CN111440818A - Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof - Google Patents

Abstract

The invention discloses a soybean mosaic virus infectious cloning vector capable of infecting tobacco, an agrobacterium strain and application thereof. The sequence of the soybean mosaic virus infectious cloning vector capable of infecting tobacco is shown in SEQ ID NO. 1. The soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) is applied to infected tobacco. In the invention, a soybean mosaic virus strain (SC7) capable of infecting tobacco is selected to construct an infectious cloning vector, agrobacterium is transformed and the tobacco is injected, so that system infection is successfully formed on the tobacco. The method lays a solid and reliable foundation for the application of tobacco in the research aspect of soybean mosaic virus.

Description

Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and relates to a soybean mosaic virus infectious cloning vector capable of infecting tobacco, an agrobacterium strain and application thereof.

Background

Soybean Mosaic Virus (SMV) belongs to potyvirus, and the genome is a positive-sense RNA strand with the size of about 9.6kb and comprises 5 'and 3' non-coding regions and a middle coding sequence. One polypeptide translated from its coding sequence can form 10 mature viral proteins by self-cleavage. Soybean mosaic virus hosts are narrow, but have wide prevalence range, and occur to different degrees in the main soybean producing areas all over the world. After soybean is infected with soybean mosaic virus, symptoms such as flower and leaf shrinkage, dead top and the like can be generated, so that the growth and development of plants are hindered, and the yield and the quality are reduced.

The pathogenic cause of the soybean mosaic virus is researched, the mechanism of the plant for resisting the soybean mosaic virus is clarified, and the molecular breeding method can be more effectively applied to realize the cultivation of good disease-resistant varieties. In previous studies on soybean mosaic virus and anti-soybean mosaic virus genes, we have been limited to performing on soybean plants themselves. However, due to the difficulty of soybean genetic transformation and the like, the progress of related research is not smooth; moreover, because the infection range of the soybean mosaic virus is limited, the range of searching for the disease-resistant gene does not break through the species limit all the time. The plant virus infectious cloning vector can provide a new idea for the fields of virus and plant interaction and the like. The RNA genome of the virus is difficult to perform in vitro gene manipulation, and after the RNA genome is constructed into DNA-based infectious clone, the operations of virus recombination, mutation, fragment insertion and deletion and the like can be easily performed, and the RNA genome can also carry exogenous genes to be co-expressed along with the infection of the virus.

Tobacco is a commonly used model plant for plant disease resistance studies. As few soybean mosaic virus strains can infect tobacco, the application of the soybean mosaic virus strain to the tobacco is fresh in the research of the soybean mosaic virus.

Disclosure of Invention

The invention aims to provide a soybean mosaic virus infectious cloning vector capable of infecting tobacco, aiming at the defects of the prior art.

Another object of the present invention is to provide Agrobacterium transformed with the vector.

The invention also aims to provide the application of the vector and the agrobacterium.

The purpose of the invention can be realized by the following technical scheme:

a soybean mosaic virus infectious clone vector pCB301-SMV (SC7) capable of infecting tobacco has a complete sequence shown as SEQ ID NO.1, a construction method shown as figure 1 and a vector map shown as figure 2.

The construction method of the soybean mosaic virus infectious clone vector pCB301-SMV (SC7) extracts RNA from soybean leaves infected with the SMV (SC7), carries out reverse transcription to obtain cDNA, obtains fragments of the SMV by utilizing a plurality of pairs of primers for segmented amplification, then introduces sequences of PolyA and HDVrz after 3' UTR of the fragments by utilizing a PCR method, and overlapping sequences exist among the fragments; transferring the fragments and a pCB301 vector linearized by SmaI and StuI into a yeast W303 strain for recombination reaction; the infectious clone vector pCB301-SMV (SC7) is formed by screening the vector with successful recombination and extracting the plasmid.

As a preferable example of the construction method of the present invention, fragments of SMV are obtained by PCR amplification in five sections: the template was the cDNA of the resulting SMV (SC7) by reverse transcription, frag1a was amplified using primers 1c-F-1 and 1a-2R, frag2a was amplified using primers 2a-F and 2a-2R, frag3a was amplified using primers 3a-F and 3a-R, frag4a was amplified using primers 4a-F and 4a-R, frag5-1a was amplified using primers 5a-F and 5 a-R-1; wherein the sequence of 1c-F-1 is shown as SEQ ID NO.2, the sequence of 1a-2R is shown as SEQ ID NO.3, the sequence of 2a-F is shown as SEQ ID NO.5, the sequence of 2a-2R is shown as SEQ ID NO.4, the sequence of 3a-F is shown as SEQ ID NO.6, the sequence of 3a-R is shown as SEQ ID NO.7, the sequence of 4a-F is shown as SEQ ID NO.8, the sequence of 4a-R is shown as SEQ ID NO.9, the sequence of 5a-F is shown as SEQ ID NO.10, and the sequence of 5a-R-1 is shown as SEQ ID NO. 11.

As a preferred embodiment of the construction method of the present invention, fragments containing PolyA and HDVrz were obtained by 2 additional rounds of PCR: first, using the fragment frag5a-1 obtained by the above PCR as a template, and amplifying the fragment with primers 5a-F and 5a-R-2 to obtain frag5 a-2; then taking the fragment frag5a-2 obtained by the PCR as a template, and amplifying by using primers 5a-F and 5a-R-3 to obtain a frag5a-3 fragment, namely a fragment containing PolyA and HDVrz; wherein the sequence of 5a-F is shown as SEQ ID NO.10, the sequence of 5a-R-2 is shown as SEQ ID NO.12, and the sequence of 5a-R-3 is shown as SEQ ID NO. 13.

As a preferable selection of the construction method, the vector pCB301 is subjected to double enzyme digestion by using NEB endonuclease SmaI and StuI to obtain a linearized pCB301 vector, the frag1a, frag2a, frag3a, frag4a, frag5a-3 for standby purification and the linearized pCB301 vector are uniformly mixed according to the mol ratio of 1:1:1:1:1, yeast W303 competent cells are transferred by using a PEG/L iAc mediated method, SD/-Trp plates are coated after recovery and placed in a 30 ℃ incubator for inverted culture for 3 days, a plurality of single colonies are selected in a liquid/-Trp culture medium, yeast plasmids are extracted after shaking overnight, and the SD plasmid is the pCB301-SMV (SC7) infectious clone vector.

Agrobacterium transformed with the soybean mosaic virus infectious cloning vector pCB301-SMV (SC 7).

The application of the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) in infecting tobacco.

