CN113403335A - Mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof - Google Patents
Mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof Download PDFInfo
- Publication number
- CN113403335A CN113403335A CN202110689243.0A CN202110689243A CN113403335A CN 113403335 A CN113403335 A CN 113403335A CN 202110689243 A CN202110689243 A CN 202110689243A CN 113403335 A CN113403335 A CN 113403335A
- Authority
- CN
- China
- Prior art keywords
- mmdav
- kpni
- vector
- infectious
- pbinplus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a mulberry leaf type dwarf-related virus MMDaV infectious cloning vector, a construction method and application thereof. On the basis of obtaining the complete sequence of the mulberry leaf type dwarf related virus genome, 2.0 forward repeated full-length genes of the mulberry leaf type dwarf related virus are constructed on a plant expression vector pBinPLUS, and are transferred into an agrobacterium strain by an electric shock method to obtain a virus vector which has infection capacity to plants and is mediated by agrobacterium. The infectious clone vector provided by the invention can cause necrosis reaction on the Nicotiana benthamiana, and is simple to operate and good in repeatability; the infectious cloning vector provided by the invention can be effectively used for plant disease resistance reaction analysis.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to the construction of infectious clone of a single-stranded DNA virus, a geminivirus family, a Mulberry leaf dwarf-associated virus (MMDaV).
Background
Mulberry leaf dwarf virus (MMDaV) is a single-component geminivirus which seriously influences the growth of Mulberry and the yield of Mulberry leaves, and when the disease occurs, the Mulberry shows symptoms of dwarfing, yellowing and shrinking of leaves, and the like. The genome of MMDaV is a single-stranded circular DNA molecule of size 2952nt, the viral chain containing 5 ORFs (V1, V2, V3, V4 and V5): v1 may encode capsid protein, V2 encodes protein as RNA silencing inhibitor, and the homology of V3, V4 and V5 with known geminivirus sequence is very low, and the function of the encoded protein is not clear; the complementary strand contains 2 ORFs (C1 and C1: C2), and the encoded proteins are probably involved in viral replication. The viral strand of MMDaV is intergenic with the complementary strand, containing the initiation site of viral replication and transcription. At present, the biological properties and pathogenic mechanism of MMDaV are not clear.
Infectious cloning of plant viruses is a fundamental tool in plant virology research. The virus genome can be modified and reformed in vitro by utilizing molecular operations such as mutation, recombination and the like; by analyzing the phenotypic and characteristic changes of the recombinant virus, the structure of the viral genome can be researched, the functions of viral genes and products can be determined, and the interaction between the virus and a host can be understood. In addition, the infectious clone of the virus can be used for evaluating the resistance of the plant, and provides an important means for screening antiviral plants and controlling the virus.
Disclosure of Invention
The first object of the present invention is to provide an MMDaV infectious cloning vector and a method for preparing the same.
A second object of the present invention is to provide Agrobacterium strains carrying MMDaV infectious clones and uses thereof.
The invention takes MMDaV as a material, utilizes a molecular biology method to construct 2.0 forward repeated MMDaV full-length gene groups on a plant expression vector pBinPLUS with high replication capacity, and transfers the recombinant vector into an agrobacterium strain by an electric shock method to obtain a virus vector which has infection capacity to plants by agrobacterium mediation.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
an infectious cloning vector of MMDaV is prepared by constructing 2.0 forward-repeated MMDaV full-length gene groups on a plant expression vector pBinPLUS with high replication capacity, wherein the MMDaV full sequence is shown as SEQ ID NO: and 6.
