CN111440818A - Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof - Google Patents
Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof Download PDFInfo
- Publication number
- CN111440818A CN111440818A CN202010095003.3A CN202010095003A CN111440818A CN 111440818 A CN111440818 A CN 111440818A CN 202010095003 A CN202010095003 A CN 202010095003A CN 111440818 A CN111440818 A CN 111440818A
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- mosaic virus
- smv
- pcb301
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/34011—Potyviridae
- C12N2770/34022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a soybean mosaic virus infectious cloning vector capable of infecting tobacco, an agrobacterium strain and application thereof. The sequence of the soybean mosaic virus infectious cloning vector capable of infecting tobacco is shown in SEQ ID NO. 1. The soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) is applied to infected tobacco. In the invention, a soybean mosaic virus strain (SC7) capable of infecting tobacco is selected to construct an infectious cloning vector, agrobacterium is transformed and the tobacco is injected, so that system infection is successfully formed on the tobacco. The method lays a solid and reliable foundation for the application of tobacco in the research aspect of soybean mosaic virus.
Description
Technical Field
The invention belongs to the field of genetic engineering, and relates to a soybean mosaic virus infectious cloning vector capable of infecting tobacco, an agrobacterium strain and application thereof.
Background
Soybean Mosaic Virus (SMV) belongs to potyvirus, and the genome is a positive-sense RNA strand with the size of about 9.6kb and comprises 5 'and 3' non-coding regions and a middle coding sequence. One polypeptide translated from its coding sequence can form 10 mature viral proteins by self-cleavage. Soybean mosaic virus hosts are narrow, but have wide prevalence range, and occur to different degrees in the main soybean producing areas all over the world. After soybean is infected with soybean mosaic virus, symptoms such as flower and leaf shrinkage, dead top and the like can be generated, so that the growth and development of plants are hindered, and the yield and the quality are reduced.
The pathogenic cause of the soybean mosaic virus is researched, the mechanism of the plant for resisting the soybean mosaic virus is clarified, and the molecular breeding method can be more effectively applied to realize the cultivation of good disease-resistant varieties. In previous studies on soybean mosaic virus and anti-soybean mosaic virus genes, we have been limited to performing on soybean plants themselves. However, due to the difficulty of soybean genetic transformation and the like, the progress of related research is not smooth; moreover, because the infection range of the soybean mosaic virus is limited, the range of searching for the disease-resistant gene does not break through the species limit all the time. The plant virus infectious cloning vector can provide a new idea for the fields of virus and plant interaction and the like. The RNA genome of the virus is difficult to perform in vitro gene manipulation, and after the RNA genome is constructed into DNA-based infectious clone, the operations of virus recombination, mutation, fragment insertion and deletion and the like can be easily performed, and the RNA genome can also carry exogenous genes to be co-expressed along with the infection of the virus.
Tobacco is a commonly used model plant for plant disease resistance studies. As few soybean mosaic virus strains can infect tobacco, the application of the soybean mosaic virus strain to the tobacco is fresh in the research of the soybean mosaic virus.
Disclosure of Invention
The invention aims to provide a soybean mosaic virus infectious cloning vector capable of infecting tobacco, aiming at the defects of the prior art.
Another object of the present invention is to provide Agrobacterium transformed with the vector.
The invention also aims to provide the application of the vector and the agrobacterium.
The purpose of the invention can be realized by the following technical scheme:
a soybean mosaic virus infectious clone vector pCB301-SMV (SC7) capable of infecting tobacco has a complete sequence shown as SEQ ID NO.1, a construction method shown as figure 1 and a vector map shown as figure 2.
The construction method of the soybean mosaic virus infectious clone vector pCB301-SMV (SC7) extracts RNA from soybean leaves infected with the SMV (SC7), carries out reverse transcription to obtain cDNA, obtains fragments of the SMV by utilizing a plurality of pairs of primers for segmented amplification, then introduces sequences of PolyA and HDVrz after 3' UTR of the fragments by utilizing a PCR method, and overlapping sequences exist among the fragments; transferring the fragments and a pCB301 vector linearized by SmaI and StuI into a yeast W303 strain for recombination reaction; the infectious clone vector pCB301-SMV (SC7) is formed by screening the vector with successful recombination and extracting the plasmid.
As a preferable example of the construction method of the present invention, fragments of SMV are obtained by PCR amplification in five sections: the template was the cDNA of the resulting SMV (SC7) by reverse transcription, frag1a was amplified using primers 1c-F-1 and 1a-2R, frag2a was amplified using primers 2a-F and 2a-2R, frag3a was amplified using primers 3a-F and 3a-R, frag4a was amplified using primers 4a-F and 4a-R, frag5-1a was amplified using primers 5a-F and 5 a-R-1; wherein the sequence of 1c-F-1 is shown as SEQ ID NO.2, the sequence of 1a-2R is shown as SEQ ID NO.3, the sequence of 2a-F is shown as SEQ ID NO.5, the sequence of 2a-2R is shown as SEQ ID NO.4, the sequence of 3a-F is shown as SEQ ID NO.6, the sequence of 3a-R is shown as SEQ ID NO.7, the sequence of 4a-F is shown as SEQ ID NO.8, the sequence of 4a-R is shown as SEQ ID NO.9, the sequence of 5a-F is shown as SEQ ID NO.10, and the sequence of 5a-R-1 is shown as SEQ ID NO. 11.
As a preferred embodiment of the construction method of the present invention, fragments containing PolyA and HDVrz were obtained by 2 additional rounds of PCR: first, using the fragment frag5a-1 obtained by the above PCR as a template, and amplifying the fragment with primers 5a-F and 5a-R-2 to obtain frag5 a-2; then taking the fragment frag5a-2 obtained by the PCR as a template, and amplifying by using primers 5a-F and 5a-R-3 to obtain a frag5a-3 fragment, namely a fragment containing PolyA and HDVrz; wherein the sequence of 5a-F is shown as SEQ ID NO.10, the sequence of 5a-R-2 is shown as SEQ ID NO.12, and the sequence of 5a-R-3 is shown as SEQ ID NO. 13.
As a preferable selection of the construction method, the vector pCB301 is subjected to double enzyme digestion by using NEB endonuclease SmaI and StuI to obtain a linearized pCB301 vector, the frag1a, frag2a, frag3a, frag4a, frag5a-3 for standby purification and the linearized pCB301 vector are uniformly mixed according to the mol ratio of 1:1:1:1:1, yeast W303 competent cells are transferred by using a PEG/L iAc mediated method, SD/-Trp plates are coated after recovery and placed in a 30 ℃ incubator for inverted culture for 3 days, a plurality of single colonies are selected in a liquid/-Trp culture medium, yeast plasmids are extracted after shaking overnight, and the SD plasmid is the pCB301-SMV (SC7) infectious clone vector.
Agrobacterium transformed with the soybean mosaic virus infectious cloning vector pCB301-SMV (SC 7).
The application of the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) in infecting tobacco.
The application of the agrobacterium in infecting tobacco.
Has the advantages that:
1. the soybean mosaic virus sequence carried by the infectious cloning vector pCB301-SMV (SC7) is in a DNA form, so that the genetic operations of virus genome recombination, fragment insertion and the like are facilitated.