The application of the agrobacterium in infecting tobacco.

Has the advantages that:

1. the soybean mosaic virus sequence carried by the infectious cloning vector pCB301-SMV (SC7) is in a DNA form, so that the genetic operations of virus genome recombination, fragment insertion and the like are facilitated.

2. The infectious cloning vector pCB301-SMV (SC7) and a strain ArgSMV (SC7) formed by transforming agrobacterium thereof can be conveniently and stably stored in a low-temperature refrigerator for a long time, and can effectively avoid the defect that the original soybean mosaic virus is stored in a leaf way.

3. The invention breaks through the species boundary in the aspect of soybean mosaic virus disease-resistant research, expands the related research to tobacco, and can realize the pathogenicity analysis of the soybean mosaic virus on the tobacco, thereby promoting the discovery process of cross-species disease-resistant genes.

In the invention, a soybean mosaic virus strain (SC7) capable of infecting tobacco is selected to construct an infectious cloning vector, agrobacterium is transformed and the tobacco is injected, so that system infection is successfully formed on the tobacco. The method lays a solid and reliable foundation for the application of tobacco in the research aspect of soybean mosaic virus.

Drawings

FIG. 1 is a schematic diagram of the construction process of the soybean mosaic virus infectious cloning vector.

FIG. 2 shows the construction of the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) vector.

FIG. 3 is a photograph of a purified soybean mosaic virus fragment and a vector agarose gel electrophoresis; 1: DNA marker 10000; 2: SMV amplified fragment frag1 a; 3: SMV amplified fragment frag2 a; 4: SMV amplified fragment frag3 a; 5: SMV amplified fragment frag4 a; :6: SMV amplified fragment frag5 a-1; 7: SMV amplified fragment frag5 a-2; 8: SMV amplified fragment frag5 a-3; 9: pCB301 vector after linearization with SmaI and StuI.

FIG. 4 is a graph comparing the phenotype of the injected strain ArgSMV of Nicotiana benthamiana (SC7) and the buffer solution after 1 month injection; a: the phenotype of the plant after the Nicotiana benthamiana injection strain ArgSMV (SC7) is shown, the edge of a leaf is curled downwards, the pigment distribution is uneven, and the plant is dwarfed; b: the phenotype, negative control, leaf blade and plant type of the plant are normal after the Nicotiana benthamiana is injected with the infection buffer solution.

FIG. 5 is a comparison of details of the back of the leaf discs after 1 month injection of the strain ArgSMV (SC7) and buffer; the obtained leaves are injection superior leaves A: the leaf back phenotype after the B.benthamiana injection strain ArgSMV (SC 7); b: the back phenotype of the leaf after injecting infection buffer solution into Nicotiana benthamiana.

FIG. 6 detection of SMV accumulation in tobacco leaves by PCR; 1. 2, 3 are divided into upper leaves of tobacco plants which are taken from 3 injected strains ArgSMV (SC 7); 4. 5 and 6 are divided into upper leaves of 3 tobacco plants injected with the buffer solution. The detection time is 1 month after injection.

Detailed Description

The following examples are intended to illustrate the invention without limiting its scope of use.

Example 1: construction of Soybean mosaic Virus infectious cloning vector pCB301-SMV (SC7)

1. RNA extraction and reverse transcription of SMV (SC7) isolates

Extraction of RNA was performed using trizol reagent: putting 1 blade inoculated with SMV (SC7) into a 2ml centrifuge tube, adding liquid nitrogen, and rapidly grinding into powder by using a grinding rod; adding 1ml trizol, shaking and mixing uniformly, standing for 5min at room temperature; adding 200ml chloroform, shaking vigorously for 15sec, and standing at room temperature for 2 min; centrifuging at 12000rcf for 10min at 4 deg.C, sucking 500 μ l supernatant, adding into 500 μ l isopropanol, mixing, and standing for 5 min; centrifuging for 5min at 12000rcf of a 4 ℃ centrifuge, and discarding the supernatant; adding 1ml 75% ethanol, vortex for 1min, centrifuging at 4 deg.C in 12000rcf for 1min, discarding supernatant, standing at room temperature for 5min to fully volatilize ethanol. Adding 50 μ l of water to dissolve the RNA precipitate. Reverse transcription of RNA Using Primescript of TAKARA^TMii1st strand cdna synthesis kit: the reverse transcription process was performed as described in the specification, wherein the reverse transcription primer used was the oligodT provided in the kit.

2. Amplification of SMV (SC7) fragment and enzyme digestion purification of vector

Amplification of the SMV (SC7) fragment: the amplification of the fragment was carried out by 3 rounds of PCR using PrimerSTAR-Max-DNA-Polymerase from TAKARA, all according to the instructions; the primers used are as in table 1; in the first round of PCR amplification, the template is cDNA obtained by reverse transcription as described above, the frag1a is amplified by using primers 1c-F-1 and 1a-2R (such as SEQ ID NO.2 and SEQ ID NO.3), the frag2a is amplified by using primers 2a-F and 2a-2R (such as SEQ ID NO.5 and SEQ ID NO.4), the frag3a is amplified by using primers 3a-F and 3a-R (such as SEQ ID NO.6 and SEQ ID NO.7), the frag4a is amplified by using primers 4a-F and 4a-R (such as SEQ ID NO.8 and SEQ ID NO.9), and the frag5a-1 is amplified by using primers 5a-F and 5a-R-1 (such as SEQ ID NO.10 and SEQ ID NO. 11); in the second round of PCR amplification, the template is frag5a-1 obtained by the above PCR, and primers 5a-F and 5a-R-2 (shown as SEQ ID NO.10 and SEQ ID NO.12) are used for amplifying frag5 a-2; in the third round of PCR amplification, the template is frag5a-2 obtained by the above PCR, and primers 5a-F and 5a-R-3 (shown as SEQ ID NO.10 and SEQ ID NO.13) are used for amplifying frag5 a-3; the vector pCB301 was double-digested with the NEB endonucleases SmaI and StuI at 25 ℃ for 1 hour and 37 ℃ for 1 hour. The vector digestion product and the SMV (SC7) fragment were purified for future use using an AxyPrep DNA gel recovery kit, the purification process was performed according to the instructions, the purified fragment was detected by agarose gel electrophoresis, and the detection results are shown in FIG. 3.

