CN110144364B

CN110144364B - Cre-LoxP recombination system for infectious clone of pepper mild mottle virus and application thereof

Info

Publication number: CN110144364B
Application number: CN201810537608.6A
Authority: CN
Inventors: 彭杰军; 郑红英; 赵晋平; 钱靖; 燕飞; 鲁宇文; 林林; 程晔; 陈剑平
Original assignee: Zhejiang Academy of Agricultural Sciences; Ningbo University
Current assignee: Zhejiang Academy of Agricultural Sciences; Ningbo University
Priority date: 2018-05-30
Filing date: 2018-05-30
Publication date: 2023-05-12
Anticipated expiration: 2038-05-30
Also published as: CN110144364A

Abstract

The invention relates to the field of plant genetic engineering, in particular to a Cre-LoxP recombination system for infectious clone of pepper light mottle virus and application thereof. The invention provides a Cre-LoxP recombination system for infectious clone of pepper light mottle virus PMMoV-GFP, which comprises a pJM23 vector, a pJG102 vector and a pCre vector. The Cre-LoxP recombination system of the PMMoV-GFP infectious clone consisting of the pJM23 vector and the pJG2303 vector is further constructed by simplifying the number of Cre-LoxP recombination system vectors by adopting a mode of fusing the Cre gene with the pJG102 vector. The Cre-LoxP recombination system reduces the difficulty of modifying the whole sequence of the PMMoV and improves the operability of the PMMoV exogenous protein expression system.

Description

Cre-LoxP recombination system for infectious clone of pepper mild mottle virus and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a Cre-LoxP recombination system for infectious clone of pepper light mottle virus and application thereof. More specifically, the recombination of infectious cloning vectors of pepper light mottle virus carrying exogenous GFP genes is realized by using a Cre-LoxP recombination system.

Background

The pepper light mottle virus (pepper mild mottle virus, PMMoV) belongs to a member of the genus Tobamovirus, the virion is in the shape of a straight rod, is a positive single strand RNA virus, the genome consists of 6357 nucleotides, and has 4 open reading frames (open reading frames, ORFs) in total, encodes 4 proteins, encoding viral replicase protein p126 (70-3421 nt), viral replicase protein p183 (70-4906 nt), motor protein MP (movement protein,4909-5680 nt) and coat protein CP (coat protein,5685-6156 nt), respectively. PMMoV is one of the important viruses that jeopardizes the production of capsicum, plants show mottled or yellow-green alternate flowers She Zhengzhuang after being infected, fruits show malformations after being infected, mottled, causing capsicum to fall out of leaves, flowers and fruits, and seriously threatening the production of capsicum worldwide.

The Cre recombinase is the 38.5kDa product of the E.coli P1 phage Cre gene, which recognizes and catalyzes recombination between LoxP sites. LoxP is a DNA sequence with a length of 34bp, and comprises 2 inverted repeats of 13bp separated by 8bp, each inverted repeat and adjacent 4bp form a Cre protein binding region, and the sequence is as follows: ATAACTTCGTATA-GCATACAT-TATACGAAGTTAT. The asymmetry of the spacing determines that the LoxP site has directionality. The Cre recombinase can specifically recognize LoxP site without other auxiliary factors, and can complete DNA recombination in-vivo and in-vitro cells. The Cre mediated recombination process is a dynamic, reversible process, and can be divided into three cases according to the LoxP site position: (1) If two LoxP loci are positioned on one DNA chain and have the same direction, cre recombinase can effectively excise sequences between the two LoxP loci; (2) If two LoxP sites are located on one DNA strand, but in opposite directions, cre recombinase can cause sequence inversion between the two LoxP sites; (3) If two LoxP sites are located on two different DNA strands or chromosomes, respectively, cre enzyme can mediate the exchange or chromosomal translocation of the two DNA strands.

By introducing LoxP sequence into target gene sequence and utilizing Cre enzyme to induce LoxP site to make specific integration or recombination, the target genome can be more simply and effectively genetically modified and reformed so as to promote the research of gene function.

Disclosure of Invention

The invention splits the infectious cloning vector of pepper light mottle virus (Pepper mild mottle virus, PMMoV) carrying exogenous GFP gene into about 4kb and 2kb vectors, introduces LoxP sequences into corresponding target fragments, and utilizes Cre enzyme to induce the LoxP sites to recombine in plants to form complete PMMoV-GFP viral sequences, thereby generating PMMoV-GFP viral particles with infection activity.

The invention aims at providing a Cre-LoxP recombination system for infectious clone of pepper light mottle virus PMMoV-GFP.

In some preferred embodiments, the Cre-LoxP recombination system comprises a pJM23 vector, a pJG102 vector, and a pCre vector.

In some preferred modes, the pJM23 vector is constructed by fusing RdRp (p 126/p 183) of PMMoV-GFP invasive clone sequence and MP partial sequence into pCB301, introducing the front half sequence (5'-gtaggtttcattttcataattacacaaatttagatttgatttttgtt-3') of intron and LoxP sequence (5'-ataacttcgtatagcatacattatacgaag ttat-3') at the 3' end, and the nucleotide sequence of the pJM23 vector is shown as SEQ ID No. 14.

In some preferred modes, the pJM102 vector is constructed by fusing another part of MP sequence of PMMoV-GFP invasive cloning sequence, GFP and CP into pCB301, introducing the latter half sequence (5'-ttttattaca tgtttgaacttcaacaatttatgactttttgttcttattgttgcag-3') of the intron and LoxP sequence (5'-ataacttcgtatagcatacattatacgaagttat-3') into the 5' end of the pJM102 vector, and the nucleotide sequence of the pJM102 vector is shown as SEQ ID No. 15.

In some preferred embodiments, the pCre vector is constructed from a Cre sequence fused to a binary expression vector.

In some preferred embodiments, the construction method of the Cre-LoxP recombination system of the PMMoV-GFP invasive clone comprises the following steps:

(1) Obtaining the nucleotide complete sequence of PMMoV-GFP invasive clone;

(2) Designing primers pJM23-1f/r, pJM23-2f/r and pCB301-full f/r, amplifying target fragments introduced with LoxP sequences, and directly reconstructing pJM23, pJM23-2 and pCB301-full fragments obtained by PCR amplification by using ClonExpress MultiS One Step Cloning Kit of Vazyme to construct a pJM23 vector;

(3) Designing primers pJG102f/r and pCB301-102f/r, amplifying target fragments introduced with LoxP sequences, and directly reconstructing pJG102 and pCB301-102 (deletion of 35S promoter by pCB 301) fragments obtained by PCR amplification by using ClonExpress II One Step Cloning Kit of Vazyme to form a pJG102 vector;

(4) Designing a primer pCre f/r to amplify a Cre gene fragment, and constructing a pCre vector by using double enzyme digestion of XbaI and SacI to be connected into a binary expression vector;

(5) The three vectors are co-transformed into Benshi tobacco by adopting an agrobacterium-mediated method, and recombinant PMMoV-GFP invasive clone is obtained after Cre gene expression in vivo.

Preferably, the base sequence of the primer is shown as SEQ ID No. 2-SEQ ID No. 13.

It is another object of the present invention to provide an additional Cre-LoxP recombination system for infectious cloning of the pepper light mottle virus PMMoV-GFP.

In some preferred embodiments, the Cre-LoxP recombination system comprises a pJM23 vector and a pGJ2303 vector.

In some preferred modes, the pJM23 vector is constructed by fusing RdRp (p 126/p 183) of PMMoV-GFP invasive clone sequence and MP partial sequence into pCB301, introducing the front half sequence (5'-gtaggtttcattttcataattacacaaatttagatttgatttttgtt-3') of the intron and the LoxP sequence (5'-ataacttcgtatagcatacattatacgaa gttat-3') into the 3' end of the pJM23 vector, and the nucleotide sequence of the pJM23 vector is shown as SEQ ID No. 14; the pJG2303 vector is formed by fusing a pJG102 vector and 35S-Cre-RZ-NOS, and the nucleotide sequence of the pJG2303 vector is shown as SEQ ID No. 16.

In some preferred modes, the construction method of the Cre-LoxP recombination system of the PMMoV-GFP invasive clone comprises the following steps:

(1) Obtaining the nucleotide complete sequence of PMMoV-GFP invasive clone;

(3) Designing a primer pJG2303f/r, amplifying pCB301-full-RH f/r, introducing a 35S-Cre-RZ-NOS sequence into a pJG102 vector by using ClonExpress II One Step Cloning Kit of Vazyme, and recombining to obtain the pJG2303 vector;

(4) The two vectors are co-transformed into Benshi tobacco by adopting an agrobacterium-mediated method, and recombinant PMMoV-GFP invasive clone is obtained after Cre gene expression in vivo.

Preferably, the base sequence of the primer constructed by the pJG2303 vector is shown in SEQ ID No. 17-SEQ ID No. 20.

The third object of the invention is to provide an application of Cre-LoxP recombination system of pepper light mottle virus PMMoV-GFP invasive clone.