The preparation method of the MMDaV infectious cloning vector comprises the following steps:
(1) extraction of total plant DNA: extracting plant genome total DNA from collected mulberry infected with MMDaV by adopting a CTAB method;
(2) cloning and sequencing of the full-length sequence of MMDaV: PCR amplification is carried out by using a PCR amplification system and using mulberry DNA containing MMDaV as a template and MMDaV FL/SalI-F and MMDaV FL/KpnI-R (inserting SalI and KpnI sites) as primers, a PCR product is inserted into a pEasy-T1 vector, and pEasy T1-MMDaV-PL (containing SalI and KpnI specific enzyme cutting sites) is obtained by screening. Amplifying a target fragment (2952bp) by using the MMDaV FL/KpnI-F and the MMDaV FL/KpnI-R (inserting KpnI sites) as primers, inserting the PCR product into a pEasy-T1 vector, and screening to obtain pEasy T1-MMDaV-FL (containing KpnI specific enzyme cutting sites);
the gene sequences of the primers MMDaV FL/SalI-F, MMDaV FL/KpnI-F and MMDaV FL/KpnI-R are respectively SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3;
(3) cloning of pBinPLUS-MMDaV-PL: the correctly sequenced T1-MMDaV-PL plasmid was digested with SalI and KpnI restriction enzymes by a conventional digestion and collection method, and the desired fragment (about 3000 bp) was collected. Meanwhile, after the binary plant expression vector pBinPLUS is subjected to enzyme digestion by using SalI and KpnI restriction enzymes, an MMDaV fragment subjected to enzyme digestion by using the SalI and KpnI restriction enzymes is connected with the pBinPLUS by using T4 DNA ligase to obtain pBinPLUS-MMDaV-PL;
(4) cloning of pBin-MMDaV 2A: the T1-MMDaV-FL plasmid with the correct sequence was digested with KpnI restriction enzyme by a conventional digestion and collection method, and the desired fragment (about 3000 bp) was collected. Meanwhile, the pBinPLUS-MMDaV-PL plasmid was digested with KpnI restriction enzyme, recovered and purified, and then the MMDaV fragment recovered by the same restriction enzyme digestion with KpnI was ligated with the pBinPLUS-MMDaV-PL fragment using T4 DNA ligase, and the plasmid pBin-MMDaV2A containing 2 tandem repeats was obtained by screening.
The infectious cloning vector disclosed by the invention is applied to pathogenicity analysis and virus gene function research of MMDaV.
An agrobacterium strain carrying the MMDaV infectious clone is prepared by transferring the pBin-MMDaV2A plasmid into EHA105 agrobacterium-infected competent cells by an electric shock transformation method to obtain the agrobacterium containing the MMDaV infectious clone.
The agrobacterium strain disclosed by the invention is applied to pathogenicity analysis and virus gene function research of MMDaV.
Compared with the prior art, the invention has the outstanding effects that:
(1) the invention constructs 2 copies of MMDaV genome to plant expression vector pBinPLUS, and transfers the recombinant vector into agrobacterium strain through electric shock transformation, to obtain virus vector with infection ability.
(2) The agrobacterium strain provided by the invention can produce large amount of MMDaV infectious clones.
(3) The infectious clone vector provided by the invention can cause necrosis reaction on the Nicotiana benthamiana, and has the advantages of simple operation and good repeatability.
(4) The infectious cloning vector provided by the invention can be effectively used for plant disease resistance reaction analysis.
The infectious cloning vector of MMDaV, the construction method and application thereof are further described in the following description and specific examples in conjunction with the accompanying drawings.
Drawings
FIG. 1 is a schematic diagram of the construction of an MMDaV infectious cloning vector.
FIG. 2 is a graph of the phenotype of MMDaV infectious clone Agrobacterium infiltrated with Nicotiana benthamiana. A: MMDaV infectious clone Agrobacterium infiltration inoculated 3 days later phenotype (white light); b: MMDaV infectious clone Agrobacterium infiltration inoculated with 3 days after the Nicotiana benthamiana phenotype (ultraviolet light); c: MMDaV infectious clone Agrobacterium was infiltrated with the 3 day old phenotype from Nicotiana benthamiana (photographed under white light after DAB staining).
FIG. 3 is a PCR assay of Nicotiana benthamiana inoculated with MMDaV infectious clones; m: DNAmarker; 1: a PCR negative control; 2-5: MMDaV infectious clone inoculated plants.
Detailed Description
The examples provided herein were performed according to conventional experimental conditions, wherein the primer sequences used are shown in Table 1.
TABLE 1 MMDaV infectious cloning vector construction primers
| Numbering | Primer and method for producing the same | Sequences (5'-3') | SEQ ID No. |
| 1 | MMDaV FL/SalI-F | gggtcgacatttgacccattttgaccatgg | SEQ ID No:1 |
| 2 | MMDaV FL/KpnI-F | ggggtaccatttgacccattttgacc | SEQ ID No:2 |
| 3 | MMDaV FL/KpnI-R | ggggtacccattaccaccagtatg | SEQ ID No:3 |
| 4 | V4 GW-F | caccatgttttcaaggagaaaaaaag | SEQ ID No:4 |
| 5 | C1C2 GW-F | caccatggcttcaagttctaacttcag | SEQ ID No:5 |
Example 1 construction of infectious clone pBin-MMDaV2A of Mulberry leaf-type dwarf-related Virus
(1) Extraction of total plant DNA: extracting plant genome total DNA from collected mulberry infected with MMDaV by CTAB method.