3. Yeast transformation and plasmid extraction of each fragment and linearized vector

Selecting Saccharomyces cerevisiae strain W303 cultured on YPDA plate culture medium, placing the strain into 50ml YPDA liquid culture medium, shaking at 220rpm for overnight at 30 ℃ until OD600 is near 1.0, pouring the strain into a 50ml centrifuge tube, centrifuging, using sterile water to resuspend and centrifuge, removing supernatant, adding 0.1M L iAc to prepare into competent cells, uniformly mixing the frag1a, frag2a, frag3a, frag4a, frag5a-3 and linearized pCB301 vector according to the mol ratio of 1:1:1:1:1, transferring the strain into yeast competent cells by using a PEG/L iAc mediation method, coating SD/-plate after recovery, placing the strain into a 30 ℃ SD culture box for inverted culture for 3 days, selecting a plurality of single colonies into the liquid/-Trp culture medium, shaking for extracting yeast plasmid, using Omega yeast small extraction kit, completely extracting the plasmid, namely extracting the pCB vector (SC-7) according to the specification.

Example 2: preparation of Agrobacterium-forming Strain ArgSMV (SC7) and infection with Nicotiana benthamiana

1. Agrobacterium freeze-thaw method for transforming infectious clone vector pCB301-SMV (SC7)

The infectious cloning vector pCB301-SMV (SC7) is transferred into an agrobacterium strain EHA105 by using a freeze-thaw method, and the specific operation is as follows: taking 1 EHA105 competence, placing on ice for thawing, adding 5. mu.l pCB301-SMV (SC7) plasmid, mixing, freezing in liquid nitrogen for 2min, placing in 37 ℃ water bath for 3min, adding 800. mu.l YEP culture medium for resuscitation for 3 h, taking 100. mu.l, uniformly coating on YEB culture medium containing Kan, Str and Rif antibiotics, and performing inversion culture at 28 ℃ for 3 days. The Agrobacterium strain ArgSMV (SC7) was prepared.

2. Enlarged culture of agrobacterium liquid and preparation of injection

A single colony on the YEB plate is picked up and put into 10ml of YEP liquid culture medium containing Kan, Str and Rif antibiotics, the mixture is shaken at 28 ℃ and 200rpm overnight, the mixture is centrifuged at 4000rpm for 5min, the supernatant is discarded, and the precipitate is resuspended to the OD600 of about 0.1 by using an infection buffer solution. Each 50ml injection buffer contains 250mg glucose, 0.488g MES, 0.038g Na₃PO₄·12H₂O and 1mg of acetosyringone.

3. Injection and pathogenicity determination of the ArgSMV strain (SC7) on Nicotiana benthamiana

The Bo's tobacco cultured for 3 weeks was left in a light environment for 2 hours to open its stomata. Injecting the prepared agrobacterium ArgSMV (SC7) into the leaves spread by the Nicotiana benthamiana by using a disposable injector, wherein each leaf is 0.1ml, each plant is injected with 2 leaves, and 3 plants are injected in total; meanwhile, 3 tobacco injection buffer solutions with the same growth vigor are selected as negative controls; then the culture chamber is returned to the culture chamber for 3-4 weeks. The infection result is carried out by adopting two methods of phenotype observation and PCR detection; the phenotype is shown in fig. 4 and 5, and the plant infected by ArgSMV (SC7) is green and has obviously curled leaves. In order to detect whether the leaves contain the SMV or not by utilizing PCR, the invention extracts RNA of newly grown leaves of two groups of plants and carries out reverse transcription to form a cDNA template, primers SMV-C-F and SMV-C-R (such as SEQ ID NO.14 and SEQ ID NO.15) are used for carrying out PCR to detect the accumulation of the SMV, primers Tubblin-F and Tubblin-R (such as SEQ ID NO.16 and SEQ ID NO.17) are used for carrying out PCR as internal reference, and the detection result is shown in figure 6. The results show that ArgSMV (SC7) successfully infests burdening tobacco and that soybean mosaic virus successfully replicates and spreads in tobacco neoleaves.

The primer sequences referred to in the above examples are shown in Table 1:

TABLE 1

Sequence listing

<110> Nanjing university of agriculture

<120> soybean mosaic virus infectious cloning vector and agrobacterium strain capable of infecting tobacco and application thereof

<160>17

<170>SIPOSequenceListing 1.0

<210>1

<211>16700

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

aagcttgcat gcctgcaggt caacatggtg gagcacgaca cacttgtcta ctccaaaaat 60

atcaaagata cagtctcaga agaccaaagg gcaattgaga cttttcaaca aagggtaata 120

tccggaaacc tcctcggatt ccattgccca gctatctgtc actttattgt gaagatagtg 180

gaaaaggaag gtggctccta caaatgccat cattgcgata aaggaaaggc catcgttgaa 240

gatgcctctg ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa 300

aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgataa catggtggag 360

cacgacacac ttgtctactc caaaaatatc aaagatacag tctcagaaga ccaaagggca 420

attgagactt ttcaacaaag ggtaatatcc ggaaacctcc tcggattcca ttgcccagct 480

atctgtcact ttattgtgaa gatagtggaa aaggaaggtg gctcctacaa atgccatcat 540

tgcgataaag gaaaggccat cgttgaagat gcctctgccg acagtggtcc caaagatgga 600

cccccaccca cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc ttcaaagcaa 660