In some preferred embodiments, the Agrobacterium-mediated co-transformation of Nicotiana benthamiana produces biologically active PMMoV-GFP invasive clones by replacing the PMMoV CP gene in the pJG102 vector with the tobacco mosaic virus TMV CP gene.

According to the invention, the PMMoV infectious clone is split into two vectors of about 4kb and 2kb, loxP sequences are introduced into corresponding target fragments, and the LoxP sites are induced to recombine in a plant body by Cre enzyme to form complete PMMoV-GFP virus sequences, so that PMMoV-GFP virus particles with infection activity are generated. The Cre-LoxP recombination system can realize the transformation of the CP gene and the exogenous protein sequence of the PMMoV-GFP invasive clone by transforming the 2kb vector, namely transforming the pJG102 vector, thereby simplifying the transformation process of the PMMoV sequence, reducing the difficulty of transforming the whole PMMoV sequence and improving the operability of the PMMoV exogenous protein expression system.

The invention provides a method for simply and effectively carrying out genetic modification and reconstruction on a target genome, the recombination system provided by the invention not only can effectively shorten the time for reconstructing a virus gene and greatly save related reagent consumables and reconstruction cost, but also can be used for carrying out functional research on related genes and promoting development of related gene functions.

Drawings

FIG. 1 is the principle of PMMoV Cre-LoxP recombination system.

FIG. 2 is a map of pJM23 vector.

FIG. 3 is a map of pJG102 vector.

FIG. 4 is a pCre vector map

FIG. 5 shows the infection and electron microscopy results of pJM23+pJG102+pCre co-infiltrating PMMoV system.

FIG. 6 is an example of construction and map of vector pJG2303, wherein, FIG. A) is a schematic diagram of construction strategy of pJG2303 vector and FIG. B) is a map of pJG2303 vector.

FIG. 7 is a systematic infection of PMMoV after co-infiltration of pJG2303+pJM23.

FIG. 8 shows that the system infection occurs after the CP gene sequence of pJG102 is replaced with the CP gene sequence of TMV.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the technical solution of the present invention without departing from the scope of the present invention, but these changes and substitutions fall within the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

Example 1: PMMoV-GFP invasive cloning

The PMMoV-GFP invasive clone is formed by inserting GFP genes into original PMMoV virus gene sequences, namely, inserting a coat protein gene promoter of tobacco light green mosaic virus (Tobacco mild green mosaic virus, TMGMV) and exogenous GFP genes between motion proteins coded by pepper light mottle virus and coat proteins, and the specific construction process is disclosed in the patent application CN2015104808267. The complete sequence of the PMMoV-GFP infectious cloning vector capable of expressing exogenous GFP is shown as SEQ ID No. 1.

Example 2: construction of a PMMoV-GFP infectious clone Cre-LoxP recombination System consisting of three vectors

1. Vector construction

The PMMoV-GFP infectious clone sequence contained 5 open reading frame ORFs, rdRp (p 126), rdRp (p 183), MP, GFP, CP in sequence. According to the open reading frame of the PMMoV-GFP infectious clone sequence, splitting the whole sequence, preparing a corresponding split vector by fusing the corresponding split fragment to a plant expression vector pCB301 (commercially available) with a 35S promoter and a ribozyme Rz, introducing a LoxP sequence into the corresponding fragment, thereby forming a Cre-LoxP recombination system, and inducing gene recombination through the Cre vector.

The RdRp (p 126/p 183) of the PMMoV-GFP invasive cloning sequence and the MP partial sequence are fused into pCB301 to construct a first vector, which is named pJM23 and contains a 35S promoter and a NOS terminator;

the other part of MP sequence, GFP and CP are fused into pCB301 (the 35S promoter is deleted) to construct a second vector, which is named as pJG102, the 35S promoter is deleted and only NOS terminator is contained;

the Cre sequence is fused into a binary expression vector pCV1300 to construct a third vector which is named pCre.

The pCV1300 vector is formed by double digestion of plasmids pCAMBIA1300 and PBI121 with HindIII and EcoRI, and ligation of the 35S-GUS-NOS segment of pBI121 into the pCAMBIA1300 vector.

Primers are designed according to the corresponding sequences respectively, corresponding fragments are obtained through PCR amplification technology, and the sequences of the primers are shown in Table 1.

TABLE 1 primer sequence listing

The vector pJM23 was amplified into three fragments by the primers pJM23-1f/r, pJM23-2f/r and pCB301-full f/r, the pJM23-1/2 fragment was a PMMoV fragment, and the front half sequence (5'-gtaggtttcattttcataattacacaaatttagatttgatttttgtt-3') and LoxP sequence (5'-ataacttcgtatagcatacattatacgaag ttat-3') of the intron were introduced into the 3' -end of the pJM23-2 fragment, and pCB301-full was the vector fragment.

The vector pJG102 is amplified into two fragments by the primers pJG102f/r and pCB301-102f/r, the 5' -end of the pJG102 fragment is introduced into the latter half sequence of the intron (5'-ttttattacatgtttgaacttcaacaatttatgactttttgttcttattgttgcag-3') and LoxP sequence (5'-ataacttcgtatagcatacattatacgaagttat-3'), and pCB301-102 is the 35S deleted vector sequence.

The Cre fragment was amplified using pCRE plasmid (cloning vector carrying Cre gene) as template and pCre f/r as primer.

(1) Construction of pJM23 and pJG102

The PCR amplification system is as follows: 9. Mu.L of DEPC water, 25. Mu.L of 2X PCR Buffer for KOD FX Neo, 10. Mu.L of 2mM dNTPs, 1.5. Mu.L of each of the upstream and downstream primers (10. Mu.M), 2. Mu.L of cDNA template, 1. Mu.L of KOD FX Neo polymerase, and 50. Mu.L of the total reaction system; the reaction conditions of each fragment are: 94℃2min,94℃15s,60℃30s,68℃3.5min,35 cycles; and at 68℃for 10min.

The construction of the two vectors is completed by recombining the purified amplified target fragment with the corresponding vector by adopting a ClonExpress MultiS One Step Cloning Kit recombination cloning kit of Vazyme company. The reaction was carried out using a 10. Mu.L system in which 5 XCE MultiS Buffer 2. Mu.L, pCB301-full fragment 120ng, pJM23-1, pJM23-2 fragments 60ng,ExnaseTM MultiS 1. Mu.L each, and finally ddH was used ₂ The system was adjusted to 10. Mu.L. The components were gently mixed by blowing up and down several times with a pipette. The reaction was carried out at 37℃for 30min. Immediately after completion of the reaction, the reaction tube was placed in an ice-water bath and cooled for 5min (carrier build pattern shown in FIG. 2).

Purification was performed using the Vazyme company ClonExpress II One Step Cloning Kit recombinant cloning kitThe amplified target fragment of (2) and the corresponding vector are recombined to complete the construction of the two vectors. The reaction was carried out using a 10. Mu.L system in which 5 XCE II Buffer 2. Mu.L, 120ng of pCB301-102 fragment and 60ng,ExnaseTM II 1. Mu.L of pJG102 fragment were used, followed by ddH ₂ The system was adjusted to 10. Mu.L. The components were gently mixed by blowing up and down several times with a pipette. The reaction was carried out at 37℃for 30min. Immediately after completion of the reaction, the reaction tube was placed in an ice-water bath and cooled for 5min (carrier build pattern shown in FIG. 3).

(2) Construction of pCre

The PCR reaction system is as follows: 10 XPrimeSTAR buffer 6. Mu.L, dNTPs 6. Mu.L, upstream and downstream detection primers 0.5. Mu.L each, template DNA 0.5. Mu.L, primeSTAR DNA polymerase 0.5. Mu.L, water 46.5 XX. Mu.L. The reaction procedure is: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 15sec, annealing at 58℃for 15sec, elongation at 68℃for 15sec, and 40 cycles, 72℃continues for 15sec.

And (3) carrying out agarose gel electrophoresis on the PCR product to obtain a target gene fragment, recovering and purifying the target fragment, and sequencing the recovered fragment.

Separating and recovering PCR amplified product by gel electrophoresis, and mixing with

-T Easy Vector ligation to construct T-Cre; xbaI, sacI double enzyme cuts T-Cre and pCV1300.

The enzyme digestion reaction system is as follows: 30. Mu.L of plasmid, 6. Mu.L of corresponding endonuclease cleavage buffer, 2. Mu.L of restriction endonuclease and 20. Mu.L of water.

The vector plasmid or PCR product is digested at the optimum temperature for the restriction enzyme used for about 12 hours. The product obtained after completion of the cleavage reaction was separated in 1% (v/w) agarose gel and the desired fragment was recovered for ligation.

The total volume of the ligation reaction was 20. Mu.L, and the ratio of the target gene to the vector was 15:2, T4DNA ligase 1U, and connecting for 12-16 h at 16 ℃; the vector map is shown in FIG. 4.