The specific operation method comprises the following steps: taking 0.1g of plant leaves, putting the plant leaves into a 2mL centrifuge tube, adding a steel ball with the diameter of 5mm, putting the centrifuge tube into liquid nitrogen for quick freezing, putting the centrifuge tube into a grinding instrument, grinding the plant leaves for 60s at 40HZ, and grinding the plant leaves into powder. Adding 500 μ L CTAB extractive solution preheated at 65 deg.C (2% beta-mercaptoethanol is added when using) into the ground powder, mixing, heating in 65 deg.C metal bath for 1h, and mixing by reversing for 3-4 times. The same volume of 24:1 chloroform: isoamyl alcohol (ready-to-use) was shaken up and down to mix well and centrifuged at 10000rpm for 5min at 4 ℃. Sucking the supernatant with a pipette gun, placing in a 1.5mL centrifuge tube, adding 1/10 volumes of 3M sodium acetate solution (pH5.2) and equal volume of anhydrous ethanol precooled at-20 deg.C, mixing, and standing at-20 deg.C for 1 h. Centrifuging at 12000rpm for 5min at 4 deg.C, discarding supernatant, washing precipitate with 500mL 70% ethanol for three times, centrifuging at 10000rpm for 3min each time at 4 deg.C. The supernatant was discarded, dried at room temperature for about 10min, added with 30 μ L of 65 ℃ preheated deionized water, and pipetted and mixed well. The total DNA sample was stored at-20 ℃.
(2) Cloning and sequencing of the full-length sequence of MMDaV: PCR amplification is carried out by using mulberry DNA containing MMDaV virus as a template and MMDaV FL/SalI-F and MMDaV FL/KpnI-R (SalI and KpnI sites are inserted) as primers by using a PCR amplification system: mu.L of ddH2O, 5. mu.L of 5 XStart FastPfu buffer, 0.5. mu.L of 5 'end primer (10. mu. mol/L), 2. mu.L of 2.5mM dNTPs, 0.5. mu.L of 3' end primer (10. mu. mol/L), 1. mu.L of TransStart FastPfu DNApolymerase, 1. mu.L of template, with a final total volume of 25. mu.L. The reaction parameters are as follows: carrying out circular reaction after pre-denaturation at 95 ℃ for 2 min: denaturation at 95 ℃ for 20s, annealing at 50 ℃ for 20s, extension at 72 ℃ for 2kb/min, and extension at 72 ℃ for 10min after 35 cycles. And (3) carrying out agarose gel electrophoresis on the amplified PCR product, purifying, inserting the purified PCR product into a pEasy-T1 vector, screening to obtain pEasy T1-MMDaV-PL (containing SalI and KpnI specific enzyme cutting sites), sequencing and splicing to obtain a full-length sequence of 1 copy of MMDaV. And (3) amplifying the MMDaV full-length sequence (2952nt) by using the MMDaV FL/KpnI-F and the MMDaV FL/KpnI-R (inserting KpnI sites) as primers, similarly inserting the PCR product into a pEasy-T1 vector, screening to obtain pEasy T1-MMDaV-FL (containing KpnI specific enzyme cutting sites), sequencing and splicing to obtain another 1 copy of the MMDaV full-length sequence. The gene sequences of the primers MMDaV FL/SalI-F, MMDaV FL/KpnI-F and MMDaV FL/KpnI-R are respectively SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3; the complete sequence of MMDaV is shown in SEQ ID NO: and 6.
(3) Cloning of pBinPLUS-MMDaV-PL: the plasmid pEasy T1-MMDaV-PL which had been correctly sequenced was digested with SalI and KpnI restriction enzymes by the digestion and recovery method, and the desired fragment (about 3000 bp) was recovered. The enzyme cutting system is as follows: 25 μ L plasmid, 8 μ L ddH2O, 1. mu.L SalI, 1. mu.L KpnI, 5. mu.L 10 XBuffer, the final total volume is 40. mu.L, after mixing and short centrifugation, the reaction is carried out for 30-40min at 37 ℃. Meanwhile, the binary plant expression vector pBinPLUS is cut by SalI and KpnI restriction enzymes and purified, and then an MMDaV fragment cut by the SalI and KpnI restriction enzymes is connected with the pBinPLUS by using T4 DNA ligase to obtain pBinPLUS-MMDaV-PL. The connecting system is as follows: 250ng of MMDaV fragment, 1. mu.L of 10 XT 4 ligation buffer, 1. mu. L T4 ligation buffer, 100ng of digested pBinPLUS vector and supplement ddH2And O to the total volume of 10 mu L, mixing the samples uniformly, centrifuging the mixture for a short time, and reacting the mixture for 30min at the temperature of 22 ℃.