gtggattgat gtgatatctc cactgacgta agggatgacg cacaatccca ctatccttcg 720

caagaccctt cctctatata aggaagttca tttcatttgg agaggaaatt aaaacaactc 780

ataaagacaa caacgattac aaacgcattc aagacttcta tttctcactt tcaagcaatt 840

caagccttac gtaaacttct aaacaattca ctattttctc aaggaaaatc aactgaaatg 900

gcaacaatca tgtttggaga ctttactgtg cagctgaagc ataacacaaa gactgagaag 960

agaaagcggg tggtggaaac caccaagctt gaaaaggagg tgcgcatgga aactgtccac 1020

gtgcaagtta tggagagtat tactgtaggt tgctcagcac gctgtgcggg cttgagcgcg 1080

tacacaaagt cgtcccttag gaaagcaatg aaggaagggg atctgagcgc gtcaggggga 1140

tgccattatt gcggtcttcg ggcattggtt ggtgagggtc gcaaaagggt gatttctgta 1200

cccaggttgg tggcgcaaca gaaggaagtg gttgtcacta aggaagttcc tcatttctat 1260

gaggaggaat atgaagttga aataccatgt gtgaccactg agatagcgca accagtagtg 1320

gctgtcactt ctatgagcaa tgtttgcgga actgctatgc agacaaaggt gacaagcact 1380

atcgtcacca aagatatgat ggcgacatct aagccatcat tgaagcaagt cagtcgtgct 1440

cttgtactga ctggtaagaa agaggttggt agctatgact tggctatcaa gaagatggat 1500

gaggcaatgc agcaaaattc tgcgctgcaa aaacagctgt tcattcaaca gcaaagcacc 1560

attcaacaga aacctaaagg agctgttcaa ctgaggttat gctcgtacga acaagcaaag 1620

aaacgtgttg aattggcgcg taagagacaa gaagaagagg aagattttct caatgggaag 1680

tatgaacaac aattctacgc tggcgcatcc actccaaagc ctatgaaatt tgaaggaggg 1740

agtgttggtt ttagaacaaa gtactggaga ccaactccaa agaagattac agaaaggcgt 1800

gcaacaccac agtgtagaaa actaacatat gtcttggagg aggttctctc tttagcttcc 1860

aagagtggca agctggttga atttatcaca ggaggcaaag gaaagagtgt caaagtttgt 1920

tacatgcgga agcatggcgc aatattgccc aagttctctc ttccgcatga agaaggtagg 1980

tatatccatc aggagctcca gtatgaaagc atatacgagt ttcttcctta tatttgcatg 2040

tttgcaaagt ataagagcat aagtgcggat gatataactt atggagatag tggtttactg 2100

tttgatgagc gatcatcttt aaccacaaat catactaaat taccgtactt tgttgtccgg 2160

ggaagagaga atgggaaact tattaacgct cttgagatgg ttgtgagcat gagggacatc 2220

cagcattatt cccaaaatcc tgaggttcag tttttccgtg gttggaaaaa ggtgttcgac 2280

acaatgcttc cacatgtgga gaatcatgaa tgcaccattg atttcacaaa tgagcagtgt 2340

ggtgaattgg cagcagcaat taatcaatca atctttccag ttaagaagct atcatgtaat 2400

caatgtcgac agcacattaa gaatcttagt tgggaggagt acaaacaatt ccttttagcc 2460

cacatgagtt gtcataggac tgaatgggaa gacttccaga aagttgatgg catgaggtat 2520

gtgaagaaag tgattgagac atcaactgcg gaaaacgcaa gtcttcagac atcaatggag 2580

attgtgcgtt taacacaaaa ctataagagt actcacatgc ttcaaataca ggatattaat 2640

aaggctctta tgaagggtcc gtcggttaca cagggtgagc tggagcaagc ttccaagcag 2700

ctactagcaa tgacacagtg gtggaaaaat cacatggctt taactgatga ggatgcactt 2760

aaagtgttca ggaacaagag atcttccaaa gcactactta acccaagttt gctttgtgat 2820

aatcagttgg acaagaatgg taatttcgtc tggggagagc gtggcaggca ttcaaagcga 2880

ttcttttcga attactttga agaggttgtt ccttctgaag ggtacagtaa gtatgtgatt 2940

agaaagaatc cgaacggaca aagagagttg gcaattgggt ctcttattgt gccgctagat 3000

tttgagcgtg ctcgaatggc actgcagggc aaaagtgtaa caagagagcc aattacaatg3060

tcatgtatct caagacaaga tgggaacttt gtgtatcctt gctgttgcgt cacacatgat 3120

gatggaaaag ctttctattc tgagcttaag agtcctacaa agcgccactt ggttattgga 3180

acatctggtg atccaaaata cattgatctg ccagccactg atgcagatag gatgtatata 3240

gctaaagaag gattttgcta cctcaacatc ttcttggcaa tgttggtcaa tgtaaatgaa 3300

gatgaagcca aagacttcac gaagatggta agggatgtta ttgtgccaag gctaggaaag 3360

tggccgacaa tgttagatgt agcaacagct acatacatgc taacagtttt tcatcctgaa 3420

accagaaatg ctgagcttcc acgtatttta gttgaccatg cgtgtcaaac catgcatgta 3480

atagactctt ttgggtccct cacagttggg taccatgttc ttaaagctgg cacagtgaac 3540

caattgattc aatttgcttc caatgacctt cagagcgaga tgaaatttta cagagttggt 3600

ggcgaagtgc agcaaaggat gaagtgtgaa acagcactta taacaagtat tttcaaacct 3660

aagaggatga ttcaaatcct tgagaatgat ccatacattc ttttgatggg cctggtttca 3720

ccttctatcc tgattcacat gtatcgcatg aagcatttcg aaaaaggggt ggagttgtgg 3780

ataagtaagg aacatagtgt ggcaaagatc ttcattatat tggaacagct caccaagagg 3840

gttgctgcaa atgacgtgct acttgagcag cttgaaatga tttcagagac ttcagagaga 3900

ttcatgagca tattagagga ctgtccccaa gtaccaccgt catacaagac agcaaaagat 3960

ttgttaacaa tgtatataga aagaaaagca tccaacagcc agcttgttga gaatggtttt 4020

gtggatatga atgacaagtt gtacatggca tatgaaaaaa tctattcaga tcgcttgaag 4080

caggaatggc gcgcattaag ctggttggaa aaattttcta taacatggca gttgaaaaga 4140

tttactccac atacggagaa atgtttgaca aagaaagttg tagaagaaag cagcgcatct 4200

tcaggaaact ttgcgagtgt gtgcttcatg aatgcccagt cacacctcag aaatgtaaga 4260

aatacacttt ttcaaaaatg tgaccaggtt tggactgcat cggtgcgagc ttttgtgagg 4320

ctcataattt cgacacttca taggtgctac agtgatattg tttatctggt gaacatctgt 4380

ataatctttt cattgcttgt ccaaatgact agtgtactgc aaggcattgt caacacagca 4440

aggagagata aagcactctt aaatagatgg aaaaggaaag aagatgaaga ggccgtgatc 4500

catttgtatg aaatgtgtga aaagatggaa ggtggacacc caaggcttga gaaattttta 4560

gaccatgtca agggtgttag acctgatcta ctccccatag cagtgagcat gacaggacaa 4620

tcagaagatg tctccgcaca ggccaaaaca gcaactcaat tgcaacttga gaaaattgtg 4680

gcattcatgg ctttgttgac catgtgtatt gataatgaaa ggagtgatgc ggttttcaaa 4740

atattgagca agttaaaggc atttttcagc acaatgggtg aggatgttaa agtgcagagt 4800

