CP ). The 3a protein is involved in cell-to-cell migration functions. The coat protein is translated from subgenome RNA (RNA4) transcribed from RNA3. These characteristics also appear in bromovirus, ilarvirus and alfalfa mosaic virus.

International Patent Application No. PCT/JP1999/005386 (International Application Date 1999. 09. 30) relates to a plant transformation vector. Vectors for plant transformation that use bacteria and thus lower the likelihood of transfer of DNAs other than T-DNA into plant chromosomes, in particular, these vectors are right and left border sequences that can be recognized by Agrobacterial vir proteins. Field, a T-DNA sequence that is located between the border sequences and into which a gene to be introduced into a plant can be inserted, and a replication initiation point that enables the replication of the vectors in bacteria, and a plurality of left borders Vectors used for plant transformation, characterized by having sequences, are disclosed.

Therefore, the present inventors put infectious clones of cucumber mosaic virus isolated from red beans in domestic packaging in a binary vector and introduce them into plants using Agrobacterium tumefaciens, agro-infiltration ( Agro-infiltration) method was used to introduce viral genes into plants to confirm that infectious CMV activity was reconstituted, and the present invention was completed.

An object of the present invention is to provide Agrobacterium tumefacience capable of reproducing the infectious activity of Cucumber mosaic virus (CMV) in plants.

In order to achieve the above object, the present invention is Agrobacterium tumefaciens each transformed with SEQ ID NO: 1 to SEQ ID NO: 3 capable of reproducing the infectious activity of Cucumber mosaic virus (CMV) in plants ( Agrobacterium tumefaciens ) It provides a mixture of Agrobacterium tumefaciens containing three species. In addition, Agrobacterium Tumefacience of the accession number KACC95081P, KACC95082P or KACC95083P is provided. Preferably, the plant is a mixture of Agrobacterium tumefaciens, characterized in that Nicotiana benthamiana (Nicotiana benthamiana).

The present invention relates to an Agrobacterium tumefaciens mixture capable of reproducing the infectious activity of Cucumber mosaic virus (CMV) in plants. Plant transformation technology using traditional tissue culture has a disadvantage that requires a lot of time and effort due to a long regeneration period as well as low efficiency of the transformation process, and somatic cell mutation or natural malformation occurs during the regeneration process. There was a serious problem. The use of the Agrobacterium tumefaciens mixture of the present invention has the advantage of being quick and convenient when compared to traditional plant transformation in introducing genes into plants. The development of gene carriers for plant transformation with high utilization can be used as a technology to identify various phenomena involved in the development and differentiation of plants, or to develop new functional varieties through the introduction of useful genes.

1 shows a schematic diagram of the structure of a pSNU1 vector.
Multiple cloning site part: 1-68 bp, cis- cleaving ribozyme sequence (Rz): 69-119 bp, NOS poly-A: 184-436 bp, T-border (right): 474-499 bp, pVS1 sta :1540-2540bp, pVS1 rep:3223-4223bp, pBR322 bom:4543-4803bp, pBR322 ori:4943-5223bp, Kanamycin resistance gene (aadA):5514-6308bp, T-border (left):6733-6758bp , Cauliflower mosaic virus ( CaMV ) 35S duplication promoter: 6877-7628bp
Figure 2 shows a schematic diagram of the structure of an infectious clone of Cucumber mosaic virus ( CMV). A) a schematic diagram of pCkpaR1 from which CMV RNA1 is cloned, B) pCkpaR2 from which CMV RNA2 is cloned, C) pCkpaR3 from which CMV RNA3 is cloned; CP: coat protein.
Figure 3 shows a schematic diagram of the inoculation method of infectious clones through agro-infiltration (agro-infiltration).
Figure 4 is Nicotiana Ventamiana (Nicotiana) infected with CMV benthamiana ) It shows the symptom expression picture of the plant.
5 is a picture of a gel confirming CMV infectivity by using the RT-PCR technique.
Lane 1: size marker (size marker), lane 2: control (mock), lane 3: agro-infiltration (agro-infiltration) via a CMV infectious clone was inoculated experimental group (upper lobe), lane 4: agro- Experimental sphere inoculated with CMV infectious clone through agro-infiltration (inoculated leaves)

Embodiment of the first aspect of the present invention is cucumber mosaic virus; the respective transformants to be reproduced to an active infection in plants SEQ ID NO: 1 to SEQ ID NO: 3 in the (Cucumber mosaic virus CMV) Agrobacterium-to mepa sieon switch (Agrobacterium tumefaciens ) It provides a mixture of Agrobacterium tumefaciens containing three species. Preferably, the plant is a mixture of Agrobacterium tumefaciens, characterized in that Nicotiana benthamiana (Nicotiana benthamiana).