2. Transformed agrobacterium and strain preservation

C58C1 agrobacterium preserved at-70 ℃ is taken to be competent and put on ice for melting. mu.L of the purified pJM23, pJG102 and pCre plasmids were added to 100. Mu.L of competence, respectively, and the mixture was mixed and added to a treated cuvette. Setting 2.2V voltage, and performing electric shock conversion. Click complete addition of 900. Mu.L of liquid medium (YEP). Shaking culture was carried out at 28℃for 2 hours at 200rpm, the bacterial solution was spread on a plate containing 50. Mu.g/. Mu.L kanamycin (Kan) and 100. Mu.g/. Mu.L rifampicin (Rif), and cultured at 28℃until single colonies were formed. Single colonies of transformed agrobacteria were picked and inoculated into a liquid medium containing 50. Mu.g/. Mu.L Kan, 100. Mu.g/. Mu.L Rif, and shake cultured at 28℃for 16h at 200rpm, and 1. Mu.L of the bacterial liquid was taken for PCR detection. The nucleotide sequence of the pJM23 vector obtained by sequencing is shown as SEQ ID No.14, and the nucleotide sequence of the pJG102 vector is shown as SEQ ID No. 15. And (3) taking the bacterial liquid with positive detection result, mixing 15-30% of glycerol, placing the mixture into a glycerol pipe, and storing the mixture in an ultralow temperature refrigerator at the temperature of-70 ℃.

3. In vivo recombination of PMMoV-GFP invasive clone Cre-LoxP recombination system

Picking up pJM23, pJG102 and pCre, respectively, and inoculating the single spots to a YEP culture medium containing Kan (50 mg/L) and Rif (50 mg/L) resistance, and performing overnight shaking culture at 28 ℃; then transferring the strain to LB culture medium with the same resistance in proportion, growing to logarithmic phase (A600 value is about 0.6-0.8), centrifuging at 8000rpm/min for 5min, and collecting thalli; with MgCl at a final concentration of 10mM ₂ 10mM MES (pH 5.6), 200uM acetosyringone (Ace) was resuspended in sterile water and the bacterial suspension was adjusted to OD ₆₀₀ 1.0. Three vectors were prepared as pJM23: pJG102: pcr=1:0.5:0.5, and then left at room temperature for 3 hours or more. The mixed Agrobacterium solution was aspirated with a 1. Mu.L syringe (needle-free) for use. Selecting 4-6 pieces of real leaf Benshi cigarettes, and infiltrating and injecting bacterial liquid into leaf tissue gaps at the back of the leaves. 6-8 plants are injected into each treatment, and the infiltrated plants are placed in a dark place for 3-6 hours and then transferred to a greenhouse at 25 ℃ for culture (16-hour light/8-hour dark alternation). On day 6 after inoculation, the system leaves are observed under an ultraviolet lamp to generate obvious green fluorescence (shown in figure 5), which indicates that the GFP of the foreign protein is stably and highly expressed in the plant body.

4. System leaf recombinant virion identification

The system leaves were subjected to negative electron microscopy, and as can be seen from FIG. 5, baculovirus particles of about 300nm were present in the top leaf. Extracting total RNA by using Trizol, carrying out reverse transcription, carrying out PCR amplification on MP sequences of PMMoV, cutting a target strip, recovering the target strip, connecting T4 with pGEM-T vectors, carrying out overnight at 4 ℃, converting T1 escherichia coli competence, culturing overnight at 37 ℃, identifying single colonies by colony PCR, and picking positive clones for sequencing. Sequencing results showed that Intron cleavage in MP sequence was complete and that the green fluorescence of the top leaf was indeed generated by the Cre-LoxP recombinant PMMoV virions (FIG. 5). The result shows that the constructed PMMoV-GFP infectious clone has biological activity after Cre-LoxP recombination, can successfully infect Benshi smoke and can successfully express exogenous proteins.

Example 3: construction of a PMMoV-GFP infectious clone Cre-LoxP recombination System consisting of two vectors

In the embodiment, the total sequence and Cre sequence of PMMoV-GFP infectious clone are split and combined, so that the number of vectors of the Cre-LoxP recombination system is simplified, and the PMMoV-GFP infectious clone Cre-LoxP recombination system is constructed by the two vectors, and the specific steps are as follows:

1. the RdRp (p 126/p 183) and MP part sequence of PMMoV-GFP invasive cloning sequence are fused into pCB301 to construct a first vector, which is named pJM23, and contains a 35S promoter and a NOS terminator, the 3' end of which is introduced with an intron first half sequence (5'-gtaggtttcattttcataattacacaaatttagatttgatttttgtt-3') and a LoxP sequence (5'-ataacttcgtatagcatacattatacgaagttat-3'), and the nucleotide sequence of the pJM23 vector is shown as SEQ ID No. 14;

the 35S-Cre-RZ-NOS is fused into a pJG102 vector to construct a second vector, the second vector is named as pJG2303, the nucleotide sequence of the pJG2303 vector is shown as SEQ ID No.16, and the construction strategy and the vector map are shown as figure 6;

2. the construction process of the pJM23 vector and the pJG2303 vector is the same as that of example 2, wherein the base sequence of the primer constructed by the pJG2303 vector is shown in SEQ ID No. 17-SEQ ID No. 20;

in vivo recombination of PMMoV-GFP invasive clone Cre-LoxP recombination System

Picking up pJM23 and pJG2303, respectively, and inoculating the single spots to a YEP culture medium containing Kan (50 mg/L) and Rif (50 mg/L) resistance, and performing shake culture at 28 ℃ overnight; then transferring the strain to LB culture medium with the same resistance in proportion, growing to logarithmic phase (A600 value is about 0.6-0.8), centrifuging at 8000rpm/min for 5min, and collecting thalli; the bacterial suspension was resuspended in sterile water containing 10mM MgCl2, 10mM MES (pH 5.6), 200uM acetosyringone (Ace) and the bacterial suspension was adjusted to an OD600 of 1.0. Two vectors were combined as pJM23: pjg2303=1:1, and then allowed to stand at room temperature for 3 hours or more. The Agrobacterium solution was aspirated with a 1. Mu.L syringe (needle-free) for use. Selecting 4-6 pieces of real leaf Benshi cigarettes, and infiltrating and injecting bacterial liquid into leaf tissue gaps at the back of the leaves. 6-8 plants are injected into each treatment, and the infiltrated plants are placed in a dark place for 3-6 hours and then transferred to a greenhouse at 25 ℃ for culture (16-hour light/8-hour dark alternation). On day 8 after inoculation, obvious green fluorescence appears on the system leaves as observed under an ultraviolet lamp, and baculovirus particles are found as observed under a negative electron microscope (figure 7), which shows that the constructed PMMoV-GFP invasive clone has biological activity after Cre-LoxP recombination, can successfully infect Benshi smoke and can successfully express exogenous proteins. The PMMoV-GFP infectious clone Cre-LoxP recombination system constructed by the method can also recombine to generate PMMoV-GFP infectious virus particles.

Example 4: application of PMMoV-GFP invasive clone Cre-LoxP recombination system

This example illustrates the use of the Cre-LoxP recombination system for the infectious clone PMMoV-GFP by taking the example of replacing the CP gene of PMMoV in pJG102 vector with that of tobacco mosaic virus (Tobacco mosaic virus, TMV).

pJG102-Rep vector fragment and the CP fragment of TMV to be replaced were amplified using high fidelity enzyme (commercially available) with pJG102-Rep f/r and Rep-TMV f/r as primers, the base sequences of which are shown in Table 2, and the PCR amplification reaction system and procedure were as described in example 2. And directly recombining the recovered PCR product by using a ClonExpress recombination kit of Vazyme, directly performing heat shock conversion after reacting for 30min, and selecting monoclonal PCR for detection to obtain the modified pJG102 vector (the CP gene of PMMoV is replaced by the CP gene of TMV). Positive clone extraction plasmid agrobacterium tumefaciens in vivo recombination of PMMoV-GFP invasive clone Cre-LoxP recombination system was performed as described in step 3 of example 2. As can be seen from FIG. 8, the leaf of Benshi tobacco fluoresces after 7 days of inoculation, and baculovirus particles are found by negative electron microscope observation, which shows that after the modified pJG102 vector and pJM23 vector and pCre vector are transformed together by using an agrobacterium-mediated method, virus particles with infection activity are produced by recombination, thereby showing that the infectious clone Cre-LoxP recombination system can be used for researching the functions of the Tobamovirus virus genes.