2. The infectious cloning vector pCB301-SMV (SC7) and a strain ArgSMV (SC7) formed by transforming agrobacterium thereof can be conveniently and stably stored in a low-temperature refrigerator for a long time, and can effectively avoid the defect that the original soybean mosaic virus is stored in a leaf way.
3. The invention breaks through the species boundary in the aspect of soybean mosaic virus disease-resistant research, expands the related research to tobacco, and can realize the pathogenicity analysis of the soybean mosaic virus on the tobacco, thereby promoting the discovery process of cross-species disease-resistant genes.
In the invention, a soybean mosaic virus strain (SC7) capable of infecting tobacco is selected to construct an infectious cloning vector, agrobacterium is transformed and the tobacco is injected, so that system infection is successfully formed on the tobacco. The method lays a solid and reliable foundation for the application of tobacco in the research aspect of soybean mosaic virus.
Drawings
FIG. 1 is a schematic diagram of the construction process of the soybean mosaic virus infectious cloning vector.
FIG. 2 shows the construction of the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) vector.
FIG. 3 is a photograph of a purified soybean mosaic virus fragment and a vector agarose gel electrophoresis; 1: DNA marker 10000; 2: SMV amplified fragment frag1 a; 3: SMV amplified fragment frag2 a; 4: SMV amplified fragment frag3 a; 5: SMV amplified fragment frag4 a; :6: SMV amplified fragment frag5 a-1; 7: SMV amplified fragment frag5 a-2; 8: SMV amplified fragment frag5 a-3; 9: pCB301 vector after linearization with SmaI and StuI.
FIG. 4 is a graph comparing the phenotype of the injected strain ArgSMV of Nicotiana benthamiana (SC7) and the buffer solution after 1 month injection; a: the phenotype of the plant after the Nicotiana benthamiana injection strain ArgSMV (SC7) is shown, the edge of a leaf is curled downwards, the pigment distribution is uneven, and the plant is dwarfed; b: the phenotype, negative control, leaf blade and plant type of the plant are normal after the Nicotiana benthamiana is injected with the infection buffer solution.
FIG. 5 is a comparison of details of the back of the leaf discs after 1 month injection of the strain ArgSMV (SC7) and buffer; the obtained leaves are injection superior leaves A: the leaf back phenotype after the B.benthamiana injection strain ArgSMV (SC 7); b: the back phenotype of the leaf after injecting infection buffer solution into Nicotiana benthamiana.
FIG. 6 detection of SMV accumulation in tobacco leaves by PCR; 1. 2, 3 are divided into upper leaves of tobacco plants which are taken from 3 injected strains ArgSMV (SC 7); 4. 5 and 6 are divided into upper leaves of 3 tobacco plants injected with the buffer solution. The detection time is 1 month after injection.
Detailed Description
The following examples are intended to illustrate the invention without limiting its scope of use.
Example 1: construction of Soybean mosaic Virus infectious cloning vector pCB301-SMV (SC7)
1. RNA extraction and reverse transcription of SMV (SC7) isolates
Extraction of RNA was performed using trizol reagent: putting 1 blade inoculated with SMV (SC7) into a 2ml centrifuge tube, adding liquid nitrogen, and rapidly grinding into powder by using a grinding rod; adding 1ml trizol, shaking and mixing uniformly, standing for 5min at room temperature; adding 200ml chloroform, shaking vigorously for 15sec, and standing at room temperature for 2 min; centrifuging at 12000rcf for 10min at 4 deg.C, sucking 500 μ l supernatant, adding into 500 μ l isopropanol, mixing, and standing for 5 min; centrifuging for 5min at 12000rcf of a 4 ℃ centrifuge, and discarding the supernatant; adding 1ml 75% ethanol, vortex for 1min, centrifuging at 4 deg.C in 12000rcf for 1min, discarding supernatant, standing at room temperature for 5min to fully volatilize ethanol. Adding 50 μ l of water to dissolve the RNA precipitate. Reverse transcription of RNA Using Primescript of TAKARATMii1st strand cdna synthesis kit: the reverse transcription process was performed as described in the specification, wherein the reverse transcription primer used was the oligodT provided in the kit.
2. Amplification of SMV (SC7) fragment and enzyme digestion purification of vector
Amplification of the SMV (SC7) fragment: the amplification of the fragment was carried out by 3 rounds of PCR using PrimerSTAR-Max-DNA-Polymerase from TAKARA, all according to the instructions; the primers used are as in table 1; in the first round of PCR amplification, the template is cDNA obtained by reverse transcription as described above, the frag1a is amplified by using primers 1c-F-1 and 1a-2R (such as SEQ ID NO.2 and SEQ ID NO.3), the frag2a is amplified by using primers 2a-F and 2a-2R (such as SEQ ID NO.5 and SEQ ID NO.4), the frag3a is amplified by using primers 3a-F and 3a-R (such as SEQ ID NO.6 and SEQ ID NO.7), the frag4a is amplified by using primers 4a-F and 4a-R (such as SEQ ID NO.8 and SEQ ID NO.9), and the frag5a-1 is amplified by using primers 5a-F and 5a-R-1 (such as SEQ ID NO.10 and SEQ ID NO. 11); in the second round of PCR amplification, the template is frag5a-1 obtained by the above PCR, and primers 5a-F and 5a-R-2 (shown as SEQ ID NO.10 and SEQ ID NO.12) are used for amplifying frag5 a-2; in the third round of PCR amplification, the template is frag5a-2 obtained by the above PCR, and primers 5a-F and 5a-R-3 (shown as SEQ ID NO.10 and SEQ ID NO.13) are used for amplifying frag5 a-3; the vector pCB301 was double-digested with the NEB endonucleases SmaI and StuI at 25 ℃ for 1 hour and 37 ℃ for 1 hour. The vector digestion product and the SMV (SC7) fragment were purified for future use using an AxyPrep DNA gel recovery kit, the purification process was performed according to the instructions, the purified fragment was detected by agarose gel electrophoresis, and the detection results are shown in FIG. 3.
3. Yeast transformation and plasmid extraction of each fragment and linearized vector
Selecting Saccharomyces cerevisiae strain W303 cultured on YPDA plate culture medium, placing the strain into 50ml YPDA liquid culture medium, shaking at 220rpm for overnight at 30 ℃ until OD600 is near 1.0, pouring the strain into a 50ml centrifuge tube, centrifuging, using sterile water to resuspend and centrifuge, removing supernatant, adding 0.1M L iAc to prepare into competent cells, uniformly mixing the frag1a, frag2a, frag3a, frag4a, frag5a-3 and linearized pCB301 vector according to the mol ratio of 1:1:1:1:1, transferring the strain into yeast competent cells by using a PEG/L iAc mediation method, coating SD/-plate after recovery, placing the strain into a 30 ℃ SD culture box for inverted culture for 3 days, selecting a plurality of single colonies into the liquid/-Trp culture medium, shaking for extracting yeast plasmid, using Omega yeast small extraction kit, completely extracting the plasmid, namely extracting the pCB vector (SC-7) according to the specification.