cttgatgaga ttcaaaacat tgatgaagac aagaggctca caattgattt cgaccttgaa 4860

acaaataagg agtcttccag tgtttctttt gatgttaaat ttgaggcctg gtggaataga 4920

cagttggaac agaatagagt aattccacac tacaggtcga caggtgagtt tcttgagttc 4980

acaagagaaa cagcagccaa agttgcaaat ttgatagcaa catcaagcca cacagaattt 5040

ttgattcgag gtgcagttgg ctcagggaaa tcaacaggtt taccacatca cctctcaaag 5100

aagggcaaag ttctgctact agagccaact agaccgttag cggagaatgt tagtaagcag 5160

ttgagctttg aacctttcta tcataatgta acactgagaa tgagaggatt gagcaagttt 5220

ggctcaagta acatagttgt catgacaagt gggtttgcgt ttcattacta tgtcaacaat 5280

ccacaacagc tatctgattt cgattttatc ataatagacg agtgccatgt tcaagatagc 5340

ccaacgattg cattcaactg tgcgcttaaa gaatttgaat ttagtggcaa acttataaaa 5400

gtgtctgcaa cacctccagg aagagagtgc gaattcacaa cacaacatcc agtgaagttg 5460

aaagttgaag accatttgtc ttttcagaac tttgtgcaag ctcagggtac aggatcaaat 5520

gctgatatga tccaacatgg gaacaattta ctcgtatacg ttgcaagtta caatgaagtt 5580

gaccaattgt cacgactatt aactgagaaa cattacaagg tgacaaaggt tgatgggaga 5640

acaatgcaaa tgggaaatgt agagattgca accacaggca cggaagggaa accacacttc 5700

atagtcgcaa caaatatcat tgagaatgga gtgactcttg atattgattg cgtaattgat 5760

tttggactta aagtggtggc aacccttgac acagataacc ggtgtgtgcg ttacaacaaa 5820

cagtcagttt cttatgggga gcggatccag agacttggca gagttggtcg ttgtaaacct 5880

ggatttgcgc taaggattgg acacacggga aaaggagttg aggaagttcc cgagttcata 5940

gctacagagg cagcctttct atcctttgct tatgggttgc cagttacaac acaaagtgtc 6000

tcgaccaaca tactgtcccg ttgcacagtg aaacaagctc gagtagctct gaattttgag 6060

ctaactccat ttttcaccac taacttcata aagtatgatg gtagcatgca cccagaaatt 6120

cacagactgc tcaagtccta caaactaagg gagtccgaga tgttattgac caagttagcc 6180

ataccatatc agtttgttgg gcagtgggtg acagtcaagg agtatgaacg tcaaggtatc 6240

cacctcaatt gtccagagaa agtgaaaata cctttctatg tgcatggaat accagataag 6300

ttgtacgaga tgttgtggga cacagtttgt aaatacaaga atgatgctgg atttggctca 6360

attaagagtg tgaatgcaac gaagattagt tacactctaa gcactgaccc gacagcaatt 6420

cctcgcacac ttgcaatact ggaccatttg ttgagtgagg agatgactaa gaagagtcat 6480

tttgacacaa ttggctctgc tgttactggg tattcctttt ctcttgcagg catagctgat 6540

ggatttagaa agaggtattt aaaggactac acacagcata atatagccgt cctacaacag 6600

gctaaagcac agctgctaga gttcgactgc aacaaagttg acatcaacaa cctgcacaat 6660

gttgagggta taggcatttt aaatgcagtc caactacaga gcaaacatga ggtgagcaaa 6720

tttttgcagc ttaaaggaaa gtgggatgga aagaaattca tgaatgatgc tgttgtggct 6780

atcttcactt tagtgggcgg tggttggatg ctatgggatt acttcacaag agtcatacgt 6840

gaaccagtat caactcaagg aaagaagagg cagatacaaa agctcaaatt tagggatgcc 6900

tttgacagaa aagtaggccg tgaggtgtat gcagatgatt acaccatgga gcacaccttt 6960

ggggaggcat ataccaagaa aggaaagcag aaaggcagca ctcgtacaaa aggaatgggt 7020

cgcaaatcga ggaacttcat acatctatat ggagttgagc cagagaatta cagcatgatt 7080

aggtttgtag accctctaac tgggcacaca atggatgaac accccagagt tgatatcaga 7140

atggttcaac aagagtttga ggatataagg aaggacatga ttggggaggg tgaattggat 7200

cggcaaagag tttaccataa ccctggttta caggcttatt tcattgggaa gaatacagag 7260

gaagcactca aagttgacctcacaccacac agacccacac ttctctgtca aaacagcaat 7320

gctatagcgg gttttccaga gagggaggat gaattgcgtc agacaggctt gccacaagta 7380

gtttccaggt cagacgttcc acgtgccaaa gaaagggttg aagtggaaag caaatctgtt 7440

tacaaaggac tcagagatta tagtggcatt tccacattaa tatgtcaact tacaaattca 7500

tcagatggac acaaagaaac aatgtttggg gttggctatg gttctttcat tatcacaaat 7560

gggcacttgt ttaggaggaa caatggaatg ctcacagtca agacatggca tggtgagttt 7620

gtgatacaca acactacaca gctcaagata cattttattc aagggaagga tgtgattctg 7680

attcgcatgc caaaggactt tcctccattt gggaagcgca atctctttag acaaccaaag 7740

cgtgaggaac gggtttgtat ggttggaaca aactttcaag agaagagctt gcgtgcaaca 7800

gtttcagaat cttctatgat attgccagag gggaaaggtt ctttttggat acattggatt 7860

acaacccaag atggtttttg tgggttgcct cttgtttctg ttaatgatgg gcacattgtt 7920

ggaatacatg gattagcatc taatgattca gagaagaact ttttcgttcc actcactgat 7980

gggtttgaga aggaatatct ggagaatgct gataacttgt catgggataa gcactggttt 8040

tgggaaccaa gcaagatagc atggggctct ttgaatttag ttgaggaaca accaaaagag 8100

gagttcaaaa tatcaaagct tgtatcggat ctctttggaa acacagtgac agtacaaggg 8160

agaaaggaaa gatgggtttt agatgcaatg gaaggcaact tagtggcttg tgggcaagct 8220

gacagtgcat tggtaacaaa gcatgttgtt aaaggaaagt gcccctattt cgcacaatac 8280

ctttcagtga atcaagaagc aaagtccttc tttgaaccac ttatgggtgc gtatcaacca 8340

agccgattaa acaaagatgc attcaaacga gatttcttca aatacaacaa accagttgtt 8400

ttgaatgaag ttgatttcca gtcttttgag agggcagtgg ctggagtgaa gctgatgatg 8460

atggaatttg atttcaagga gtgtgtgtat gtgactgatc ctgatgaaat atacgactcc 8520

ttgaacatga aagctgcagt tggtgcacaa tacaaaggga agaagcaaga ttacttctct 8580

ggaatggata gttttgacaa ggaacgcttg ctttacctca gttgcgaaag gttattttat 8640

ggggaaaaag gagtgtggaa tggatctctg aaagcagagc taaggccaat tgaaaaagtg 8700

caagcaaaca aaactagaac attcacagca gcaccaattg acacactact tggagcaaaa 8760

gtttgtgttg atgatttcaa caatcaattt tacagtctca atcttacatg tccatggaca 8820

gttggaatga ccaaatttta tagaggttgg gacaagttga tgagaagttt acccgatgga 8880

tgggtgtact gtcatgcaga tggctcacag tttgatagtt ccctgacacc tttactactg 8940