The successful transformation of the vector only needs 2 days, and the construction time is greatly shortened. Taking the Tobamovirus virus CP study as an example, the laboratory constructs a PMMoV-GFP vector comprising a pCB301 vector and a PMMoV-GFP sequence, wherein the sizes of the PMMoV-GFP vector and the PMMoV-GFP sequence are 4591bp and 7504bp respectively, and the total size of the PMMoV-GFP is 12095bp, the PMMoV-GFP fragments are connected in a segmented manner (3-4 segments) by utilizing a proper enzyme cutting site in a traditional double enzyme cutting construction mode, the T vector containing the fragments is subjected to multiple enzyme cutting connection after the T vector is constructed, 3 days are required for one enzyme cutting connection, and the construction of the modified PMMoV-GFP is smoothly completed in 9-12 days; if ClonExpress MultiS One Step Cloning Kit of Vazyme is used, PMMoV-GFP needs to be split into 3 segments for recombination (but the gene containing CP needs to be replaced by nested PCR to construct a T vector and then used as a template for PCR amplification), each transformation needs to carry out multi-segment recombination of which the sizes of PCR products are about 4.5kb, 2.5kb and 2.5kb, and the recombination time is only 2 days, but the recombination efficiency of a plurality of large segments is lower than that of a small segment recombination, repeated experiments can be needed to be carried out successfully, and the construction of the transformed PMMoV-GFP can be completed successfully and takes about 2 to 8 days. The CP gene sequence of the pJG102 can be replaced directly based on the pJG102, the pJG102-Rep f/r and the sequence Rep-TMV f/r needing to be replaced are designed, recombination is directly carried out through ClonExpress II One Step Cloning Kit of Vazyme, fragment recombination of about 5.5kb and 500bp is completed, the construction can be completed almost once, and the construction can be completed in 2 days, so that the transformation time and cost are greatly saved.

The invention can realize the replacement of the CP gene by modifying the pJG102 vector without using the PMMoV complete sequence, thereby greatly reducing the modification difficulty and being convenient for researching the functions of the Tobamovirus virus genes.

TABLE 2 primer sequence listing

Primer name	Primer sequences	SEQ ID No.
			pJG102-Rep f	ACATGATGGTGTAAATAAGTTGG	SEQ ID No.21
pJG102-Rep r	AGTTAAAACGTACTCGATGACG	SEQ ID No.22
			Rep-TMV f	CGTCATCGAGTACGTTTTAACTATGCCTTATACAATCAACTCTC	SEQ ID No.23
Rep-TMV r	CCAACTTATTTACACCATCATGTCTAAGTAGCCGGAGTTGTGG	SEQ ID No.24

In summary, by using the Cre-LoxP recombination system of the PMMoV-GFP invasive clone provided by the invention, the transformation such as gene replacement can be performed by using each split vector of the recombination system, and the transformation by using the whole sequence of the PMMoV is not needed, so that the difficulty of gene transformation is greatly reduced. The invention provides a method for simply and effectively carrying out genetic modification and reconstruction on a target genome, the recombination system provided by the invention can effectively shorten the time of gene reconstruction, greatly save related reagent consumables and reconstruction cost, and carry out functional research on related genes by utilizing the system so as to promote development of related gene functions.

Sequence listing

<110> university of Ningbo, national academy of agricultural sciences of Zhejiang province

<120> Cre-LoxP recombination system for infectious clone of pepper light mottle virus and application thereof

<130> 18-100070-00005262

<141> 2018-05-30

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 7504

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gtaaattttt cacaatttaa caacaacaac acaaacaaca aacaacatta caaacaaatt 60