Example 2: preparation of Agrobacterium-forming Strain ArgSMV (SC7) and infection with Nicotiana benthamiana
1. Agrobacterium freeze-thaw method for transforming infectious clone vector pCB301-SMV (SC7)
The infectious cloning vector pCB301-SMV (SC7) is transferred into an agrobacterium strain EHA105 by using a freeze-thaw method, and the specific operation is as follows: taking 1 EHA105 competence, placing on ice for thawing, adding 5. mu.l pCB301-SMV (SC7) plasmid, mixing, freezing in liquid nitrogen for 2min, placing in 37 ℃ water bath for 3min, adding 800. mu.l YEP culture medium for resuscitation for 3 h, taking 100. mu.l, uniformly coating on YEB culture medium containing Kan, Str and Rif antibiotics, and performing inversion culture at 28 ℃ for 3 days. The Agrobacterium strain ArgSMV (SC7) was prepared.
2. Enlarged culture of agrobacterium liquid and preparation of injection
A single colony on the YEB plate is picked up and put into 10ml of YEP liquid culture medium containing Kan, Str and Rif antibiotics, the mixture is shaken at 28 ℃ and 200rpm overnight, the mixture is centrifuged at 4000rpm for 5min, the supernatant is discarded, and the precipitate is resuspended to the OD600 of about 0.1 by using an infection buffer solution. Each 50ml injection buffer contains 250mg glucose, 0.488g MES, 0.038g Na3PO4·12H2O and 1mg of acetosyringone.
3. Injection and pathogenicity determination of the ArgSMV strain (SC7) on Nicotiana benthamiana
The Bo's tobacco cultured for 3 weeks was left in a light environment for 2 hours to open its stomata. Injecting the prepared agrobacterium ArgSMV (SC7) into the leaves spread by the Nicotiana benthamiana by using a disposable injector, wherein each leaf is 0.1ml, each plant is injected with 2 leaves, and 3 plants are injected in total; meanwhile, 3 tobacco injection buffer solutions with the same growth vigor are selected as negative controls; then the culture chamber is returned to the culture chamber for 3-4 weeks. The infection result is carried out by adopting two methods of phenotype observation and PCR detection; the phenotype is shown in fig. 4 and 5, and the plant infected by ArgSMV (SC7) is green and has obviously curled leaves. In order to detect whether the leaves contain the SMV or not by utilizing PCR, the invention extracts RNA of newly grown leaves of two groups of plants and carries out reverse transcription to form a cDNA template, primers SMV-C-F and SMV-C-R (such as SEQ ID NO.14 and SEQ ID NO.15) are used for carrying out PCR to detect the accumulation of the SMV, primers Tubblin-F and Tubblin-R (such as SEQ ID NO.16 and SEQ ID NO.17) are used for carrying out PCR as internal reference, and the detection result is shown in figure 6. The results show that ArgSMV (SC7) successfully infests burdening tobacco and that soybean mosaic virus successfully replicates and spreads in tobacco neoleaves.
The primer sequences referred to in the above examples are shown in Table 1:
TABLE 1
Sequence listing
<110> Nanjing university of agriculture
<120> soybean mosaic virus infectious cloning vector and agrobacterium strain capable of infecting tobacco and application thereof
<160>17
<170>SIPOSequenceListing 1.0
<210>1
<211>16700
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aagcttgcat gcctgcaggt caacatggtg gagcacgaca cacttgtcta ctccaaaaat 60
atcaaagata cagtctcaga agaccaaagg gcaattgaga cttttcaaca aagggtaata 120
tccggaaacc tcctcggatt ccattgccca gctatctgtc actttattgt gaagatagtg 180
gaaaaggaag gtggctccta caaatgccat cattgcgata aaggaaaggc catcgttgaa 240
gatgcctctg ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa 300
aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgataa catggtggag 360
cacgacacac ttgtctactc caaaaatatc aaagatacag tctcagaaga ccaaagggca 420
attgagactt ttcaacaaag ggtaatatcc ggaaacctcc tcggattcca ttgcccagct 480
atctgtcact ttattgtgaa gatagtggaa aaggaaggtg gctcctacaa atgccatcat 540
tgcgataaag gaaaggccat cgttgaagat gcctctgccg acagtggtcc caaagatgga 600
cccccaccca cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc ttcaaagcaa 660
gtggattgat gtgatatctc cactgacgta agggatgacg cacaatccca ctatccttcg 720
caagaccctt cctctatata aggaagttca tttcatttgg agaggaaatt aaaacaactc 780
ataaagacaa caacgattac aaacgcattc aagacttcta tttctcactt tcaagcaatt 840
caagccttac gtaaacttct aaacaattca ctattttctc aaggaaaatc aactgaaatg 900
gcaacaatca tgtttggaga ctttactgtg cagctgaagc ataacacaaa gactgagaag 960
agaaagcggg tggtggaaac caccaagctt gaaaaggagg tgcgcatgga aactgtccac 1020
gtgcaagtta tggagagtat tactgtaggt tgctcagcac gctgtgcggg cttgagcgcg 1080
tacacaaagt cgtcccttag gaaagcaatg aaggaagggg atctgagcgc gtcaggggga 1140
tgccattatt gcggtcttcg ggcattggtt ggtgagggtc gcaaaagggt gatttctgta 1200
cccaggttgg tggcgcaaca gaaggaagtg gttgtcacta aggaagttcc tcatttctat 1260
gaggaggaat atgaagttga aataccatgt gtgaccactg agatagcgca accagtagtg 1320
gctgtcactt ctatgagcaa tgtttgcgga actgctatgc agacaaaggt gacaagcact 1380
atcgtcacca aagatatgat ggcgacatct aagccatcat tgaagcaagt cagtcgtgct 1440
cttgtactga ctggtaagaa agaggttggt agctatgact tggctatcaa gaagatggat 1500
gaggcaatgc agcaaaattc tgcgctgcaa aaacagctgt tcattcaaca gcaaagcacc 1560
attcaacaga aacctaaagg agctgttcaa ctgaggttat gctcgtacga acaagcaaag 1620
aaacgtgttg aattggcgcg taagagacaa gaagaagagg aagattttct caatgggaag 1680
tatgaacaac aattctacgc tggcgcatcc actccaaagc ctatgaaatt tgaaggaggg 1740