(4) Cloning of pBin-MMDaV 2A: the pEasy T1-MMDaV-FL plasmid with the correct sequence was digested with KpnI restriction enzyme, and the target fragment of about 3000bp was recovered. Simultaneously, cutting the pBinPLUS-MMDaV-PL plasmid by KpnI restriction enzyme, recovering and purifying agarose gel, and connecting the MMDaV fragment which is also cut and recovered by the KpnI restriction enzyme with the pBinPLUS-MMDaV-PL fragment by using T4 DNA ligase, wherein the specific operation system refers to (3); clones containing 2 tandem repeats were selected, plasmids containing 2 tandem repeats were extracted, and the invasive clone of MMDaV constructed in this way was named pBin-MMDaV2A (shown in FIG. 1).
Example 2 pBin-MMDaV2A infectious clone inoculation
The plasmid pBinPLUS-MMDaV 2A is transferred into an agrobacterium strain EHA105 by an electric shock transformation method to obtain agrobacterium containing MMDaV infectious clones. Inoculating agrobacterium containing a mulberry leaf type dwarf-related virus recombinant plant expression vector into an LB culture medium containing kanamycin (50mg/L) and rifampicin (50mg/L) resistance, and performing shake culture at the temperature of 28 ℃ and the rpm of 220 until OD600 is 0.8-1.2; centrifuging at 10000rpm for 5min, discarding the supernatant, and adding 10mM MgCl2The cells were resuspended in an infiltration buffer containing 10mM MES and 100mM acetosyringone, OD600 was adjusted to 1.2, and the cells were allowed to stand at room temperature for 3 hours to infiltrate the plants. Selecting 4-6 true leaves of the Nicotiana benthamiana, slightly pricking a plurality of small holes on the back of each leaf by using a needle, slowly penetrating and injecting bacterial liquid into the tissue gaps by using a 1mL injector without the needle, and inoculating the plants to be cultured in an isolation greenhouse at 25 ℃.
EXAMPLE 3 infectious assay of pBin-MMDaV2A infectious clones
The inoculated plants were observed for symptoms at regular intervals and the changes caused by the MMDaV infectious clones on the plants were monitored. When the inoculated B.benthamiana was observed under white light and ultraviolet light, it was found that 3 days after the Agrobacterium pBin-MMDaV2A had infiltrated the B.benthamiana, the inoculated leaves exhibited a marked necrotic phenotype (FIGS. 2A and 2B). The leaves of the cultivars were stained with DAB and the leaves inoculated with the MMDaV infectious clone were found to appear visibly brown.
The specific operation is as follows: the inoculated leaves were cut off and placed in a 50mL centrifuge tube, and gently handled. Prepared DAB-HCl solution (1mg/mL, pH 3.8) was added thereto, and the leaves were washed. Standing under light at room temperature for 8 hr while shaking. Pouring out DAB-HCl solution, adding 96% ethanol, boiling for 5-10min until the green color is removed to obtain H2O2Position ofThe color will change to brown. After natural cooling, 70% alcohol was added for preservation, and the picture was taken for recording (fig. 2C).
The inoculated plants were tested by PCR to identify their infectivity: PCR detection can be carried out by using primers V4 GW-F and C1C2 GW-F, and the amplification size is about 1500 bp; the gene sequences of the primers V4 GW-F and C1C2 GW-F are SEQ ID NO. 4 and SEQ ID NO. 5 respectively, and the results are shown in figure 3, and specific target bands can be detected by the plant leaves inoculated with the MMDaV infectious clone.
The above results demonstrate that: the constructed MMDaV infectious clone has biological activity, and can quickly activate the defense reaction of plants after infecting Nicotiana benthamiana to cause leaf necrosis.
The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solution of the present invention by those skilled in the art should fall within the protection scope defined by the claims of the present invention without departing from the spirit of the present invention.