acaactacaa tggcttacac acaacaagct accaacgccg cattagcaag tactctccga 120

gggaacaacc ccttggtgaa cgatcttgct aatcggagac tgtacgaatc agcggtcgaa 180

caatgcaatg cacatgaccg caggcccaag gttaattttt taaggtcgat aagcgaagag 240

cagacgctta tcgcaactaa ggcctaccct gagttccaaa ttacgttcta caacacgcag 300

aacgctgtgc acagtctcgc aggtggactt cggtctttgg aactagaata cttgatgatg 360

cagatcccct atggttcaac gacatacgat atcgggggaa attttgctgc tcacatgttt 420

aaaggtcgtg actacgttca ttgttgcatg cctaatatgg acttacgtga cgtcatgcgt 480

cacaatgctc aaaaggatag cattgaactg tacctttcaa agcttgcgca aaagaaaaag 540

gtaataccgc catatcaaaa gccagtcttt gataaataca cggacgatcc gcaatcggta 600

gtgtgctcga aacctttcca gcactgcgaa ggcgtttcgc actgcacgga taaagtatac 660

gctgtcgctt tgcacagttt atacgacatt ccagcagatg aatttggtgc agcacttctg 720

aggagaaatg ttcatgtctg ttatgctgcc ttccactttt ctgagaatct tcttttagaa 780

gattcgtatg ttagtcttga cgacataggc gctttcttct cgagagaggg tgatatgttg 840

aacttttcct ttgtagcaga gagtacttta aattatactc attcctatag taatgtgctt 900

aagtatgtgt gtaagactta cttccccgct tctagtagag aagtgtacat gaaggagttt 960

ttggtaacta gggtaaatac ttggttttgt aagttttcaa ggttagatac ctttgtacta 1020

tatagaggtg tgtaccacag aggtgtagac aaggagcaat tttatagtgc aatggaagat 1080

gcttggcatt acaaaaagac tttggcgatg atgaatagcg aaaggatcct cttggaggat 1140

tcatcgtctg ttaattattg gtttccaaag atgaaagata tggtgatagt acctttgttc 1200

gacgtatctt tacagaacga ggggaaaagg ttagcaagaa aggaggttat ggtcagcaag 1260

gacttcgttt atactgtgct taatcatatt cgcacatacc agtcgaaagc gcttacttac 1320

gccaatgtat tatcgttcgt tgagtcgata agatcaagag tgataattaa tggggtgact 1380

gctcgctcag agtgggatgt ggacaaggct ttgttgcagt ctctgtcaat gacctttttc 1440

ttgcagacca aattggccat gctcaaagat gacctcgtgg ttcaaaaatt tcaagtgcat 1500

tctaaatcgc tcactgaata tgtctgggat gagattactg ccgcttttca caactgtttt 1560

cctacaatca aggagaggtt gattaacaag aaactcataa ctgtttcgga aaaggctctt 1620

gaaattaaag tacctgactt atatgtgact ttccacgaca gattagttaa agagtacaag 1680

tcttcagtgg aaatgccggt actggacgtt aaaaagagct tggaagaagc ggaagtgatg 1740

tacaatgctt tgtcagaaat ctcaattctt aaggatagtg acaagtttga tgttgatgtt 1800

ttttcccgaa tgtgtaatac tttaggcgta gatccattgg tggcagcaaa ggtaatggta 1860

gccgtggttt caaatgagag tggtttgacc ttaacgtttg agcggcctac cgaagcaaat 1920

gtcgcacttg cattgcaacc gacaattgca tcaaaggagg aaggttcatt aaagattgtg 1980

tcgtcagacg taggtgagtc ctcaatcaag gaagtggtcc gaaaatcgga gatttctatg 2040

ctaggtctaa caggcagcac agtgtccgat gagttccaaa gaagtacaga aatcgagtcg 2100

ttgcagcagt tccatatggt atccacagag acgattatcc gtaaacagat gcatgcgatg 2160

gtgtatactg gtccgctaaa agttcaacaa tgcaagaact atttagacag cctagtagcc 2220

tcgctctctg ctgcggtatc aaacctgaag aagataatca aggacacagc tgcgatagat 2280

ctcgagacta aggaaaaatt tggagtctac gacgtgtgcc ttaagaaatg gttggtgaaa 2340

cctcaatcga aaggacatgc ttggggtgtg gtgatggact cagactataa gtgctttgta 2400

gcgcttctca catacgatgg cgagaacatt gtgtgcggag agacatggcg tagagtcgca 2460

gtgagctccg aatctttggt gtattcagat atggggaaga taagagctat acgctcagtg 2520

cttaaagacg gtgaacccca tataagtagt gcaaaggtta cacttgttga tggtgttcca 2580

ggttgcggga agacaaagga gattctttcg agggtcaact ttgacgaaga tctggttcta 2640

gtaccaggaa aacaggctgc cgaaatgata aaaagaagag caaacagttc tggtttaatc 2700

gtggcgacca aggagaacgt aaggacggta gactctttct taatgaatta cggtcgaggt 2760

ccgtgccaat acaaaaggct gtttctggat gaaggtctaa tgttacaccc cggttgtgtt 2820

aattttctgg ttggcatgtc tctatgctcc gaggcttttg tttatggaga cacccagcag 2880

attccttaca tcaacagagt tgcaactttt ccctatccta agcatttgag tcaactcgag 2940

gtcgatgctg ttgagactcg cagaacaaca ttgcggtgtc cggctgatat caccttcttc 3000

ttgaatcaga agtacgaagg gcaagttatg tgcacatcaa gtgttacacg ctcggtgtca 3060

cacgaggtca tccaaggtgc agcagtaatg aatccagtgt ctaaaccact taaagggaag 3120

gtgattacat tcactcaatc agacaagtca ttgctgctct caaggggtta cgaagatgtg 3180

cataccgttc atgaggtgca aggggaaacg tttgaagacg tctcattagt gagattgacg 3240

cctacacccg tgggaataat ttcaaagcag agtccgcacc tgttggtctc gttgtctagg 3300

catacaaggt caatcaaata ttacactgtt gtactagatg cagtcgtttc agtgcttaga 3360

gatttggagt gtgtgagtag ttacctgtta gatatgtaca aagttgatgt gtcgactcaa 3420

tagcaattac agatagaatc ggtgtacaaa ggtgttaacc ttttcgtcgc agccccgaaa 3480

acaggagatg tttctgacat gcaatattac tatgacaagt gtttgccggg aaacagtact 3540

atacttaatg agtatgatgc tgtaactatg caaatacgag aaaataattt gaatgtcaag 3600

gattgtgtgt tggatatgtc gaagtcggtg cctcttccga gagaatctga gacgacattg 3660

aaacctgtga tcaggactgc tgctgaaaaa cctcgaaaac ctggattgtt ggaaaacttg 3720

gtcgcgatga tcaaaagaaa tttcaactct cccgaattaa taggggtcgt cgacatcgaa 3780

gacaccgctt ctctagtagt agataagttt tttgatgcat actttattaa agaaaagaaa 3840

aaacctaaaa atatacctct gctttcaagg gcgagtttgg aaagatggat agaaaagcaa 3900

gaaaagtcga cgattggcca gttggctgat tttgacttta ttgatcttcc agccgttgat 3960

caatataggc acatgatcaa gcagcagccg aaacagcgtc tagatcttag tattcaaact 4020

gaatacccgg ctttgcaaac tattgtgtat catagcaaga aaatcaatgc gctttttggt 4080

cctgtatttt cagaattaac aagacaactg ctagagtcaa ttgacagttc gagattcatg 4140

ttttatacaa ggaaaacgcc tacacagatc gaagagtttt tctcagatct ggactctaat 4200

gttcctatgg acatattaga gctggacatt tccaagtatg acaaatcaca gaacgaattt 4260

cattgtgcag ttgagtatga gatttggaaa aggttaggct tagacgattt cttggccgaa 4320

gtttggaaac acgggcatcg gaagacaacg ttgaaagact acacagccgg aataaaaacg 4380

tgtttgtggt atcaaaggaa aagtggtgat gtcaccacat tcattggaaa cacgatcatt 4440

attgctgcat gtctgtcctc tatgctaccg atggagagat tgattaaagg tgccttttgt 4500

ggtgatgata gtatactata ctttccaaag ggcactgatt tccctgatat tcaacagggt 4560

gcaaatcttc tctggaattt tgaagccaag ttgttcagga agagatatgg ttacttttgc 4620

ggtaggtaca taatccacca tgacagaggt tgtattgtat attatgaccc tctaaaattg 4680

atctcgaaac tcggtgctaa acacatcaag aatagagaac atttagagga atttagaacc 4740

tctctttgtg atgttgctgg gtcgttgaac aattgtgcgt actatacaca tttggacgac 4800

gctgtcggtg aggttattaa aaccgcacct cctggttcgt ttgtttatag agcattagtt 4860

aagtacttgt gtgataaaag gttgtttcaa acattgtttc tggaataaat ggcgttagta 4920

gtcaaggatg acgttaagat ttctgagttc atcaatttgt ctaccgctga gaaattctta 4980

cctgctgtta tgacttcggt caagacggta cgaatttcga aagttgacaa agtgattgca 5040

atggaaaacg attcgttatc cgatgtagat ttgcttaaag gtgttaagct tgttaaagat 5100

ggttatgtgt gtttggcagg gttagttgtg tccggggagt ggaacctacc ggacaactgc 5160

agaggtggag taagcgtttg tttggttgac aagagaatgc aaagagatga cgaagcaaca 5220

cttggatctt atagaaccag tgcggctaag aaacgatttg ccttcaaatt gatcccgaat 5280

tatagcatta ctaccgccga tgctgagaga aatgtttggc aagttttagt taatattaga 5340

ggtgttgcca tggaaaaggg tttctgtcct ttatctttgg agtttgtctc agtttgtatt 5400

gtacacaaat ccaatataaa attaggcttg agagagaaaa ttactagtgt gtcggaagga 5460

ggacccgttg aacttacaga agcagttgtt gatgagttca tcgaatcagt tccaatggct 5520

gacagattac gtaaatttcg caatcaatcc aagaaaagaa gtaataagta tgtaggtaag 5580

agaaatgata ataagggtgt gaataaggaa aggaagctgt ttgataaggt tagaattggg 5640

cagaactcgg agtcatcgga cgccgagtct tcttcgtttt aactatgaag actaatcttt 5700

ttctctttct catcttttca cttctcctat cattatcctc ggccgaattc agtaaaggag 5760

aagaactttt cactggagtt gtcccaattc ttgttgaatt agatggtgat gttaatgggc 5820

acaaattttc tgtcagtgga gagggtgaag gtgatgcaac atacggaaaa cttaccctta 5880

aatttatttg cactactgga aaactacctg ttccatggcc aacacttgtc actactttct 5940

cttatggtgt tcaatgcttt tcaagatacc cagatcatat gaagcggcac gacttcttca 6000

agagcgccat gcctgaggga tacgtgcagg agaggaccat cttcttcaag gacgacggga 6060

actacaagac acgtgctgaa gtcaagtttg agggagacac cctcgtcaac aggatcgagc 6120

ttaagggaat cgatttcaag gaggacggaa acatcctcgg ccacaagttg gaatacaact 6180

acaactccca caacgtatac atcatggccg acaagcaaaa gaacggcatc aaagccaact 6240

tcaagacccg ccacaacatc gaagacggcg gcgtgcaact cgctgatcat tatcaacaaa 6300

atactccaat tggcgatggc cctgtccttt taccagacaa ccattacctg tccacacaat 6360

ctgccctttc gaaagatccc aacgaaaaga gagaccacat ggtccttctt gagtttgtaa 6420

cagctgctgg gattacacat ggcatggatg aactatacaa acatgatgag ctttaactcg 6480

aggggtagtc aagatgcata ataaataacg gattgtgtcc gtaatcacac gtggtgcgta 6540

cgataacgca tagtgttttt ccctccactt aaatcgaagg gttgtgtctt ggatcgcgcg 6600

ggtcaaatgt atatggttca tatacatccg caggcacgta ataaagcgag gggttcgggt 6660

cgaggtcggc tgtgaaactc gaaaaggttc cggaaaacaa aaaagagagt ggtaggtaat 6720

agtgttaata ataagaaaat aaataatagt ggtaagaaag gtttgaaagt tgaggaaatt 6780

gaggataatg taagtgatga cgagtctatc gcgtcatcga gtacgtttta actatggctt 6840

acacagtttc cagtgccaat caattagtgt atttaggttc tgtatgggcc gatccattag 6900

agttacaaaa tctatgtact tcggcgttag gtaatcagtt tcaaacacag caggctagaa 6960

ctacggttca acagcagttc tctgatgtgt ggaagactat accgaccgct acagttagat 7020

ttcccgctac tggtttcaaa gttttccgat ataatgccgt gctagattct ctagtgtcgg 7080

cacttctcgg agcctttgat actaggaata ggataataga agtagaaaat ccgcaaaatc 7140

ctacaactgc cgagacgctt gatgcgacga ggcgggtaga tgatgcgacg gtggccatta 7200

gggccagtat aagtaacctc atgaatgagt tagttcgtgg cacgggaatg tacaatcaag 7260

ctctgttcga gagcgcgagt ggactcacct gggctacaac tccttagaca tgatggtgta 7320

aataagttgg acgaacgtta aacgtccgtg gcgagtacga taactcgtag tgtttttccc 7380

tccacttaaa tcgaagggtt gtcgttagga tggaacgcaa ttaaatacat gtgtgacgtg 7440

tatttgcgaa cgacgtaatt attttcaggg gttcgaatcc cccccgaacc gcgggtagcg 7500

gccc 7504

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gggtcggcat ggcatctc 18

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cctctccaaa tgaaatgaac tt 22

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gttcatttca tttggagagg gtaaattttt cacaatttaa caaca 45

<210> 5

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gaaaagttgc aactctgttg atgtaaggaa tctgctgggt gt 42

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

acacccagca gattccttac atcaacagag ttgcaacttt tc 42

<210> 7

<211> 124

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gtggagatgc catgccgacc cataacttcg tataatgtat gctatacgaa gttataacaa 60

aaatcaaatc taaatttgtg taattatgaa aatgaaacct accttatcaa acagcttcct 120

ttcc 124

<210> 8

<211> 132

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tttcaacaaa gggtaatatc ggataacttc gtatagcata cattatacga agttattttt 60

attacatgtt tgaacttcaa caatttatga ctttttgttc ttattgttgc aggttagaat 120

tgggcagaac tc 132

<210> 9

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gtggagatgc catgccgacc cgggccgcta cccgcggt 38

<210> 10

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gtctagaatg tccaatttac tgaccgtac 29

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ggagctctta atcgccatct tccagcag 28