A second aspect of the present invention also provides Agrobacterium tumefaciens with accession numbers KACC95081P, KACC95082P or KACC95083P.

The strains containing the genes pCkpaR1 (SEQ ID NO: 1), pCkpaR2 (SEQ ID NO: 2), and pCkpaR3 (SEQ ID NO: 3) were deposited with the Institute of Agriculture and Biotechnology on May 21, 2008 under the deposit numbers KACC 95081P, KACC 95082P, and KACC 95083P, respectively. .

The term'Agro-infiltration' used in the present invention refers to a method for introducing and expressing a gene into a plant or producing a desired protein in a plant. This is a method of injecting a suspension of Agrobacterium containing the gene to be transferred into the plant leaf by applying pressure using a needleless syringe to transfer the desired gene to the plant cell. This has the advantage of being quick and convenient compared to traditional plant transformation.

The term'vector' used in the present invention refers to a nucleic acid molecule capable of transporting by linking another nucleic acid to it. A preferred vector is a vector capable of self-replicating and expressing the nucleic acid to which it is bound.

The term'transformation' used in the present invention refers to a change in the genotype of a cell by absorption of foreign DNA or RNA into a cell. Host cells include, but are not limited to, plant cells, prokaryotic cells, yeast cells, and insect cells.

Hereinafter, the present invention will be described in more detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

< Example 1> Design and manufacture of a recombinant vector for plant transformation using an infectious clone of cucumber mosaic virus

The pSNU1 vector was used as a vector for carrying the infectious clone of Cucumber mosaic virus ( CMV ) (FIG. 1 ). pSNU1 vector is the left border of T-DNA, double 35S promoter of Cauliflower mosaic virus (CaMV ), multiple cloning site ( MCS ; Eco RI , Xba I , Stu I , Nco) I , Bam HI , Kpn I , Sac I , Mlu I , Xho I , Srf I , Sma I , Spe I), cis -cleaving ribozyme sequence(Rz), NOS terminator(NOS poly-A), right side of T-DNA It contains the right border in order. Therefore, it can be transformed into Agrobacterium to deliver a desired gene to a plant through Agro-infiltration. In addition, the pSNU1 vector contains a kanamycin resistance gene.

In order to produce a CMV infectious clone capable of agro-infiltration based on T-DNA, a CMV isolate isolated from red beans in domestic packaging was used. Total RNA was extracted from red beans infected with the CMV isolate. From this total RNA, using a primer (5'-G GAATTC TGGTCTCCTTTTRGAGRCC-3' (SEQ ID NO: 4) or 5'-AG GGATCC TGGTCTCCTTTTRGAGRCC-3' (SEQ ID NO: 5)) through reverse transcription reaction to CMV RNA1, RNA2, RNA3 For cDNA was synthesized. To amplify the CMV RNA1 from the cDNA synthesis primer (5'-A GGATCC GTTTATTTACAAGAGCGTACGG-3 '( SEQ ID NO: 6) and 5'-GGATCC TGGTCTCCTTTTRGAGRCC AG-3' (SEQ ID NO: 7)) was subjected to PCR reaction using a . In order to amplify the CMV RNA2 primer (5'-GGATCC GTTTATTTACAAGAGCGTACGG AG-3 '(SEQ ID NO: 8) and 5'-G ACTAGT GGTCTCCTTTTRGAGRCC-3' ( SEQ ID NO: 9)) to, in order to amplify a CMV RNA3 primer (5 ' the -AG GGATCC GTAATCTTACCACTGTG-3 '(SEQ ID NO: 10) and 5'-GGATCC TGGTCTCCTTTTRGAGRCC AG-3' (SEQ ID NO: 11)) was used. After denaturing at 94°C for 3 minutes using each primer, repeat 35 cycles of 30 seconds at 94°C, 30 seconds at 55°C, 3 minutes at 72°C, and react at 72°C for 10 minutes. DNA fragments containing the nucleotide sequence of were amplified.