aatgcagttc ttgatgtcag gagctttttc atggaagact ggtgggttgg aagagaaatg 9000

ctagaaaacc tctatgctga gatagtctac acaccaatct tagcacctga tggcacaatt 9060

tttaaaaagt tcagaggaaa caacagtggg caaccatcta cagttgtgga taacactttg 9120

atggtagtca ttgccatgta ctattcttgt tgtaagcatg ggtggtcaga ggaggatatt 9180

caggaaagat tagtgttttt cgccaatggc gatgacatca ttcttgcagt tagtgataag 9240

gatacatggc tatatgacac tcttagcact tcgttcgctg aacttggtct caattacaac 9300

tttgaggaac ggacaaagaa gagggaggaa ttgtggttca tgtctcacaa agccatgtta 9360

gttgatggaa tttatattcc aaaacttgaa cctgagagaa ttgtctctat tctagagtgg 9420

gacaggagca aagagcttat gcatcgcact gaggcgatat gtgcatcaat gattgaggca 9480

tggggataca ctgaattact gcaagagatc cgcaaatttt atttgtggct tttgaacaag 9540

gatgagttta aggagctcgc ttcgtctgga aaagcaccat atattgcaga gacagctttg 9600

agaaagctgt acacagatgt caatgcacaa acaagtgagc tacaaagata tcttgaagtg 9660

ttggacttta atcatattga tgactgttgt gaatcagtgt ctctacaatc aggcaaggag 9720

aaggaaggag acatggatgc agataaagat ccaaagaaga gcaccagtag tagcaaggga 9780

gctggaacaa gtagcaaaga tgtaaatgtt ggatcaaaag gaaaggtggt tccgcgtttg 9840

cagaagatta caaggaagat gaatcttcca atggttgaag ggaagatcat tctcagtttg 9900

gaccacttgc ttgagtataa acctaaccag gttgatttat tcaatacccg ggcaacgaga 9960

acacagttcg aagcgtggta caatgcagtt aaagatgaat atgagcttga tgatgaacag 10020

atgggtgtgg ttatgaatgg tttcatggta tggtgcattg acaatggcac atctccagat 10080

gcaaatggcg tgtgggtgat gatggatgga aaagaacaga ttgaatatcc gctgaaaccc 10140

attgttgaaa atgcaaaacc aactttgaga caaatcatgc accacttctc agatgcagca 10200

gaagcttaca ttgagatgag aaattctgaa agtccgtata tgcctagata tggactactg 10260

aggaatttga gagatagaga gctagcccgc tatgcttttg atttctatga ggttacttcc 10320

aaaacaccaa acagggcaag ggaagcaata gcgcagatga aggctgcagc tctttcggga 10380

gttaacaaca agttgtttgg acttgatggg aacatctcaa ctaactccga aaatactgaa 10440

aggcacactg caagggatgt gaatcaaaac atgcacactc ttttgggtat gggcccacag 10500

cagtaaaggc taagtaaatt ggtcacagtt atcatttcgg gtcgctttat agtttgctat 10560

aatatagtat ttgcactgtc tttaagtata gtgtgattgc atcaccaaat aatgcttttg 10620

tttagtgtgg ttttaaccac ccagtgtgct ttatgttata gtttatgaat ggcaggagaa 10680

ccattgtgtt gctggagccc tttggagagt ggttttaacc acgtctagtg gccgaggtac 10740

ggcaatgttt gttgtcctaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 10800

aaaaaaaaaa aaaagggtcg gcatggcatc tccacctcct cgcggtccga cctgggcatc 10860

cgaaggagga cgcacgtcca ctcggatggc taagggagag ccactgggtc agggagagct 10920

cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg 10980

ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta 11040

acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat 11100

acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg 11160

cggtgtcatc tatgttacta gatcggaatt cagattgtcg tttcccgcct tcagtttaaa 11220

ctatcagtgt ttgacaggat atattggcgg gtaaacctaa gagaaaagag cgtttattag 11280

aataatcgga tatttaaaag ggcgtgaaaa ggtttatccg ttcgtccatt tgtatgtgca 11340

tgccaaccac aggagatctc agtgccacct gggtcctttt catcacgtgc tataaaaata 11400

attataattt aaatttttta atataaatat ataaattaaa aatagaaagt aaaaaaagaa 11460

attaaagaaa aaatagtttt tgttttccga agatgtaaaa gactctaggg ggatcgccaa 11520

caaatactac cttttatctt gctcttcctg ctctcaggta ttaatgccga attgtttcat 11580

cttgtctgtg tagaagacca cacacgaaaa tcctgtgatt ttacatttta cttatcgtta 11640

atcgaatgta tatctattta atctgctttt cttgtctaat aaatatatat gtaaagtacg 11700

ctttttgttg aaatttttta aacctttgtt tatttttttt tcttcattcc gtaactcttc 11760

taccttcttt atttactttc taaaatccaa atacaaaaca taaaaataaa taaacacaga 11820

gtaaattccc aaattattcc atcattaaaa gatacgaggc gcgtgtaagt tacaggcaag 11880

cgatccgtct aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg 11940

aggccctttc gtctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc 12000

ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc 12060

gcgtcagcgg gtgttggcgg gtgtcggggc tggcttaact atgcggcatc agagcagatt 12120

gtactgagag tgcaccatag atcacgacat tactatatat ataatatagg aagcatttaa 12180

tagaacagca tcgtaatata tgtgtacttt gcagttatga cgccagatgg cagtagtgga 12240

agatattctt tattgaaaaa tagcttgtca ccttacgtac aatcttgatc cggagctttt 12300

ctttttttgc cgattaagaa ttaattcggt cgaaaaaaga aaaggagagg gccaagaggg 12360

agggcattgg tgactattga gcacgtgagt atacgtgatt aagcacacaa aggcagcttg 12420

gagtatgtct gttattaatt tcacaggtag ttctggtcca ttggtgaaag tttgcggctt 12480

gcagagcaca gaggccgcag aatgtgctct agattccgat gctgacttgc tgggtattat 12540

atgtgtgccc aatagaaaga gaacaattga cccggttatt gcaaggaaaa tttcaagtct 12600

tgtaaaagca tataaaaata gttcaggcac tccgaaatac ttggttggcg tgtttcgtaa 12660

tcaacctaag gaggatgttt tggctctggt caatgattac ggcattgata tcgtccaact 12720

gcatggagat gagtcgtggc aagaatacca agagttcctc ggtttgccag ttattaaaag 12780

actcgtattt ccaaaagact gcaacatact actcagtgca gcttcacaga aacctcattc 12840

gtttattccc ttgtttgatt cagaagcagg tgggacaggt gaacttttgg attggaactc 12900

gatttctgac tgggttggaa ggcaagagag ccccgaaagc ttacatttta tgttagctgg 12960

tggactgacg ccagaaaatg ttggtgatgc gcttagatta aatggcgtta ttggtgttga 13020