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

gggtcggcat ggcatctc 18

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ccgatattac cctttgttga aa 22

<210> 14

<211> 5709

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gtaaattttt cacaatttaa caacaacaac acaaacaaca aacaacatta caaacaaatt 60

acaactacaa tggcttacac acaacaagct accaacgccg cattagcaag tactctccga 120

gggaacaacc ccttggtgaa cgatcttgct aatcggagac tgtacgaatc agcggtcgaa 180

caatgcaatg cacatgaccg caggcccaag gttaattttt taaggtcgat aagcgaagag 240

cagacgctta tcgcaactaa ggcctaccct gagttccaaa ttacgttcta caacacgcag 300

aacgctgtgc acagtctcgc aggtggactt cggtctttgg aactagaata cttgatgatg 360

cagatcccct atggttcaac gacatacgat atcgggggaa attttgctgc tcacatgttt 420

aaaggtcgtg actacgttca ttgttgcatg cctaatatgg acttacgtga cgtcatgcgt 480

cacaatgctc aaaaggatag cattgaactg tacctttcaa agcttgcgca aaagaaaaag 540

gtaataccgc catatcaaaa gccagtcttt gataaataca cggacgatcc gcaatcggta 600

gtgtgctcga aacctttcca gcactgcgaa ggcgtttcgc actgcacgga taaagtatac 660

gctgtcgctt tgcacagttt atacgacatt ccagcagatg aatttggtgc agcacttctg 720

aggagaaatg ttcatgtctg ttatgctgcc ttccactttt ctgagaatct tcttttagaa 780

gattcgtatg ttagtcttga cgacataggc gctttcttct cgagagaggg tgatatgttg 840

aacttttcct ttgtagcaga gagtacttta aattatactc attcctatag taatgtgctt 900

aagtatgtgt gtaagactta cttccccgct tctagtagag aagtgtacat gaaggagttt 960

ttggtaacta gggtaaatac ttggttttgt aagttttcaa ggttagatac ctttgtacta 1020

tatagaggtg tgtaccacag aggtgtagac aaggagcaat tttatagtgc aatggaagat 1080

gcttggcatt acaaaaagac tttggcgatg atgaatagcg aaaggatcct cttggaggat 1140

tcatcgtctg ttaattattg gtttccaaag atgaaagata tggtgatagt acctttgttc 1200

gacgtatctt tacagaacga ggggaaaagg ttagcaagaa aggaggttat ggtcagcaag 1260

gacttcgttt atactgtgct taatcatatt cgcacatacc agtcgaaagc gcttacttac 1320

gccaatgtat tatcgttcgt tgagtcgata agatcaagag tgataattaa tggggtgact 1380

gctcgctcag agtgggatgt ggacaaggct ttgttgcagt ctctgtcaat gacctttttc 1440

ttgcagacca aattggccat gctcaaagat gacctcgtgg ttcaaaaatt tcaagtgcat 1500

tctaaatcgc tcactgaata tgtctgggat gagattactg ccgcttttca caactgtttt 1560

cctacaatca aggagaggtt gattaacaag aaactcataa ctgtttcgga aaaggctctt 1620

gaaattaaag tacctgactt atatgtgact ttccacgaca gattagttaa agagtacaag 1680

tcttcagtgg aaatgccggt actggacgtt aaaaagagct tggaagaagc ggaagtgatg 1740

tacaatgctt tgtcagaaat ctcaattctt aaggatagtg acaagtttga tgttgatgtt 1800

ttttcccgaa tgtgtaatac tttaggcgta gatccattgg tggcagcaaa ggtaatggta 1860

gccgtggttt caaatgagag tggtttgacc ttaacgtttg agcggcctac cgaagcaaat 1920

gtcgcacttg cattgcaacc gacaattgca tcaaaggagg aaggttcatt aaagattgtg 1980

tcgtcagacg taggtgagtc ctcaatcaag gaagtggtcc gaaaatcgga gatttctatg 2040

ctaggtctaa caggcagcac agtgtccgat gagttccaaa gaagtacaga aatcgagtcg 2100

ttgcagcagt tccatatggt atccacagag acgattatcc gtaaacagat gcatgcgatg 2160

gtgtatactg gtccgctaaa agttcaacaa tgcaagaact atttagacag cctagtagcc 2220

tcgctctctg ctgcggtatc aaacctgaag aagataatca aggacacagc tgcgatagat 2280

ctcgagacta aggaaaaatt tggagtctac gacgtgtgcc ttaagaaatg gttggtgaaa 2340

cctcaatcga aaggacatgc ttggggtgtg gtgatggact cagactataa gtgctttgta 2400

gcgcttctca catacgatgg cgagaacatt gtgtgcggag agacatggcg tagagtcgca 2460

gtgagctccg aatctttggt gtattcagat atggggaaga taagagctat acgctcagtg 2520

cttaaagacg gtgaacccca tataagtagt gcaaaggtta cacttgttga tggtgttcca 2580

ggttgcggga agacaaagga gattctttcg agggtcaact ttgacgaaga tctggttcta 2640

gtaccaggaa aacaggctgc cgaaatgata aaaagaagag caaacagttc tggtttaatc 2700

gtggcgacca aggagaacgt aaggacggta gactctttct taatgaatta cggtcgaggt 2760

ccgtgccaat acaaaaggct gtttctggat gaaggtctaa tgttacaccc cggttgtgtt 2820

aattttctgg ttggcatgtc tctatgctcc gaggcttttg tttatggaga cacccagcag 2880

attccttaca tcaacagagt tgcaactttt ccctatccta agcatttgag tcaactcgag 2940

gtcgatgctg ttgagactcg cagaacaaca ttgcggtgtc cggctgatat caccttcttc 3000

ttgaatcaga agtacgaagg gcaagttatg tgcacatcaa gtgttacacg ctcggtgtca 3060

cacgaggtca tccaaggtgc agcagtaatg aatccagtgt ctaaaccact taaagggaag 3120

gtgattacat tcactcaatc agacaagtca ttgctgctct caaggggtta cgaagatgtg 3180

cataccgttc atgaggtgca aggggaaacg tttgaagacg tctcattagt gagattgacg 3240

cctacacccg tgggaataat ttcaaagcag agtccgcacc tgttggtctc gttgtctagg 3300

catacaaggt caatcaaata ttacactgtt gtactagatg cagtcgtttc agtgcttaga 3360

gatttggagt gtgtgagtag ttacctgtta gatatgtaca aagttgatgt gtcgactcaa 3420

tagcaattac agatagaatc ggtgtacaaa ggtgttaacc ttttcgtcgc agccccgaaa 3480

acaggagatg tttctgacat gcaatattac tatgacaagt gtttgccggg aaacagtact 3540

atacttaatg agtatgatgc tgtaactatg caaatacgag aaaataattt gaatgtcaag 3600

gattgtgtgt tggatatgtc gaagtcggtg cctcttccga gagaatctga gacgacattg 3660

aaacctgtga tcaggactgc tgctgaaaaa cctcgaaaac ctggattgtt ggaaaacttg 3720

gtcgcgatga tcaaaagaaa tttcaactct cccgaattaa taggggtcgt cgacatcgaa 3780

gacaccgctt ctctagtagt agataagttt tttgatgcat actttattaa agaaaagaaa 3840

aaacctaaaa atatacctct gctttcaagg gcgagtttgg aaagatggat agaaaagcaa 3900

gaaaagtcga cgattggcca gttggctgat tttgacttta ttgatcttcc agccgttgat 3960

caatataggc acatgatcaa gcagcagccg aaacagcgtc tagatcttag tattcaaact 4020

gaatacccgg ctttgcaaac tattgtgtat catagcaaga aaatcaatgc gctttttggt 4080

cctgtatttt cagaattaac aagacaactg ctagagtcaa ttgacagttc gagattcatg 4140

ttttatacaa ggaaaacgcc tacacagatc gaagagtttt tctcagatct ggactctaat 4200

gttcctatgg acatattaga gctggacatt tccaagtatg acaaatcaca gaacgaattt 4260

cattgtgcag ttgagtatga gatttggaaa aggttaggct tagacgattt cttggccgaa 4320

gtttggaaac acgggcatcg gaagacaacg ttgaaagact acacagccgg aataaaaacg 4380

tgtttgtggt atcaaaggaa aagtggtgat gtcaccacat tcattggaaa cacgatcatt 4440

attgctgcat gtctgtcctc tatgctaccg atggagagat tgattaaagg tgccttttgt 4500

ggtgatgata gtatactata ctttccaaag ggcactgatt tccctgatat tcaacagggt 4560

gcaaatcttc tctggaattt tgaagccaag ttgttcagga agagatatgg ttacttttgc 4620

ggtaggtaca taatccacca tgacagaggt tgtattgtat attatgaccc tctaaaattg 4680

atctcgaaac tcggtgctaa acacatcaag aatagagaac atttagagga atttagaacc 4740

tctctttgtg atgttgctgg gtcgttgaac aattgtgcgt actatacaca tttggacgac 4800

gctgtcggtg aggttattaa aaccgcacct cctggttcgt ttgtttatag agcattagtt 4860

aagtacttgt gtgataaaag gttgtttcaa acattgtttc tggaataaat ggcgttagta 4920

gtcaaggatg acgttaagat ttctgagttc atcaatttgt ctaccgctga gaaattctta 4980

cctgctgtta tgacttcggt caagacggta cgaatttcga aagttgacaa agtgattgca 5040

atggaaaacg attcgttatc cgatgtagat ttgcttaaag gtgttaagct tgttaaagat 5100

ggttatgtgt gtttggcagg gttagttgtg tccggggagt ggaacctacc ggacaactgc 5160

agaggtggag taagcgtttg tttggttgac aagagaatgc aaagagatga cgaagcaaca 5220

cttggatctt atagaaccag tgcggctaag aaacgatttg ccttcaaatt gatcccgaat 5280