agtgttggtt ttagaacaaa gtactggaga ccaactccaa agaagattac agaaaggcgt 1800
gcaacaccac agtgtagaaa actaacatat gtcttggagg aggttctctc tttagcttcc 1860
aagagtggca agctggttga atttatcaca ggaggcaaag gaaagagtgt caaagtttgt 1920
tacatgcgga agcatggcgc aatattgccc aagttctctc ttccgcatga agaaggtagg 1980
tatatccatc aggagctcca gtatgaaagc atatacgagt ttcttcctta tatttgcatg 2040
tttgcaaagt ataagagcat aagtgcggat gatataactt atggagatag tggtttactg 2100
tttgatgagc gatcatcttt aaccacaaat catactaaat taccgtactt tgttgtccgg 2160
ggaagagaga atgggaaact tattaacgct cttgagatgg ttgtgagcat gagggacatc 2220
cagcattatt cccaaaatcc tgaggttcag tttttccgtg gttggaaaaa ggtgttcgac 2280
acaatgcttc cacatgtgga gaatcatgaa tgcaccattg atttcacaaa tgagcagtgt 2340
ggtgaattgg cagcagcaat taatcaatca atctttccag ttaagaagct atcatgtaat 2400
caatgtcgac agcacattaa gaatcttagt tgggaggagt acaaacaatt ccttttagcc 2460
cacatgagtt gtcataggac tgaatgggaa gacttccaga aagttgatgg catgaggtat 2520
gtgaagaaag tgattgagac atcaactgcg gaaaacgcaa gtcttcagac atcaatggag 2580
attgtgcgtt taacacaaaa ctataagagt actcacatgc ttcaaataca ggatattaat 2640
aaggctctta tgaagggtcc gtcggttaca cagggtgagc tggagcaagc ttccaagcag 2700
ctactagcaa tgacacagtg gtggaaaaat cacatggctt taactgatga ggatgcactt 2760
aaagtgttca ggaacaagag atcttccaaa gcactactta acccaagttt gctttgtgat 2820
aatcagttgg acaagaatgg taatttcgtc tggggagagc gtggcaggca ttcaaagcga 2880
ttcttttcga attactttga agaggttgtt ccttctgaag ggtacagtaa gtatgtgatt 2940
agaaagaatc cgaacggaca aagagagttg gcaattgggt ctcttattgt gccgctagat 3000
tttgagcgtg ctcgaatggc actgcagggc aaaagtgtaa caagagagcc aattacaatg3060
tcatgtatct caagacaaga tgggaacttt gtgtatcctt gctgttgcgt cacacatgat 3120
gatggaaaag ctttctattc tgagcttaag agtcctacaa agcgccactt ggttattgga 3180
acatctggtg atccaaaata cattgatctg ccagccactg atgcagatag gatgtatata 3240
gctaaagaag gattttgcta cctcaacatc ttcttggcaa tgttggtcaa tgtaaatgaa 3300
gatgaagcca aagacttcac gaagatggta agggatgtta ttgtgccaag gctaggaaag 3360
tggccgacaa tgttagatgt agcaacagct acatacatgc taacagtttt tcatcctgaa 3420
accagaaatg ctgagcttcc acgtatttta gttgaccatg cgtgtcaaac catgcatgta 3480
atagactctt ttgggtccct cacagttggg taccatgttc ttaaagctgg cacagtgaac 3540
caattgattc aatttgcttc caatgacctt cagagcgaga tgaaatttta cagagttggt 3600
ggcgaagtgc agcaaaggat gaagtgtgaa acagcactta taacaagtat tttcaaacct 3660
aagaggatga ttcaaatcct tgagaatgat ccatacattc ttttgatggg cctggtttca 3720
ccttctatcc tgattcacat gtatcgcatg aagcatttcg aaaaaggggt ggagttgtgg 3780
ataagtaagg aacatagtgt ggcaaagatc ttcattatat tggaacagct caccaagagg 3840
gttgctgcaa atgacgtgct acttgagcag cttgaaatga tttcagagac ttcagagaga 3900
ttcatgagca tattagagga ctgtccccaa gtaccaccgt catacaagac agcaaaagat 3960
ttgttaacaa tgtatataga aagaaaagca tccaacagcc agcttgttga gaatggtttt 4020
gtggatatga atgacaagtt gtacatggca tatgaaaaaa tctattcaga tcgcttgaag 4080
caggaatggc gcgcattaag ctggttggaa aaattttcta taacatggca gttgaaaaga 4140
tttactccac atacggagaa atgtttgaca aagaaagttg tagaagaaag cagcgcatct 4200
tcaggaaact ttgcgagtgt gtgcttcatg aatgcccagt cacacctcag aaatgtaaga 4260
aatacacttt ttcaaaaatg tgaccaggtt tggactgcat cggtgcgagc ttttgtgagg 4320
ctcataattt cgacacttca taggtgctac agtgatattg tttatctggt gaacatctgt 4380
ataatctttt cattgcttgt ccaaatgact agtgtactgc aaggcattgt caacacagca 4440
aggagagata aagcactctt aaatagatgg aaaaggaaag aagatgaaga ggccgtgatc 4500
catttgtatg aaatgtgtga aaagatggaa ggtggacacc caaggcttga gaaattttta 4560
gaccatgtca agggtgttag acctgatcta ctccccatag cagtgagcat gacaggacaa 4620
tcagaagatg tctccgcaca ggccaaaaca gcaactcaat tgcaacttga gaaaattgtg 4680
gcattcatgg ctttgttgac catgtgtatt gataatgaaa ggagtgatgc ggttttcaaa 4740
atattgagca agttaaaggc atttttcagc acaatgggtg aggatgttaa agtgcagagt 4800
cttgatgaga ttcaaaacat tgatgaagac aagaggctca caattgattt cgaccttgaa 4860
acaaataagg agtcttccag tgtttctttt gatgttaaat ttgaggcctg gtggaataga 4920
cagttggaac agaatagagt aattccacac tacaggtcga caggtgagtt tcttgagttc 4980
acaagagaaa cagcagccaa agttgcaaat ttgatagcaa catcaagcca cacagaattt 5040
ttgattcgag gtgcagttgg ctcagggaaa tcaacaggtt taccacatca cctctcaaag 5100
aagggcaaag ttctgctact agagccaact agaccgttag cggagaatgt tagtaagcag 5160
ttgagctttg aacctttcta tcataatgta acactgagaa tgagaggatt gagcaagttt 5220
ggctcaagta acatagttgt catgacaagt gggtttgcgt ttcattacta tgtcaacaat 5280
ccacaacagc tatctgattt cgattttatc ataatagacg agtgccatgt tcaagatagc 5340
ccaacgattg cattcaactg tgcgcttaaa gaatttgaat ttagtggcaa acttataaaa 5400
gtgtctgcaa cacctccagg aagagagtgc gaattcacaa cacaacatcc agtgaagttg 5460
aaagttgaag accatttgtc ttttcagaac tttgtgcaag ctcagggtac aggatcaaat 5520
gctgatatga tccaacatgg gaacaattta ctcgtatacg ttgcaagtta caatgaagtt 5580
gaccaattgt cacgactatt aactgagaaa cattacaagg tgacaaaggt tgatgggaga 5640
acaatgcaaa tgggaaatgt agagattgca accacaggca cggaagggaa accacacttc 5700
atagtcgcaa caaatatcat tgagaatgga gtgactcttg atattgattg cgtaattgat 5760
tttggactta aagtggtggc aacccttgac acagataacc ggtgtgtgcg ttacaacaaa 5820
cagtcagttt cttatgggga gcggatccag agacttggca gagttggtcg ttgtaaacct 5880
ggatttgcgc taaggattgg acacacggga aaaggagttg aggaagttcc cgagttcata 5940
gctacagagg cagcctttct atcctttgct tatgggttgc cagttacaac acaaagtgtc 6000
tcgaccaaca tactgtcccg ttgcacagtg aaacaagctc gagtagctct gaattttgag 6060
ctaactccat ttttcaccac taacttcata aagtatgatg gtagcatgca cccagaaatt 6120
cacagactgc tcaagtccta caaactaagg gagtccgaga tgttattgac caagttagcc 6180
ataccatatc agtttgttgg gcagtgggtg acagtcaagg agtatgaacg tcaaggtatc 6240
cacctcaatt gtccagagaa agtgaaaata cctttctatg tgcatggaat accagataag 6300