Sequence listing
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof
<130> DS211-018
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> MMDaV FL/SalI-F(Artificial Sequence)
<400> 1
gggtcgacat ttgacccatt ttgaccatgg 30
<210> 2
<211> 26
<212> DNA
<213> MMDaV FL/KpnI-F(Artificial Sequence)
<400> 2
ggggtaccat ttgacccatt ttgacc 26
<210> 3
<211> 24
<212> DNA
<213> MMDaV FL/KpnI-R(Artificial Sequence)
<400> 3
ggggtaccca ttaccaccag tatg 24
<210> 4
<211> 26
<212> DNA
<213> V4 GW-F(Artificial Sequence)
<400> 4
caccatgttt tcaaggagaa aaaaag 26
<210> 5
<211> 27
<212> DNA
<213> C1C2 GW-F(Artificial Sequence)
<400> 5
caccatggct tcaagttcta acttcag 27
<210> 6
<211> 2952
<212> DNA
<213> Mulberry leaf type dwarf-associated virus (Artificial Sequence)
<400> 6
acagccccct cgcttggtgg cgccacgtgg cgcccgtgga ttggccccga aggggcccac 60
cattaattgc gccgaaggcg caatgtgaac ccgacaaaag gaggcggccg acaaaagaaa 120
aagaaaaaga aaagtaaaaa gaaaaaggga aaagttaaag cagattcgcc gacagttttt 180
aaaagtgggt cccatgaata attattaaag aggttgcttg cgcagcaagg aaccgatgag 240
ctataaatac ccccctgccc caaatatttt taaaatgtct gagtattgcg aacttgccga 300
agacagtaag tactgtacaa cgattttaat tgttcaattt attgttattg ccctagccat 360
tctcagttat gtctttgtgg agtaccaaat taggagagtt gcctcagagc ttgcaaggct 420
gcgtaattat gctagcctgc aagcaattaa tggcaatgga agaccagatt ctggcccaga 480
aaatagacat gagaaccgag accgggttcg agacttcagt ggaccacttg gtccacctta 540
ctcagtgccg tagactgttg agactgataa gacgtttttc tagggtaaag gatcgtgctg 600
cagtaaatgg tgattaccag gagctctgct ctgagatcaa ggcggggatg gaatccagga 660
accattccac ggaggcccag gactgttcga gtcacgcggg ttgcaagtgc catgcgaacc 720
ccgtggagaa gaagaggccc aaggtcgagt ttggcaagaa ggaagagacg gcccataaat 780
gcgttgggcc cagtgaaacg tggcacattt ggaattaaat tagccagtat aaatcatact 840
ggtggtaatg ggtaccattt gacccatttt gaccatgggg atgacacaaa ccaaagaacc 900
ggaagaaaaa taaaaattaa tggaataaac attaggggaa aactgtacct aaataatcct 960
aggactaatt cttatcacat tgtcaggctg tggataatca gggataccag accggggtcg 1020
gaaccggtgt ctttcagctc gttcatggac atgcacgaca acgagccgat gacagcgatg 1080
gtgaagaagg actgggggga acggtttcaa gttctcaagg atctgacctt tcatttagtg 1140
ggagccaatg gtttatcctt caacgaagac gtggtcgagg agtattttaa atttaaggga 1200
tatgttttgt ataatcacga ggattctgga tccttggcaa atgtacttga gaatggcata 1260
tttttgtacg cagcaacttc acatccttct gagaacgtga ctttgactgc taattgtcgt 1320
gtttattttt atgacgcaga ataagtaata aagtttataa ttttttttac agattaagtt 1380
gaatgttttc aaggagaaaa aaagataaaa aggatgccgg aagctctcga cgattggacg 1440
atcatacctc tggatgggag tccccacagt caggaggata tgaatccgga tccgttagat 1500
ctaattatgg tacagatgga agagataatt cacaatctga atttaataga acagagattg 1560
aacgtgcagt tagagctgtt atccctgtta ctgggtcggg agttttgtcc cagccagaac 1620
agtggcaaag acccagtaga tcattacggg aagcacaaca aagagaagaa agacttaaag 1680
aaacgcagag gagattagat gaggaatttg aaaaggttgt tttttcatta ataattttaa 1740
tagaatttat cactagcaga catgtaataa actagtacat tatcatcgaa ccatggttta 1800
agtgtacttg ccatccgtac aacccaatcc atgtcttcat taactaatac aatacaagga 1860
attccgccac taatacgaaa atccttcata tacttgccct taagaataat atctttttga 1920
gcacctaata atgatttaaa ccaagaagta ctaatcttct cgtattcaat atcatctatt 1980
acattatata acgcaaaatc atcataatct aaaaaactta aactaccggt aaaataattg 2040
tgtctcccta aagatctggc ccattgcgtc ttgccggatc tggttggtcc acagatgtag 2100