tatagcatta ctaccgccga tgctgagaga aatgtttggc aagttttagt taatattaga 5340

ggtgttgcca tggaaaaggg tttctgtcct ttatctttgg agtttgtctc agtttgtatt 5400

gtacacaaat ccaatataaa attaggcttg agagagaaaa ttactagtgt gtcggaagga 5460

ggacccgttg aacttacaga agcagttgtt gatgagttca tcgaatcagt tccaatggct 5520

gacagattac gtaaatttcg caatcaatcc aagaaaagaa gtaataagta tgtaggtaag 5580

agaaatgata ataagggtgt gaataaggaa aggaagctgt ttgataaggt aggtttcatt 5640

ttcataatta cacaaattta gatttgattt ttgttataac ttcgtatagc atacattata 5700

cgaagttat 5709

<210> 15

<211> 1966

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

ataacttcgt atagcataca ttatacgaag ttatttttat tacatgtttg aacttcaaca 60

atttatgact ttttgttctt attgttgcag gttagaattg ggcagaactc ggagtcatcg 120

gacgccgagt cttcttcgtt ttaactatga agactaatct ttttctcttt ctcatctttt 180

cacttctcct atcattatcc tcggccgaat tcagtaaagg agaagaactt ttcactggag 240

ttgtcccaat tcttgttgaa ttagatggtg atgttaatgg gcacaaattt tctgtcagtg 300

gagagggtga aggtgatgca acatacggaa aacttaccct taaatttatt tgcactactg 360

gaaaactacc tgttccatgg ccaacacttg tcactacttt ctcttatggt gttcaatgct 420

tttcaagata cccagatcat atgaagcggc acgacttctt caagagcgcc atgcctgagg 480

gatacgtgca ggagaggacc atcttcttca aggacgacgg gaactacaag acacgtgctg 540

aagtcaagtt tgagggagac accctcgtca acaggatcga gcttaaggga atcgatttca 600

aggaggacgg aaacatcctc ggccacaagt tggaatacaa ctacaactcc cacaacgtat 660

acatcatggc cgacaagcaa aagaacggca tcaaagccaa cttcaagacc cgccacaaca 720

tcgaagacgg cggcgtgcaa ctcgctgatc attatcaaca aaatactcca attggcgatg 780

gccctgtcct tttaccagac aaccattacc tgtccacaca atctgccctt tcgaaagatc 840

ccaacgaaaa gagagaccac atggtccttc ttgagtttgt aacagctgct gggattacac 900

atggcatgga tgaactatac aaacatgatg agctttaact cgaggggtag tcaagatgca 960

taataaataa cggattgtgt ccgtaatcac acgtggtgcg tacgataacg catagtgttt 1020

ttccctccac ttaaatcgaa gggttgtgtc ttggatcgcg cgggtcaaat gtatatggtt 1080

catatacatc cgcaggcacg taataaagcg aggggttcgg gtcgaggtcg gctgtgaaac 1140

tcgaaaaggt tccggaaaac aaaaaagaga gtggtaggta atagtgttaa taataagaaa 1200

ataaataata gtggtaagaa aggtttgaaa gttgaggaaa ttgaggataa tgtaagtgat 1260

gacgagtcta tcgcgtcatc gagtacgttt taactatggc ttacacagtt tccagtgcca 1320

atcaattagt gtatttaggt tctgtatggg ccgatccatt agagttacaa aatctatgta 1380

cttcggcgtt aggtaatcag tttcaaacac agcaggctag aactacggtt caacagcagt 1440

tctctgatgt gtggaagact ataccgaccg ctacagttag atttcccgct actggtttca 1500

aagttttccg atataatgcc gtgctagatt ctctagtgtc ggcacttctc ggagcctttg 1560

atactaggaa taggataata gaagtagaaa atccgcaaaa tcctacaact gccgagacgc 1620

ttgatgcgac gaggcgggta gatgatgcga cggtggccat tagggccagt ataagtaacc 1680

tcatgaatga gttagttcgt ggcacgggaa tgtacaatca agctctgttc gagagcgcga 1740

gtggactcac ctgggctaca actccttaga catgatggtg taaataagtt ggacgaacgt 1800

taaacgtccg tggcgagtac gataactcgt agtgtttttc cctccactta aatcgaaggg 1860

ttgtcgttag gatggaacgc aattaaatac atgtgtgacg tgtatttgcg aacgacgtaa 1920

ttattttcag gggttcgaat cccccccgaa ccgcgggtag cggccc 1966

<210> 16

<211> 4239

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

gaaacctcct cggattccat tgcccagcta tctgtcactt catcgaaagg acagtagaaa 60

aggaagatgg cttctacaaa tgccatcatt gcgataaagg aaaggctatc gttcaaagaa 120

tgcctctacc gacagtggtc ccaaagatgg accccccacc cacgaggaac atcgtggaaa 180

aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgataac atggtggagc 240

acgacactct cgtctactcc aagaatatca aagatacagt ctcagaagac cagagggcta 300

ttgagacttt caacaaaggg taatatcggg aaacctcctc ggattccatt gcccagctat 360

ctgtcacttc atcgaaagga cagtagaaaa ggaagatggc ttctacaaat gccatcattg 420

cgataaagga aaggctatcg ttcaagaatg cctctaccga cagtggtccc aaagatggac 480

ccccacccac gaggaacatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag 540

tggattgatg tgatatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc 600

aagacccttc ctctatataa ggaagttcat ttcatttgga gaggatgtcc aatttactga 660

ccgtacacca aaatttgcct gcattaccgg tcgatgcaac gagtgatgag gttcgcaaga 720

acctgatgga catgttcagg gatcgccagg cgttttctga gcatacctgg aaaatgcttc 780

tgtccgtttg ccggtcgtgg gcggcatggt gcaagttgaa taaccggaaa tggtttcccg 840

cagaacctga agatgttcgc gattatcttc tatatcttca ggcgcgcggt ctggcagtaa 900

aaactatcca gcaacatttg ggccagctaa acatgcttca tcgtcggtcc gggctgccac 960

gaccaagtga cagcaatgct gtttcactgg ttatgcggcg gatccgaaaa gaaaacgttg 1020

atgccggtga acgtgcaaaa caggctctag cgttcgaacg cactgatttc gaccaggttc 1080

gttcactcat ggaaaatagc gatcgctgcc aggatatacg taatctggca tttctgggga 1140

ttgcttataa caccctgtta cgtatagccg aaattgccag gatcagggtt aaagatatct 1200

cacgtactga cggtgggaga atgttaatcc atattggcag aacgaaaacg ctggttagca 1260

ccgcaggtgt agagaaggca cttagcctgg gggtaactaa actggtcgag cgatggattt 1320

ccgtctctgg tgtagctgat gatccgaata actacctgtt ttgccgggtc agaaaaaatg 1380

gtgttgccgc gccatctgcc accagccagc tatcaactcg cgccctggaa gggatttttg 1440

aagcaactca tcgattgatt tacggcgcta aggatgactc tggtcagaga tacctggcct 1500

ggtctggaca cagtgcccgt gtcggagccg cgcgagatat ggcccgcgct ggagtttcaa 1560

taccggagat catgcaagct ggtggctgga ccaatgtaaa tattgtcatg aactatatcc 1620

gtaacctgga tagtgaaaca ggggcaatgg tgcgcctgct ggaagatggc gatcggctct 1680

tctcctcact cgaccagatc tcgtacgcgt cccggggcgg tggctcatct ggcggaggtc 1740

tcgacgggtt aattaacggt gaacaaaagc taatctccga ggaagacttg aacggtgaac 1800

aaaaattaat ctcagaagaa gacttgaacg gactcgacgg tgaacaaaag ttgatttctg 1860

aagaagattt gaacggtgaa caaaagctaa tctccgagga agacttgaac ggtagcgctt 1920

aggggtcggc atggcatctc cacctcctcg cggtccgacc tgggcatccg aaggaggacg 1980

tcgtccactc ggatggctaa gggagagctc gaatttcccc gatcgttcaa acatttggca 2040

ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 2100

gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 2160

ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 2220

gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcataactt 2280

cgtatagcat acattatacg aagttatttt tattacatgt ttgaacttca acaatttatg 2340

actttttgtt cttattgttg caggttagaa ttgggcagaa ctcggagtca tcggacgccg 2400

agtcttcttc gttttaacta tgaagactaa tctttttctc tttctcatct tttcacttct 2460

cctatcatta tcctcggccg aattcagtaa aggagaagaa cttttcactg gagttgtccc 2520

aattcttgtt gaattagatg gtgatgttaa tgggcacaaa ttttctgtca gtggagaggg 2580

tgaaggtgat gcaacatacg gaaaacttac ccttaaattt atttgcacta ctggaaaact 2640

acctgttcca tggccaacac ttgtcactac tttctcttat ggtgttcaat gcttttcaag 2700

atacccagat catatgaagc ggcacgactt cttcaagagc gccatgcctg agggatacgt 2760

gcaggagagg accatcttct tcaaggacga cgggaactac aagacacgtg ctgaagtcaa 2820

gtttgaggga gacaccctcg tcaacaggat cgagcttaag ggaatcgatt tcaaggagga 2880

cggaaacatc ctcggccaca agttggaata caactacaac tcccacaacg tatacatcat 2940

ggccgacaag caaaagaacg gcatcaaagc caacttcaag acccgccaca acatcgaaga 3000