tgtaagcgga ggtgtggaga caaatggtgt aaaagactct aacaaaatag caaatttcgt 13080

caaaaatgct aagaaatagg ttattactga gtagtattta tttaagtatt gtttgtgcac 13140

ttgccgatct atgcggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag 13200

gaaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca 13260

ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag 13320

atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc 13380

aacgtcaaag ggcgaaaaac cgtctgtaaa gcgctggctg aacccccagc cggaactgac 13440

cccacaaggc cctagcgttt gcaatgcacc aggtcatcat tgacccaggc gtgttccacc 13500

aggccgctgc ctcgcaactc ttcgcaggct tcgccgacct gctcgcgcca cttcttcacg 13560

cgggtggaat ccgatccgca catgaggcgg aaggtttcca gcttgagcgg gtacggctcc 13620

cggtgcgagc tgaaatagtc gaacatccgt cgggccgtcg gcgacagctt gcggtacttc 13680

tcccatatga atttcgtgta gtggtcgcca gcaaacagca cgacgatttc ctcgtcgatc 13740

aggacctggc aacgggacgt tttcttgcca cggtccagga cgcggaagcg gtgcagcagc 13800

gacaccgatt ccaggtgccc aacgcggtcg gacgtgaagc ccatcgccgt cgcctgtagg 13860

cgcgacaggc attcctcggc cttcgtgtaa taccggccat tgatcgacca gcccaggtcc 13920

tggcaaagct cgtagaacgt gaaggtgatc ggctcgccga taggggtgcg cttcgcgtac 13980

tccaacacct gctgccacac cagttcgtca tcgtcggccc gcagctcgac gccggtgtag 14040

gtgatcttca cgtccttgtt gacgtggaaa atgaccttgt tttgcagcgc ctcgcgcggg 14100

attttcttgt tgcgcgtggt gaacagggca gagcgggccg tgtcgtttgg catcgctcgc 14160

atcgtgtccg gccacggcgc aatatcgaac aaggaaagct gcatttcctt gatctgctgc 14220

ttcgtgtgtt tcagcaacgc ggcctgcttg gcctcgctga cctgttttgc caggtcctcg 14280

ccggcggttt ttcgcttctt ggtcgtcata gttcctcgcg tgtcgatggt catcgacttc 14340

gccaaacctg ccgcctcctg ttcgagacga cgcgaacgct ccacggcggc cgatggcgcg 14400

ggcagggcag ggggagccag ttgcacgctg tcgcgctcga tcttggccgt agcttgctgg 14460

gccatcgagc cgacggactg gaaggtttcg cggggcgcac gcatgacggt gcggcttgcg 14520

atggtttcgg catcctcggc ggaaaacccc gcgtcgatca gttcttgcct gtatgccttc 14580

cggtcaaacg tccgattcat tcaccctcct tgcgggattg ccccgactca cgccggggca 14640

atgtgccctt attcctgatt tgacccgcct ggtgccttgg tgtccagata atccacctta 14700

tcggcaatga agtcggtccc gtagaccgtc tggccgtcct tctcgtactt ggtattccga 14760

atcttgccct gcacgaatac cagcgacccc ttgcccaaat acttgccgtg ggcctcggcc 14820

tgagagccaa aacacttgat gcggaagaag tcggtgcgct cctgcttgtc gccggcatcg 14880

ttgcgccaca tctaggtact aaaacaattc atccagtaaa atataatatt ttattttctc 14940

ccaatcaggc ttgatcccca gtaagtcaaa aaatagctcg acatactgtt cttccccgat 15000

atcctccctg atcgaccgga cgcagaaggc aatgtcatac cacttgtccg ccctgccgct 15060

tctcccaaga tcaataaagc cacttacttt gccatctttc acaaagatgt tgctgtctcc 15120

caggtcgccg tgggaaaaga caagttcctc ttcgggcttt tccgtcttta aaaaatcata 15180

cagctcgcgc ggatctttaa atggggtgtc ttcttcccag ttttcgcaat ccacatcggc 15240

cagatcgtta ttcagtaagt aatccaattc ggctaagcgg ctgtctaagc tattcgtata 15300

gggacaatcc gatatgtcga tggagtgaaa gagcctgatg cactccgcat acagctcgat 15360

aatcttttca gggctttgtt catcttcata ctcttccgag caaaggacgc catcggcctc 15420

actcatgagc agattgctcc agccatcatg ccgttcaagg tgcaggacct ttggaacagg 15480

cagctttcct tccagccata gcatcatgtc cttttcccgt tccacatcat aggtggtccc 15540

tttataccgg ctgtccgtca tttttaaata taggttttca ttttctccca ccagcttata 15600

taccttagca ggagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt 15660

tttcaattcc ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag 15720

tatttaaaga taccccaaga agctaattat aacaagacga actccaattc actgttcctt 15780

gcattctaaa actttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg 15840

tataacatag tatcgacgga gccgattttg aaaccacaat tatgggtgat gctgcaactc 15900

gagcgggccg ggagggttcg agaagggggg gcacccccct tcggcgtgcg cggtcacgcg 15960

cacagggcgc agccctggtt aaaaacaagg tttataaata ttggtttaaa agcaggttaa 16020

aagacaggtt agcggtggcc gaaaaacggg cggaaaccct tgcaaatgct ggattttctg 16080

cctgtggaca gcccctcaaa tgtcaatagg tgcgcccctc atctgtcagc actctgcccc 16140

tcaagtgtca aggatcgcgc ccctcatctg tcagtagtcg cgcccctcaa gtgtcaatac 16200

cgcagggcac ttatccccag gcttgtccac atcatctgtg ggaaactcgc gtaaaatcag 16260

gcgttttcgc cgatttgcga ggctggccag ctccacgtcg ccggccgaaa tcgagcctgc 16320

ccctcatctg tcaacgccgc gccgggtgag tcggcccctc aagtgtcaac gtccgcccct 16380

catctgtcag tgagggccaa gttttccgcg aggtatccac aacgccggcg gccgcggtgt 16440

ctcgcacacg gcttcgacgg cgtttctggc gcgtttgcag ggccatagac ggccgccagc 16500

ccagcggcga gggcaaccag cccggtgagc gtctctagtg gactgatggg ctgcctgtat 16560

cgagtggtga ttttgtgccg agctgccggt cggggagctg ttggctggct ggtggcagga 16620

tatattgtgg tgtaaacaaa ttgacgctta gacaacttaa taacacattg cggacgtttt 16680

taatgtactg gggtggtttt 16700

<210>3

<211>60

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ctctatataa ggaagttcat ttcatttgga gaggaaatta aaacaactca taaagacaac 60

<210>3

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gatgtctcaa tcactttctt cacatac 27

<210>4

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ctttaacatc ctcacccatt gtg 23

<210>5

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

catgtggaga atcatgaatg cacca 25

<210>6

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cagcaactca attgcaactt gagaaaattg 30