ttgtacgaga tgttgtggga cacagtttgt aaatacaaga atgatgctgg atttggctca 6360
attaagagtg tgaatgcaac gaagattagt tacactctaa gcactgaccc gacagcaatt 6420
cctcgcacac ttgcaatact ggaccatttg ttgagtgagg agatgactaa gaagagtcat 6480
tttgacacaa ttggctctgc tgttactggg tattcctttt ctcttgcagg catagctgat 6540
ggatttagaa agaggtattt aaaggactac acacagcata atatagccgt cctacaacag 6600
gctaaagcac agctgctaga gttcgactgc aacaaagttg acatcaacaa cctgcacaat 6660
gttgagggta taggcatttt aaatgcagtc caactacaga gcaaacatga ggtgagcaaa 6720
tttttgcagc ttaaaggaaa gtgggatgga aagaaattca tgaatgatgc tgttgtggct 6780
atcttcactt tagtgggcgg tggttggatg ctatgggatt acttcacaag agtcatacgt 6840
gaaccagtat caactcaagg aaagaagagg cagatacaaa agctcaaatt tagggatgcc 6900
tttgacagaa aagtaggccg tgaggtgtat gcagatgatt acaccatgga gcacaccttt 6960
ggggaggcat ataccaagaa aggaaagcag aaaggcagca ctcgtacaaa aggaatgggt 7020
cgcaaatcga ggaacttcat acatctatat ggagttgagc cagagaatta cagcatgatt 7080
aggtttgtag accctctaac tgggcacaca atggatgaac accccagagt tgatatcaga 7140
atggttcaac aagagtttga ggatataagg aaggacatga ttggggaggg tgaattggat 7200
cggcaaagag tttaccataa ccctggttta caggcttatt tcattgggaa gaatacagag 7260
gaagcactca aagttgacctcacaccacac agacccacac ttctctgtca aaacagcaat 7320
gctatagcgg gttttccaga gagggaggat gaattgcgtc agacaggctt gccacaagta 7380
gtttccaggt cagacgttcc acgtgccaaa gaaagggttg aagtggaaag caaatctgtt 7440
tacaaaggac tcagagatta tagtggcatt tccacattaa tatgtcaact tacaaattca 7500
tcagatggac acaaagaaac aatgtttggg gttggctatg gttctttcat tatcacaaat 7560
gggcacttgt ttaggaggaa caatggaatg ctcacagtca agacatggca tggtgagttt 7620
gtgatacaca acactacaca gctcaagata cattttattc aagggaagga tgtgattctg 7680
attcgcatgc caaaggactt tcctccattt gggaagcgca atctctttag acaaccaaag 7740
cgtgaggaac gggtttgtat ggttggaaca aactttcaag agaagagctt gcgtgcaaca 7800
gtttcagaat cttctatgat attgccagag gggaaaggtt ctttttggat acattggatt 7860
acaacccaag atggtttttg tgggttgcct cttgtttctg ttaatgatgg gcacattgtt 7920
ggaatacatg gattagcatc taatgattca gagaagaact ttttcgttcc actcactgat 7980
gggtttgaga aggaatatct ggagaatgct gataacttgt catgggataa gcactggttt 8040
tgggaaccaa gcaagatagc atggggctct ttgaatttag ttgaggaaca accaaaagag 8100
gagttcaaaa tatcaaagct tgtatcggat ctctttggaa acacagtgac agtacaaggg 8160
agaaaggaaa gatgggtttt agatgcaatg gaaggcaact tagtggcttg tgggcaagct 8220
gacagtgcat tggtaacaaa gcatgttgtt aaaggaaagt gcccctattt cgcacaatac 8280
ctttcagtga atcaagaagc aaagtccttc tttgaaccac ttatgggtgc gtatcaacca 8340
agccgattaa acaaagatgc attcaaacga gatttcttca aatacaacaa accagttgtt 8400
ttgaatgaag ttgatttcca gtcttttgag agggcagtgg ctggagtgaa gctgatgatg 8460
atggaatttg atttcaagga gtgtgtgtat gtgactgatc ctgatgaaat atacgactcc 8520
ttgaacatga aagctgcagt tggtgcacaa tacaaaggga agaagcaaga ttacttctct 8580
ggaatggata gttttgacaa ggaacgcttg ctttacctca gttgcgaaag gttattttat 8640
ggggaaaaag gagtgtggaa tggatctctg aaagcagagc taaggccaat tgaaaaagtg 8700
caagcaaaca aaactagaac attcacagca gcaccaattg acacactact tggagcaaaa 8760
gtttgtgttg atgatttcaa caatcaattt tacagtctca atcttacatg tccatggaca 8820
gttggaatga ccaaatttta tagaggttgg gacaagttga tgagaagttt acccgatgga 8880
tgggtgtact gtcatgcaga tggctcacag tttgatagtt ccctgacacc tttactactg 8940
aatgcagttc ttgatgtcag gagctttttc atggaagact ggtgggttgg aagagaaatg 9000
ctagaaaacc tctatgctga gatagtctac acaccaatct tagcacctga tggcacaatt 9060
tttaaaaagt tcagaggaaa caacagtggg caaccatcta cagttgtgga taacactttg 9120
atggtagtca ttgccatgta ctattcttgt tgtaagcatg ggtggtcaga ggaggatatt 9180
caggaaagat tagtgttttt cgccaatggc gatgacatca ttcttgcagt tagtgataag 9240
gatacatggc tatatgacac tcttagcact tcgttcgctg aacttggtct caattacaac 9300
tttgaggaac ggacaaagaa gagggaggaa ttgtggttca tgtctcacaa agccatgtta 9360
gttgatggaa tttatattcc aaaacttgaa cctgagagaa ttgtctctat tctagagtgg 9420
gacaggagca aagagcttat gcatcgcact gaggcgatat gtgcatcaat gattgaggca 9480
tggggataca ctgaattact gcaagagatc cgcaaatttt atttgtggct tttgaacaag 9540
gatgagttta aggagctcgc ttcgtctgga aaagcaccat atattgcaga gacagctttg 9600
agaaagctgt acacagatgt caatgcacaa acaagtgagc tacaaagata tcttgaagtg 9660
ttggacttta atcatattga tgactgttgt gaatcagtgt ctctacaatc aggcaaggag 9720
aaggaaggag acatggatgc agataaagat ccaaagaaga gcaccagtag tagcaaggga 9780
gctggaacaa gtagcaaaga tgtaaatgtt ggatcaaaag gaaaggtggt tccgcgtttg 9840
cagaagatta caaggaagat gaatcttcca atggttgaag ggaagatcat tctcagtttg 9900
gaccacttgc ttgagtataa acctaaccag gttgatttat tcaatacccg ggcaacgaga 9960
acacagttcg aagcgtggta caatgcagtt aaagatgaat atgagcttga tgatgaacag 10020
atgggtgtgg ttatgaatgg tttcatggta tggtgcattg acaatggcac atctccagat 10080
gcaaatggcg tgtgggtgat gatggatgga aaagaacaga ttgaatatcc gctgaaaccc 10140
attgttgaaa atgcaaaacc aactttgaga caaatcatgc accacttctc agatgcagca 10200
gaagcttaca ttgagatgag aaattctgaa agtccgtata tgcctagata tggactactg 10260
aggaatttga gagatagaga gctagcccgc tatgcttttg atttctatga ggttacttcc 10320
aaaacaccaa acagggcaag ggaagcaata gcgcagatga aggctgcagc tctttcggga 10380
gttaacaaca agttgtttgg acttgatggg aacatctcaa ctaactccga aaatactgaa 10440
aggcacactg caagggatgt gaatcaaaac atgcacactc ttttgggtat gggcccacag 10500
cagtaaaggc taagtaaatt ggtcacagtt atcatttcgg gtcgctttat agtttgctat 10560
aatatagtat ttgcactgtc tttaagtata gtgtgattgc atcaccaaat aatgcttttg 10620
tttagtgtgg ttttaaccac ccagtgtgct ttatgttata gtttatgaat ggcaggagaa 10680
ccattgtgtt gctggagccc tttggagagt ggttttaacc acgtctagtg gccgaggtac 10740
ggcaatgttt gttgtcctaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 10800