cggcggcgtg caactcgctg atcattatca acaaaatact ccaattggcg atggccctgt 3060

ccttttacca gacaaccatt acctgtccac acaatctgcc ctttcgaaag atcccaacga 3120

aaagagagac cacatggtcc ttcttgagtt tgtaacagct gctgggatta cacatggcat 3180

ggatgaacta tacaaacatg atgagcttta actcgagggg tagtcaagat gcataataaa 3240

taacggattg tgtccgtaat cacacgtggt gcgtacgata acgcatagtg tttttccctc 3300

cacttaaatc gaagggttgt gtcttggatc gcgcgggtca aatgtatatg gttcatatac 3360

atccgcaggc acgtaataaa gcgaggggtt cgggtcgagg tcggctgtga aactcgaaaa 3420

ggttccggaa aacaaaaaag agagtggtag gtaatagtgt taataataag aaaataaata 3480

atagtggtaa gaaaggtttg aaagttgagg aaattgagga taatgtaagt gatgacgagt 3540

ctatcgcgtc atcgagtacg ttttaactat ggcttacaca gtttccagtg ccaatcaatt 3600

agtgtattta ggttctgtat gggccgatcc attagagtta caaaatctat gtacttcggc 3660

gttaggtaat cagtttcaaa cacagcaggc tagaactacg gttcaacagc agttctctga 3720

tgtgtggaag actataccga ccgctacagt tagatttccc gctactggtt tcaaagtttt 3780

ccgatataat gccgtgctag attctctagt gtcggcactt ctcggagcct ttgatactag 3840

gaataggata atagaagtag aaaatccgca aaatcctaca actgccgaga cgcttgatgc 3900

gacgaggcgg gtagatgatg cgacggtggc cattagggcc agtataagta acctcatgaa 3960

tgagttagtt cgtggcacgg gaatgtacaa tcaagctctg ttcgagagcg cgagtggact 4020

cacctgggct acaactcctt agacatgatg gtgtaaataa gttggacgaa cgttaaacgt 4080

ccgtggcgag tacgataact cgtagtgttt ttccctccac ttaaatcgaa gggttgtcgt 4140

taggatggaa cgcaattaaa tacatgtgtg acgtgtattt gcgaacgacg taattatttt 4200

caggggttcg aatccccccc gaaccgcggg tagcggccc 4239

<210> 17

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

aagttcattt catttggaga ggatgtccaa tttactgacc gtaca 45

<210> 18

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

ataatgtatg ctatacgaag ttatgatcta gtaacataga tgacac 46

<210> 19

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

ataacttcgt atagcataca ttat 24

<210> 20

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

cctctccaaa tgaaatgaac tt 22

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

acatgatggt gtaaataagt tgg 23

<210> 22

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

agttaaaacg tactcgatga cg 22

<210> 23

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

cgtcatcgag tacgttttaa ctatgcctta tacaatcaac tctc 44

<210> 24

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

ccaacttatt tacaccatca tgtctaagta gccggagttg tgg 43

Claims

1. The Cre-LoxP recombination system for infectious cloning of the pepper light mottle virus PMMoV-GFP is characterized by comprising a pJM23 vector, a pJG102 vector and a pCre vector;

the nucleotide sequence of the pJM23 vector is shown as SEQ ID No. 14;

the nucleotide sequence of the pJG102 vector is shown as SEQ ID No. 15;

the pCre vector is constructed by fusing Cre sequences into a binary expression vector.

2. The Cre-LoxP recombination system of PMMoV-GFP invasive clone according to claim 1, wherein the construction method of the Cre-LoxP recombination system comprises the following steps:

(1) Obtaining the nucleotide complete sequence of PMMoV-GFP invasive clone;

(2) The primers pJM23-1f, pJM23-1 r, pJM23-2f, pJM23-2r, pCB301-full f and pCB301-full r are designed; amplifying target fragments pJM23-1, pJM23-2 and pCB301-full introduced with LoxP sequences; the pJM23-1, pJM23-2 and pCB301-full fragments obtained by PCR amplification are directly reconstructed into a pJM23 vector by utilizing ClonExpress MultiS One Step Cloning Kit of Vazyme;

(3) Designing primers pJG102f, pJG102 r, pCB301-102f and pCB301-102 r; amplifying target fragments pJG102 and pCB301-102 introduced with LoxP sequences; directly reconstructing the PCR amplified pJG102 and pCB301-102 fragment into a pJG102 vector by using a ClonExpress II One Step Cloning Kit of Vazyme;

(4) Designing primers pCre f and pCre r; amplifying Cre gene fragment; the pCre vector is constructed by connecting the XbaI and SacI into a binary expression vector after double enzyme digestion;

(5) The three vectors are co-transformed into Benshi tobacco by adopting an agrobacterium-mediated method, and recombinant PMMoV-GFP invasive clone is obtained after Cre gene expression in vivo;

wherein, the base sequences of the primers pCB301-full f, pCB301-full r, pJM23-1f, pJM23-1 r, pJM23-2f, pJM23-2r,pJG102 f,pJG102 r,pCre f,pCrer r,pCB301-102f and pCB301-102 r are respectively shown in SEQ ID No. 2-SEQ ID No. 13.

3. The Cre-LoxP recombination system for infectious cloning of the pepper light mottle virus PMMoV-GFP is characterized by comprising a pJM23 vector and a pGJ2303 vector;

the nucleotide sequence of the pJM23 vector is shown as SEQ ID No. 14; the pJG2303 vector is formed by fusing a pJG102 vector and 35S-Cre-RZ-NOS, and the nucleotide sequence of the pJG2303 vector is shown as SEQ ID No. 16.

4. The recombinant Cre-LoxP system of PMMoV-GFP invasive clone according to claim 3, wherein the construction method of said recombinant system comprises the steps of:

(1) Obtaining the nucleotide complete sequence of PMMoV-GFP invasive clone;

(2) The primers pJM23-1f, pJM23-1 r, pJM23-2f, pJM23-2r, pCB301-full f and pCB301-full r are designed; amplifying target fragments pJM23-1, pJM23-2 and pCB301-full introduced with LoxP sequences, and directly reconstructing the pJM23-1, pJM23-2 and pCB301-full fragments obtained by PCR amplification by using ClonExpress MultiS One Step Cloning Kit of Vazyme to construct a pJM23 vector;

(3) Designing a primer constructed by a pJG2303 vector; amplifying to obtain a target fragment, and recombining the target fragment to obtain 35S-Cre-RZ-NOS; introducing a 35S-Cre-RZ-NOS sequence into a pJG102 vector by utilizing ClonExpress II One Step Cloning Kit of Vazyme, and carrying out recombination construction to obtain a pJG2303 vector;

(4) The two vectors are co-transformed into Benshi tobacco by adopting an agrobacterium-mediated method, and recombinant PMMoV-GFP invasive clone is obtained after Cre gene expression in vivo;

wherein, the base sequences of the primers pCB301-full f, pCB301-full r, pJM23-1f, pJM23-1 r, pJM23-2f and pJM23-2r are respectively shown in SEQ ID No. 2-SEQ ID No. 7; the base sequence of the primer constructed by the pJG2303 vector is shown in SEQ ID No. 17-SEQ ID No. 20; the nucleotide sequence of the pJG102 vector is shown in SEQ ID No. 15.

5. Use of the Cre-LoxP recombinant system of PMMoV-GFP infectious clone of claim 1, wherein the biologically active PMMoV-GFP infectious clone is produced by co-transformation of n.benthamiana by agrobacterium-mediated method by replacing CP gene of PMMoV in pJG102 vector with CP gene of tobacco mosaic virus TMV.