<210>7

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gtatctgcct cttctttcct tgagttgata c 31

<210>8

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gttgacatca acaacctgca caatgttg 28

<210>9

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gctcatattc atctttaact gcattgtacc ac 32

<210>10

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ggtggttccg cgtttgcaga agattac 27

<210>11

<211>100

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggaggtggag atgccatgcc gacccttttt tttttttttt tttttttttt tttttttttt 60

tttttttttt tttttttttt taggacaaca aacattgccg 100

<210>12

<211>99

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gctctccctg acccagtggc tctcccttag ccatccgagt ggacgtgcgt cctccttcgg 60

atgcccaggt cggaccgcga ggaggtggag atgccatgc 99

<210>13

<211>82

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

accggcaaca ggattcaatc ttaagaaact ttattgccaa atgtttgaac gatcggggaa 60

attcgagctc tccctgaccc ag 82

<210>14

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

cagaggaagc actcaaggtt g 21

<210>15

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ctcagtgcga tgcataagct c 21

<210>16

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ggagttcaca gaggcagag 19

<210>17

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

cacttacgca tcacatagca 20

Claims (8)

1. A soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) capable of infecting tobacco is characterized by having a sequence shown in SEQ ID NO. 1.

2. The method for constructing the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) according to claim 1, wherein RNA is extracted from soybean leaves infected with soybean mosaic virus SC7, the RNA is reversely transcribed into cDNA, a fragment of the soybean mosaic virus SC7 is obtained by using a plurality of pairs of primers for segmented amplification, then sequences of PolyA and HDVrz are introduced after the 3' UTR of the last fragment by using a PCR method, and overlapping sequences exist among the fragments; transferring the fragments and a pCB301 vector linearized by SmaI and StuI into a yeast W303 strain for recombination reaction; the infectious clone vector pCB301-SMV (SC7) is formed by screening the vector with successful recombination and extracting the plasmid.

3. The method of claim 2, wherein the fragments of SMV are obtained by a first round of PCR in five separate amplifications: the template was the cDNA of the resulting SMV (SC7) by reverse transcription, frag1a was amplified using primers 1c-F-1 and 1a-2R, frag2a was amplified using primers 2a-F and 2a-2R, frag3a was amplified using primers 3a-F and 3a-R, frag4a was amplified using primers 4a-F and 4a-R, frag5-1a was amplified using primers 5a-F and 5 a-R-1; wherein the sequence of 1c-F-1 is shown as SEQ ID NO.2, the sequence of 1a-2R is shown as SEQ ID NO.3, the sequence of 2a-F is shown as SEQ ID NO.5, the sequence of 2a-2R is shown as SEQ ID NO.4, the sequence of 3a-F is shown as SEQ ID NO.6, the sequence of 3a-R is shown as SEQ ID NO.7, the sequence of 4a-F is shown as SEQ ID NO.8, the sequence of 4a-R is shown as SEQ ID NO.9, the sequence of 5a-F is shown as SEQ ID NO.10, and the sequence of 5a-R-1 is shown as SEQ ID NO. 11.

4. Construction method according to claim 2, characterized in that the fragments containing PolyA and HDVrz are obtained by 2 additional rounds of PCR: first, using the fragment frag5a-1 obtained by the above PCR as a template, and amplifying the fragment with primers 5a-F and 5a-R-2 to obtain frag5 a-2; then taking the fragment frag5a-2 obtained by the PCR as a template, and amplifying by using primers 5a-F and 5a-R-3 to obtain a frag5a-3 fragment, namely a fragment containing PolyA and HDVrz; wherein the sequence of 5a-F is shown as SEQ ID NO.10, the sequence of 5a-R-2 is shown as SEQ ID NO.12, and the sequence of 5a-R-3 is shown as SEQ ID NO. 13.

5. The construction method according to any one of claims 2 to 4, wherein the vector pCB301 is subjected to double enzyme digestion by using NEB endonucleases SmaI and StuI to obtain a linearized pCB301 vector, frag1a, frag2a, frag3a, frag4a, frag5a-3 and the linearized pCB301 vector are uniformly mixed according to the mol ratio of 1:1:1:1:1:1, and are transferred into yeast W303 competent cells by using a PEG/L iAc mediated method, SD/-Trp plates are coated after resuscitation and are placed into a 30 ℃ incubator for inverted culture for 3 days, a plurality of single colonies are selected in a liquid SD/-Trp culture medium, and yeast plasmids are extracted after shaking overnight, and the extracted plasmid is the pCB301-SMV (SC7) infectious cloning vector.

6. Agrobacterium transformed with the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) of claim 1.

7. Use of the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) of claim 1 for infecting tobacco.

8. Use of the agrobacterium of claim 6 to infest tobacco.

Images