aaaaaaaaaa aaaagggtcg gcatggcatc tccacctcct cgcggtccga cctgggcatc 10860
cgaaggagga cgcacgtcca ctcggatggc taagggagag ccactgggtc agggagagct 10920
cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg 10980
ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta 11040
acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat 11100
acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg 11160
cggtgtcatc tatgttacta gatcggaatt cagattgtcg tttcccgcct tcagtttaaa 11220
ctatcagtgt ttgacaggat atattggcgg gtaaacctaa gagaaaagag cgtttattag 11280
aataatcgga tatttaaaag ggcgtgaaaa ggtttatccg ttcgtccatt tgtatgtgca 11340
tgccaaccac aggagatctc agtgccacct gggtcctttt catcacgtgc tataaaaata 11400
attataattt aaatttttta atataaatat ataaattaaa aatagaaagt aaaaaaagaa 11460
attaaagaaa aaatagtttt tgttttccga agatgtaaaa gactctaggg ggatcgccaa 11520
caaatactac cttttatctt gctcttcctg ctctcaggta ttaatgccga attgtttcat 11580
cttgtctgtg tagaagacca cacacgaaaa tcctgtgatt ttacatttta cttatcgtta 11640
atcgaatgta tatctattta atctgctttt cttgtctaat aaatatatat gtaaagtacg 11700
ctttttgttg aaatttttta aacctttgtt tatttttttt tcttcattcc gtaactcttc 11760
taccttcttt atttactttc taaaatccaa atacaaaaca taaaaataaa taaacacaga 11820
gtaaattccc aaattattcc atcattaaaa gatacgaggc gcgtgtaagt tacaggcaag 11880
cgatccgtct aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg 11940
aggccctttc gtctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc 12000
ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc 12060
gcgtcagcgg gtgttggcgg gtgtcggggc tggcttaact atgcggcatc agagcagatt 12120
gtactgagag tgcaccatag atcacgacat tactatatat ataatatagg aagcatttaa 12180
tagaacagca tcgtaatata tgtgtacttt gcagttatga cgccagatgg cagtagtgga 12240
agatattctt tattgaaaaa tagcttgtca ccttacgtac aatcttgatc cggagctttt 12300
ctttttttgc cgattaagaa ttaattcggt cgaaaaaaga aaaggagagg gccaagaggg 12360
agggcattgg tgactattga gcacgtgagt atacgtgatt aagcacacaa aggcagcttg 12420
gagtatgtct gttattaatt tcacaggtag ttctggtcca ttggtgaaag tttgcggctt 12480
gcagagcaca gaggccgcag aatgtgctct agattccgat gctgacttgc tgggtattat 12540
atgtgtgccc aatagaaaga gaacaattga cccggttatt gcaaggaaaa tttcaagtct 12600
tgtaaaagca tataaaaata gttcaggcac tccgaaatac ttggttggcg tgtttcgtaa 12660
tcaacctaag gaggatgttt tggctctggt caatgattac ggcattgata tcgtccaact 12720
gcatggagat gagtcgtggc aagaatacca agagttcctc ggtttgccag ttattaaaag 12780
actcgtattt ccaaaagact gcaacatact actcagtgca gcttcacaga aacctcattc 12840
gtttattccc ttgtttgatt cagaagcagg tgggacaggt gaacttttgg attggaactc 12900
gatttctgac tgggttggaa ggcaagagag ccccgaaagc ttacatttta tgttagctgg 12960
tggactgacg ccagaaaatg ttggtgatgc gcttagatta aatggcgtta ttggtgttga 13020
tgtaagcgga ggtgtggaga caaatggtgt aaaagactct aacaaaatag caaatttcgt 13080
caaaaatgct aagaaatagg ttattactga gtagtattta tttaagtatt gtttgtgcac 13140
ttgccgatct atgcggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag 13200
gaaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca 13260
ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag 13320
atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc 13380
aacgtcaaag ggcgaaaaac cgtctgtaaa gcgctggctg aacccccagc cggaactgac 13440
cccacaaggc cctagcgttt gcaatgcacc aggtcatcat tgacccaggc gtgttccacc 13500
aggccgctgc ctcgcaactc ttcgcaggct tcgccgacct gctcgcgcca cttcttcacg 13560
cgggtggaat ccgatccgca catgaggcgg aaggtttcca gcttgagcgg gtacggctcc 13620
cggtgcgagc tgaaatagtc gaacatccgt cgggccgtcg gcgacagctt gcggtacttc 13680
tcccatatga atttcgtgta gtggtcgcca gcaaacagca cgacgatttc ctcgtcgatc 13740
aggacctggc aacgggacgt tttcttgcca cggtccagga cgcggaagcg gtgcagcagc 13800
gacaccgatt ccaggtgccc aacgcggtcg gacgtgaagc ccatcgccgt cgcctgtagg 13860
cgcgacaggc attcctcggc cttcgtgtaa taccggccat tgatcgacca gcccaggtcc 13920
tggcaaagct cgtagaacgt gaaggtgatc ggctcgccga taggggtgcg cttcgcgtac 13980
tccaacacct gctgccacac cagttcgtca tcgtcggccc gcagctcgac gccggtgtag 14040
gtgatcttca cgtccttgtt gacgtggaaa atgaccttgt tttgcagcgc ctcgcgcggg 14100
attttcttgt tgcgcgtggt gaacagggca gagcgggccg tgtcgtttgg catcgctcgc 14160
atcgtgtccg gccacggcgc aatatcgaac aaggaaagct gcatttcctt gatctgctgc 14220
ttcgtgtgtt tcagcaacgc ggcctgcttg gcctcgctga cctgttttgc caggtcctcg 14280
ccggcggttt ttcgcttctt ggtcgtcata gttcctcgcg tgtcgatggt catcgacttc 14340
gccaaacctg ccgcctcctg ttcgagacga cgcgaacgct ccacggcggc cgatggcgcg 14400
ggcagggcag ggggagccag ttgcacgctg tcgcgctcga tcttggccgt agcttgctgg 14460
gccatcgagc cgacggactg gaaggtttcg cggggcgcac gcatgacggt gcggcttgcg 14520
atggtttcgg catcctcggc ggaaaacccc gcgtcgatca gttcttgcct gtatgccttc 14580
cggtcaaacg tccgattcat tcaccctcct tgcgggattg ccccgactca cgccggggca 14640
atgtgccctt attcctgatt tgacccgcct ggtgccttgg tgtccagata atccacctta 14700
tcggcaatga agtcggtccc gtagaccgtc tggccgtcct tctcgtactt ggtattccga 14760
atcttgccct gcacgaatac cagcgacccc ttgcccaaat acttgccgtg ggcctcggcc 14820
tgagagccaa aacacttgat gcggaagaag tcggtgcgct cctgcttgtc gccggcatcg 14880
ttgcgccaca tctaggtact aaaacaattc atccagtaaa atataatatt ttattttctc 14940
ccaatcaggc ttgatcccca gtaagtcaaa aaatagctcg acatactgtt cttccccgat 15000
atcctccctg atcgaccgga cgcagaaggc aatgtcatac cacttgtccg ccctgccgct 15060
tctcccaaga tcaataaagc cacttacttt gccatctttc acaaagatgt tgctgtctcc 15120
caggtcgccg tgggaaaaga caagttcctc ttcgggcttt tccgtcttta aaaaatcata 15180
cagctcgcgc ggatctttaa atggggtgtc ttcttcccag ttttcgcaat ccacatcggc 15240
cagatcgtta ttcagtaagt aatccaattc ggctaagcgg ctgtctaagc tattcgtata 15300