In order to clone into the pSNU1 vector, the CMV RNA1 PCR product was treated with BamH I and cloned into the corresponding position of the vector. For CMV RNA2, Bam HI and Spe I, and for CMV RNA3, Bam HI restriction enzyme was used. The resulting CMV RNA1 cloned vector was named pCkpaR1 (SEQ ID NO: 1), the CMV RNA2 cloned vector was named pCkpaR2 (SEQ ID NO: 2), and the CMV RNA3 cloned vector was named pCkpaR3 (SEQ ID NO: 3) ( Fig. 2 ).

Strains containing the pCkpaR1 (SEQ ID NO: 1), pCkpaR2 (SEQ ID NO: 2), and pCkpaR3 (SEQ ID NO: 3) genes were deposited with the Agricultural Biotechnology Research Institute on May 21, 2008 under the deposit numbers KACC 95081P, KACC 95082P, and KACC 95083P, respectively. Became.

<Example 2> Agrobacterium-bit-fill migration check inoculation and infectivity of the infectious clone with (Agro-infiltration)

Using the plasmid DNA of each clone, Agrobacterium strain GV2260 was transformed through an electroporation method. Agrobacterium transformed with pCkpaR1, pCkpaR2, and pCkpaR3, respectively, in 5 ml of YEP liquid medium (including 50 mg/ml of kanamycin and 50 mg/ml of rifampicin) at 30° C. for 16 hours After shaking culture during the period, 1 ml of the primary culture solution was inoculated into 50 ml of new YEP medium (including 50 mg/ml of kanamycin, 50 mg/ml of rifampicin and 20 μM of acetosyringon) at 30°C. Shake culture was carried out for 6 hours under conditions. The culture solution was centrifuged at 4800G for 10 minutes to precipitate Agrobacterium, and in MMA infiltration buffer (MS salts, 10mM MES, pH5.6, 200uM acetosyringon) at a wavelength of 600nm. It was re-suspended to a concentration of OD 1. Then, the suspension was cultured with shaking for 2 hours at 30°C. After mixing the Agrobacterium cultures transformed with pCkpaR1, pCkpaR2 and pCkpaR3 in the same ratio, Nicotiana ventamiana (Nicotiana benthamiana ) on the hypocotyl surface of the leaf using a 1ml syringe was inflation (infiltration) under pressure. 5-8 days after Agro-infiltration, the infectivity of the CMV DNA clone was confirmed through RT-PCR and observation of the development of symptoms ( FIG. 3 ). As a result, CMV infectious clones were collected from Nicotiana ventamiana through Agro-infiltration. benthamiana ) 7 days after inoculation on the plant, the symptoms indicated by CMV could be observed from the upper leaf ( FIG. 4 ).

In addition, CMV infectious clones were collected from Nicotiana ventamiana through Agro-infiltration. benthamiana ) 7 days after inoculation to plants, after extracting total RNA from the upper leaves, primers specific for CMV RNA3 (5'-TCCCTGTTGAGCCCCCTTACTTT-3' (SEQ ID NO: 12) and 5'-CAACTCAGATCCCGCCACAGA-3' (SEQ ID NO: 13)) PCR product was confirmed through gel electrophoresis by performing RT-PCR using. PCR conditions were denatured at 94°C for 2 minutes, then repeated 35 cycles at 94°C for 20 seconds, 60°C for 30 seconds, and 1 minute at 72°C for 1 cycle, and then reacted at 72°C for 10 minutes.

As a result of the confirmation, it was possible to confirm the PCR product of the expected size for the plant inoculated with the CMV infectious clone, and thus it was confirmed that the plant became a systemic infection by CMV ( FIG. 5 ).

Institute of Agricultural Biotechnology KACC95083 20080414

Attach electronic file of sequence list

Claims (1)

Agrobacterium tumefaciens with accession number KACC95083P.

Images