aggctgatgg gcctgtctgg cttggactcg ggctcctgtt gcacatatat tgttgtggaa 2160
cagttaggcc cacttcccac caaaaatcat catgacatct ataacataaa acagaatcgg 2220
cccattgacg acttacgaat agaatattgt ccttggccca ttgctgaata ggttcaggta 2280
ggcccgggaa gtcagtccac cggggaacgt aaggaatact tcttcggcgg taatggtctc 2340
gagcgaaacc ggtaatcgac ggccatctga gaacgtagtc ctgtggtctt cgttctcgga 2400
caagggcgag gaaggactcc tcgtctgttg ccaaggtaag gatctctcca aagatcttct 2460
cagcgcttgc aacaggactt cgtcctcgtg tattaaattc tccgtgttca atgaagtgac 2520
cctccttctg gatatatttc ctgacggccg ctggtgagga gcacttctgg acattcggat 2580
ggtaggtgcc cgaggagtgt tcctgcggca aatcaaagaa attaggattt cttgtttcta 2640
gttttttgtc caattggaca atagcatgaa aatgactgtt gtcatcttta tgtttttctt 2700
cagcgacaca ggcatacttg actgtgtatg aattaagaat ttggagtaaa tgggacatga 2760
cccaagtaat agattcggga cattgaggga atgtaaggaa aacattctta gcagccaacc 2820
tgaagttaga acttgaagcc atttatagaa gggaaggagt tgaagccgta cgaagaaggg 2880
agagtaaggt tctataggta aggagggagt ggtggcagcg gcaaatgaag cgagggggcc 2940
ttatataata tt 2952
Claims (5)
1. An infectious cloning vector of a mulberry leaf dwarf-related virus MMDaV, which is characterized in that: the MMDaV full-length sequence is obtained by fusing two copies of MMDaV full-length sequences to a pBinPLUS vector, and the MMDaV full-length sequence is shown in SEQ ID No. 6.
2. The method for preparing the infectious cloning vector of the mulberry leaf-type dwarf-related virus MMDaV according to claim 1, comprising the following steps:
(1) extraction of total plant DNA: extracting plant genome total DNA from collected mulberry infected with MMDaV by adopting a CTAB method;
(2) cloning and sequencing of the full-length sequence of MMDaV: utilizing a PCR amplification system, taking mulberry DNA containing MMDaV virus as a template, taking MMDaV FL/SalI-F and MMDaV FL/KpnI-R as primers to carry out PCR amplification, inserting a PCR product into a pEasy-T1 vector, and screening to obtain pEasy T1-MMDaV-PL;
using the MMDaV FL/KpnI-F and the MMDaV FL/KpnI-R as primers to amplify a target fragment, inserting a PCR product into a pEasy-T1 vector, and screening to obtain pEasy T1-MMDaV-FL;
the gene sequences of the primers MMDaV FL/SalI-F, MMDaV FL/KpnI-F and MMDaV FL/KpnI-R are respectively SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3;
(3) cloning of pBinPLUS-MMDaV-PL: carrying out enzyme digestion on the T1-MMDaV-PL plasmid with correct sequencing by using SalI and KpnI restriction enzymes, and recovering a target fragment; meanwhile, the binary plant expression vector pBinPLUS is cut by SalI and KpnI restriction enzymes, recovered and purified, and then an MMDaV fragment cut by the SalI and KpnI restriction enzymes is connected with the pBinPLUS by utilizing T4 DNA ligase to obtain pBinPLUS-MMDaV-PL;
(4) cloning of pBin-MMDaV 2A: cutting the T1-MMDaV-FL plasmid with correct sequencing by using KpnI restriction enzyme, and recovering a target fragment; meanwhile, the pBinPLUS-MMDaV-PL plasmid was digested with KpnI restriction enzyme, recovered and purified, and then the MMDaV fragment recovered by the same restriction enzyme digestion with KpnI was ligated with the pBinPLUS-MMDaV-PL fragment using T4 DNA ligase, and the plasmid pBin-MMDaV2A containing 2 tandem repeats was obtained by screening.