gggacaatcc gatatgtcga tggagtgaaa gagcctgatg cactccgcat acagctcgat 15360
aatcttttca gggctttgtt catcttcata ctcttccgag caaaggacgc catcggcctc 15420
actcatgagc agattgctcc agccatcatg ccgttcaagg tgcaggacct ttggaacagg 15480
cagctttcct tccagccata gcatcatgtc cttttcccgt tccacatcat aggtggtccc 15540
tttataccgg ctgtccgtca tttttaaata taggttttca ttttctccca ccagcttata 15600
taccttagca ggagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt 15660
tttcaattcc ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag 15720
tatttaaaga taccccaaga agctaattat aacaagacga actccaattc actgttcctt 15780
gcattctaaa actttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg 15840
tataacatag tatcgacgga gccgattttg aaaccacaat tatgggtgat gctgcaactc 15900
gagcgggccg ggagggttcg agaagggggg gcacccccct tcggcgtgcg cggtcacgcg 15960
cacagggcgc agccctggtt aaaaacaagg tttataaata ttggtttaaa agcaggttaa 16020
aagacaggtt agcggtggcc gaaaaacggg cggaaaccct tgcaaatgct ggattttctg 16080
cctgtggaca gcccctcaaa tgtcaatagg tgcgcccctc atctgtcagc actctgcccc 16140
tcaagtgtca aggatcgcgc ccctcatctg tcagtagtcg cgcccctcaa gtgtcaatac 16200
cgcagggcac ttatccccag gcttgtccac atcatctgtg ggaaactcgc gtaaaatcag 16260
gcgttttcgc cgatttgcga ggctggccag ctccacgtcg ccggccgaaa tcgagcctgc 16320
ccctcatctg tcaacgccgc gccgggtgag tcggcccctc aagtgtcaac gtccgcccct 16380
catctgtcag tgagggccaa gttttccgcg aggtatccac aacgccggcg gccgcggtgt 16440
ctcgcacacg gcttcgacgg cgtttctggc gcgtttgcag ggccatagac ggccgccagc 16500
ccagcggcga gggcaaccag cccggtgagc gtctctagtg gactgatggg ctgcctgtat 16560
cgagtggtga ttttgtgccg agctgccggt cggggagctg ttggctggct ggtggcagga 16620
tatattgtgg tgtaaacaaa ttgacgctta gacaacttaa taacacattg cggacgtttt 16680
taatgtactg gggtggtttt 16700
<210>3
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ctctatataa ggaagttcat ttcatttgga gaggaaatta aaacaactca taaagacaac 60
<210>3
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gatgtctcaa tcactttctt cacatac 27
<210>4
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ctttaacatc ctcacccatt gtg 23
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
catgtggaga atcatgaatg cacca 25
<210>6
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
cagcaactca attgcaactt gagaaaattg 30
<210>7
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gtatctgcct cttctttcct tgagttgata c 31
<210>8
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
gttgacatca acaacctgca caatgttg 28
<210>9
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
gctcatattc atctttaact gcattgtacc ac 32
<210>10
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ggtggttccg cgtttgcaga agattac 27
<210>11
<211>100
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ggaggtggag atgccatgcc gacccttttt tttttttttt tttttttttt tttttttttt 60
tttttttttt tttttttttt taggacaaca aacattgccg 100
<210>12
<211>99
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
gctctccctg acccagtggc tctcccttag ccatccgagt ggacgtgcgt cctccttcgg 60
atgcccaggt cggaccgcga ggaggtggag atgccatgc 99
<210>13
<211>82
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
accggcaaca ggattcaatc ttaagaaact ttattgccaa atgtttgaac gatcggggaa 60
attcgagctc tccctgaccc ag 82
<210>14
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
cagaggaagc actcaaggtt g 21
<210>15
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
ctcagtgcga tgcataagct c 21
<210>16
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ggagttcaca gaggcagag 19
<210>17
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
cacttacgca tcacatagca 20
Claims (8)
1. A soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) capable of infecting tobacco is characterized by having a sequence shown in SEQ ID NO. 1.
2. The method for constructing the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) according to claim 1, wherein RNA is extracted from soybean leaves infected with soybean mosaic virus SC7, the RNA is reversely transcribed into cDNA, a fragment of the soybean mosaic virus SC7 is obtained by using a plurality of pairs of primers for segmented amplification, then sequences of PolyA and HDVrz are introduced after the 3' UTR of the last fragment by using a PCR method, and overlapping sequences exist among the fragments; transferring the fragments and a pCB301 vector linearized by SmaI and StuI into a yeast W303 strain for recombination reaction; the infectious clone vector pCB301-SMV (SC7) is formed by screening the vector with successful recombination and extracting the plasmid.
3. The method of claim 2, wherein the fragments of SMV are obtained by a first round of PCR in five separate amplifications: the template was the cDNA of the resulting SMV (SC7) by reverse transcription, frag1a was amplified using primers 1c-F-1 and 1a-2R, frag2a was amplified using primers 2a-F and 2a-2R, frag3a was amplified using primers 3a-F and 3a-R, frag4a was amplified using primers 4a-F and 4a-R, frag5-1a was amplified using primers 5a-F and 5 a-R-1; wherein the sequence of 1c-F-1 is shown as SEQ ID NO.2, the sequence of 1a-2R is shown as SEQ ID NO.3, the sequence of 2a-F is shown as SEQ ID NO.5, the sequence of 2a-2R is shown as SEQ ID NO.4, the sequence of 3a-F is shown as SEQ ID NO.6, the sequence of 3a-R is shown as SEQ ID NO.7, the sequence of 4a-F is shown as SEQ ID NO.8, the sequence of 4a-R is shown as SEQ ID NO.9, the sequence of 5a-F is shown as SEQ ID NO.10, and the sequence of 5a-R-1 is shown as SEQ ID NO. 11.