3. Use of the infectious cloning vector of claim 1 in pathogenicity analysis and virus gene function study of MMDaV.
4. An agrobacterium strain carrying MMDaV infectious clones characterized by: the agrobacterium containing the MMDaV infectious clone can be obtained by transferring the infectious clone vector of claim 1 into an EHA105 agrobacterium competent cell by an electric shock transformation method.
5. The use of the Agrobacterium strain of claim 4 in pathogenicity analysis and viral gene function studies of MMDaV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110689243.0A CN113403335A (en) | 2021-06-22 | 2021-06-22 | Mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110689243.0A CN113403335A (en) | 2021-06-22 | 2021-06-22 | Mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113403335A true CN113403335A (en) | 2021-09-17 |
Family
ID=77682144
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110689243.0A Pending CN113403335A (en) | 2021-06-22 | 2021-06-22 | Mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113403335A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114015718A (en) * | 2021-11-24 | 2022-02-08 | 中国农业科学院植物保护研究所 | Soybean aflatoxin virus infectious cloning vector and construction method and application thereof |
-
2021
- 2021-06-22 CN CN202110689243.0A patent/CN113403335A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| 孙少双: "桑花叶型矮缩相关病毒的RepA蛋白在烟草上诱导细胞死亡的机理研究", 《中国优秀硕士论文全文数据库 基础科学辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114015718A (en) * | 2021-11-24 | 2022-02-08 | 中国农业科学院植物保护研究所 | Soybean aflatoxin virus infectious cloning vector and construction method and application thereof |
| CN114015718B (en) * | 2021-11-24 | 2023-07-18 | 中国农业科学院植物保护研究所 | Soybean Huang Qushe virus infectious cloning vector, construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114317460B (en) | Snakegourd mottle mosaic virus and infectious cloning vector, construction method and application thereof | |
| CN107338264B (en) | VIGS vectors for virus-mediated gene silencing | |
| CN110423762B (en) | Construction method of PVMV infectious full-length cDNA clone | |
| CN115927757A (en) | Method for efficiently screening antiviral germplasm resources based on PEMV-1 and PEMV-2 infectious clones | |
| CN113388637B (en) | Mutant plasmid vector containing cucumber mosaic virus Fny isolate RNA2 and application thereof | |
| CN113403335A (en) | Mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof | |
| CN113999872A (en) | Application of tobacco DCP1/ATG8i gene in inhibiting tomato yellow leaf curl virus infection | |
| CN116622648A (en) | Wisteria mosaic virus (WiMV) and infectious cloning vector and application thereof | |
| CN114015718B (en) | Soybean Huang Qushe virus infectious cloning vector, construction method and application thereof | |
| CN109797162A (en) | Corium solani infectious clone and its construction method | |
| CN111440818A (en) | Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof | |
| KR101925468B1 (en) | Infectious clone of Papaya leaf curl virus and uses thereof | |
| CN113215189B (en) | Infectious cloning vector of tomato brown wrinkle fruit virus and construction method and application thereof | |
| CN114561387B (en) | Peanut promoter and application thereof | |
| CN115918546B (en) | Transgenic sweet wormwood and method for improving content of artemisinin in sweet wormwood | |
| CN114369617B (en) | Rape mosaic virus infectious clone vector and construction method and application thereof | |
| KR102285748B1 (en) | Watermelon mosaic virus Infectious clone and their uses | |
| CN114540354B (en) | Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof | |
| KR101962902B1 (en) | Infectious clone of Chilli leaf curl virus and uses thereof | |
| CN116836947A (en) | Calabash light mosaic virus and infectious clone vector, construction method and application thereof | |
| KR101925472B1 (en) | Infectious clone of Ageratum yellow vein Singapore alpha-satellite DNA and uses thereof | |
| CN117925704A (en) | Combined bud inhibition application of STM and ATH1 homologous genes and proteins in tobacco | |
| KR101925465B1 (en) | Infectious clone of Croton yellow vein mosaic alpha-satellite DNA and uses thereof | |
| CN115992168A (en) | Tea tree net spot virus infectious clone and construction method and application of VIGS vector thereof | |
| KR101345890B1 (en) | Agrobacterium tumefaciens species of ＫＡＣＣ９５０８３Ｐ capable of reconstituting infection activity of Cucumber mosaic virus in plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210917 |