4. Construction method according to claim 2, characterized in that the fragments containing PolyA and HDVrz are obtained by 2 additional rounds of PCR: first, using the fragment frag5a-1 obtained by the above PCR as a template, and amplifying the fragment with primers 5a-F and 5a-R-2 to obtain frag5 a-2; then taking the fragment frag5a-2 obtained by the PCR as a template, and amplifying by using primers 5a-F and 5a-R-3 to obtain a frag5a-3 fragment, namely a fragment containing PolyA and HDVrz; wherein the sequence of 5a-F is shown as SEQ ID NO.10, the sequence of 5a-R-2 is shown as SEQ ID NO.12, and the sequence of 5a-R-3 is shown as SEQ ID NO. 13.
5. The construction method according to any one of claims 2 to 4, wherein the vector pCB301 is subjected to double enzyme digestion by using NEB endonucleases SmaI and StuI to obtain a linearized pCB301 vector, frag1a, frag2a, frag3a, frag4a, frag5a-3 and the linearized pCB301 vector are uniformly mixed according to the mol ratio of 1:1:1:1:1:1, and are transferred into yeast W303 competent cells by using a PEG/L iAc mediated method, SD/-Trp plates are coated after resuscitation and are placed into a 30 ℃ incubator for inverted culture for 3 days, a plurality of single colonies are selected in a liquid SD/-Trp culture medium, and yeast plasmids are extracted after shaking overnight, and the extracted plasmid is the pCB301-SMV (SC7) infectious cloning vector.
6. Agrobacterium transformed with the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) of claim 1.
7. Use of the soybean mosaic virus infectious cloning vector pCB301-SMV (SC7) of claim 1 for infecting tobacco.
8. Use of the agrobacterium of claim 6 to infest tobacco.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010095003.3A CN111440818B (en) | 2020-02-17 | 2020-02-17 | Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010095003.3A CN111440818B (en) | 2020-02-17 | 2020-02-17 | Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111440818A true CN111440818A (en) | 2020-07-24 |
CN111440818B CN111440818B (en) | 2022-06-10 |
Family
ID=71627032
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010095003.3A Active CN111440818B (en) | 2020-02-17 | 2020-02-17 | Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111440818B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113604500A (en) * | 2021-07-28 | 2021-11-05 | 中国热带农业科学院热带生物技术研究所 | Construction and application of sugarcane streak mosaic virus full-length cDNA infectious clone |
WO2024108742A1 (en) * | 2022-11-24 | 2024-05-30 | 江苏省农业科学院 | Bean common mosaic virus isolate, method for constructing full-length infectious cdna clone of bean common mosaic virus isolate and use of bean common mosaic virus isolate |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104498521A (en) * | 2014-11-27 | 2015-04-08 | 浙江省农业科学院 | Infectious clone vector of cucumber green mottle mosaic virus (CGMMV), agrobacterium strain and preparation method and application of infectious clone vector of cucumber green mottle mosaic virus (CGMMV) |
CN108823226A (en) * | 2018-07-20 | 2018-11-16 | 南京农业大学 | A kind of Chinese soybean mosaic virus infectious clone carrier and its construction method and application |
WO2019223295A1 (en) * | 2018-05-21 | 2019-11-28 | 中国农业大学 | Plant cytorhabdovirus infectious clone, expression vector, and construction method therefor and application thereof |
-
2020
- 2020-02-17 CN CN202010095003.3A patent/CN111440818B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104498521A (en) * | 2014-11-27 | 2015-04-08 | 浙江省农业科学院 | Infectious clone vector of cucumber green mottle mosaic virus (CGMMV), agrobacterium strain and preparation method and application of infectious clone vector of cucumber green mottle mosaic virus (CGMMV) |
WO2019223295A1 (en) * | 2018-05-21 | 2019-11-28 | 中国农业大学 | Plant cytorhabdovirus infectious clone, expression vector, and construction method therefor and application thereof |
CN108823226A (en) * | 2018-07-20 | 2018-11-16 | 南京农业大学 | A kind of Chinese soybean mosaic virus infectious clone carrier and its construction method and application |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113604500A (en) * | 2021-07-28 | 2021-11-05 | 中国热带农业科学院热带生物技术研究所 | Construction and application of sugarcane streak mosaic virus full-length cDNA infectious clone |
WO2024108742A1 (en) * | 2022-11-24 | 2024-05-30 | 江苏省农业科学院 | Bean common mosaic virus isolate, method for constructing full-length infectious cdna clone of bean common mosaic virus isolate and use of bean common mosaic virus isolate |
Also Published As
Publication number | Publication date |
---|---|
CN111440818B (en) | 2022-06-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110283843B (en) | Method for improving citrus canker resistance based on CRISPRCAS9 mediated CsWRKY22 fixed-point editing | |
CN111440818B (en) | Soybean mosaic virus infectious cloning vector capable of infecting tobacco, agrobacterium strain and application thereof | |
CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
CN115058449B (en) | Method for improving citrus canker resistance by using CsWRKY43 interference | |
CN116024234B (en) | Poplar aschersonia aleyrodis effector protein SmCSEP3 and application thereof | |
CN109266650B (en) | Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter | |
CN115820685A (en) | Citrus CsGSTF1 gene and application thereof | |
CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
CN101240290B (en) | Plant transgene expression vector containing green fluorescence protein gene and its construction method and application | |
CN116286881B (en) | Sugarcane tip rot effector FsSCR1 gene and application thereof | |
CN111471689B (en) | Gene for improving resistance of soybean to cyst nematode disease and application thereof | |
CN117802148A (en) | Method for regulating rice plant type | |
CN116926121A (en) | Folum-leaf necrosis virus infectious cloning vector with GFP gene and construction method thereof | |
CN114150003B (en) | Application of cucumber green mottle mosaic virus gene interval region in resistant tobacco cultivation | |
CN112575006B (en) | Elicitin gene for inducing HR and active oxygen accumulation in biocontrol pythium and expression vector and application thereof | |
CN114480486A (en) | Screening method and application of plant antiviral RNA silencing related transcription factors | |
CN104805086B (en) | A kind of promoter of Bermuda grass Tifway dehydrin proteins Dehydrin genes | |
CN117683755B (en) | C-to-G base editing system | |
CN114107371B (en) | Cucumber green mottle mosaic virus gene mediated transgenic tobacco method | |
CN114561387B (en) | Peanut promoter and application thereof | |
CN118325936B (en) | Delivery system for delivery of non-toxic proteins based on bacterial type III secretion system | |
WO2024108742A1 (en) | Bean common mosaic virus isolate, method for constructing full-length infectious cdna clone of bean common mosaic virus isolate and use of bean common mosaic virus isolate | |
CN117925704A (en) | Combined bud inhibition application of STM and ATH1 homologous genes and proteins in tobacco | |
CN104630227A (en) | Constitutive expression promoter of strawberry vein banding virus | |
CN118086358A (en) | Oil tea PDS gene VIGS silencing system and construction method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |