AU2010257316A1 - Transformation Vectors - Google Patents
Transformation Vectors Download PDFInfo
- Publication number
- AU2010257316A1 AU2010257316A1 AU2010257316A AU2010257316A AU2010257316A1 AU 2010257316 A1 AU2010257316 A1 AU 2010257316A1 AU 2010257316 A AU2010257316 A AU 2010257316A AU 2010257316 A AU2010257316 A AU 2010257316A AU 2010257316 A1 AU2010257316 A1 AU 2010257316A1
- Authority
- AU
- Australia
- Prior art keywords
- sequence
- plant
- derived
- dna
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
Description
Regulition 3.2 AUSTRALIA PATENTS ACT, 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT DIVISIONAL Name of Applicant: THE NEW ZEALAND INSTITUTE FOR PLANT AND FOOD RESEARCH LIMITED Actual Inventors: CONNER, Anthony John; BARRELL, Philippa Jane; JACOBS, Johanna Maria Elisabeth; BALDWIN, Samantha Jane; LOKERSE, Anncrnaric Suzanne; NAP, Jan-Peter Ilendrik Address for service in A J PARK, Lcvel 11, 60 Marcus Clarke Street, Canberra ACT Australia: 2601, Australia Invention Title: Trans formation Vectors The following statement is a full description of this invention, including the best method of performing it known to us. 296C073 1.DOC TRANSFORMATION VECTORS BACKGROUND ART 5 Over the past 20 years rapid scientific advances in molecular and cell biology have resulted in the development of technology to enable genetic engineering of plants (development of transformed plants, transgenic plants or GMOs). This offers new opportunities for the incorporation of genes into crop plants and represents a new technology platform for the next level of genetic gain in crop breeding. 10 An option provided by genetic engineering is the ability to extend the germplasm base available for crop improvement to any source of DNA, including that from other plants, microbes or animals. However this crcss-species transformation has raised ethical concerns with the public, especially when associated with foo d. 15 As this technology develops further, more genes are being identified from crop species which would be of benefit to agriculture and industry if they were transferred to other genotypes of the same crop, i.e. within species transformation. The use of such "within-species transformation" approaches for moving genes between genotypes within the existing gene 20 pools available to plant breeders also has several advantages over traditional breeding: 1. Direct gene transfer to elite plants and cultivars without repeated backcrossing. This allows the efficient development of new plant lines without the many generations of hybridisation and selection usually required to recover the desired plant. 25 2. The transfer of single discrete genes, without the "linkage drag" associated with the transfer of many undefined and often undesirable neighboring genes in traditional plant breeding. 3. The specific design and dlevelopient of new gene formulations. This can involve the 30 matching of molecular switches (promoters) with the desired coding regions to target the expression of the new gene at a specific location within a plant. Alternatively, "reverse genetics" approaches can be used Lo "knock-out" specific functions in plants. This can be achieved by positioning the coding region of a gone in the reverse orientation, relative to the promoter responsible for "turning the gene on" or components of the coding region arranged in an inverted repeat under control of the promoter. In addition, moving genes between plants of the same species does not raise the same ethical 5 concerns as cross-species transformation. The application of genetic engineering requires the use of vectors for either Agrobacterium mediated transformation or direct DNA uptake into plant cells. Agrobacteriwn-mediated transformation is the preferred method and requires the construction of modified T-DNA 10 (transferred-DNA) on a vector (usually a binary vec tor). However, the transformation requires the use of vector systems based on DNA sequences from other species (e.g. the T-DNA border regions, the DNA region into which target genes are inserted, selectable markers genes and sequences allowing suel vectofs to replicate in 15 additional host systems); sequences that have been usually derived from bacterial systems. The minimum requirement of a vector to perform Agrobacteriwn-mediated plant transfonnation is at least one T-DNA border region, although in practice transformation vector systems include other vector sequences as described above. Two T-DNA border 20 regions are usually used flanking the sequence of interest to be integrated into the plant genome. However in most instances such border sequences or parts thereof also become integrated into the genome of the trasformed plant. T-DNA sequences have been identified as naturally ocouiing in the genomes of plants (White 25 ct al 1983, Nature 301- 348-350; Funer et a! 1986, Nature 319: 422-427; Aod et al 1994, Molecular and General Genetics 243: 706-710; Susuli et al 2002, Plant Journal 32: 775-787). Plant transformation vectors in which the Agrobacterium borders are replaced with plant derived T-DNA border-like sequences have also been reported (WO 03/069980), If the T DNA border-like sequences are chosen from a plant of the species to be transformed, this 30 allows for the possibility of production of plants transformed with only their own DNA. However, in practice integration is relatively un-predictable and often results in integration of other vector sequences from outside of the T-DNA borders and even transfer of the whole transformation vector which includes many additional non-plant sequences. 2 It is an object of the invention to provide improved compositions and methods for plant transformation which reduce or eliminate the transfer of foreign DNA into the plant, or at least provide the public with a useful choice. 5 SUMMARY OF INVENTION In one aspect the invention provides a plant transformation vector comprising: a) T-DNA-like sequence including at least one T-DNA border-like sequence, the T 10 DNA border-like sequence comprising two polynucleotide sequence fragments, wherein all of the sequences of the T-DNA-like sequence are derived from plant species. Also possible but less preferred is use of a similar T-DNA border-like sequence containing three or more polynucleotide sequence fragments derived from plant species. 15 In a further aspect the invention provides a plant transformation vector comprising a) a T-DNA-like sequence including at least one T-DNA border-like sequence b) additional plant polynucleotide sequence on one or both sides of the T-DNA-like sequence in which all of said sequences are derived from plants, preferably from the same plant species. 20 Preferably the additional plant pulynucleotide sequence is5' to the left border when two ' DNA border-like sequences are used, or 5' to the single '-DNA border-like sequence when a single T-DNA border-like sequence is used, 25 In a preferred embodiment the said additional plant polynucleolide sequence is at least about lbp in length, preferably at least about 5 bp, preferably at least about 10 bp, preferably at least about 50 bp, preferably at least about 100 bp, preferably at least about 200 bp, preferably at least about 500 bp, more preferably at least about I kb. 30 In a preferred embodiment the T-DNA-like sequence includes two T-DNA border-like polymcleotide sequences flanking the T-DNA-like sequence, both T-DNA border-like polynucleotide sequences being derived from plants, prefembly from the same plant species. 3 in a further embodiment the T-DNA-like sequence further comprises additional base polynucleotide sequence(s), the additional base polynucleotide sequence(s) being derived from plants preferably from the same plants species as the T-DNA border-like sequences. 5 In a further embodiment the T-DNA-like sequence includes first and second recombinase recognition site sequences, wherein all of said sequences are derived from plants, preferably from the same plant species. In a further embodiment the first recombinase recognition site and the second recombinase 10 recognition site are lox P-like sites derived from a plant species, preferably from the same plant species as the T-DNA border-like sequences. In a further embodiment the first recombinase recognition site and the second recombinase recognition site areft-like sites derived from a plant species, preferably from the same plant 15 species as the T-DNA border-like sequences. In one embodiment the vector comprises a selectable marker sequence flanked by the first and second recombinase recognition site sequences: Preferably the selectable marker is operably linked to a constitutive promoter sequence. Preferably the selectable marker and/or the 20 constitutive promoter sequences are derived from plants, preferably from the same plant species as the T-DNA border-like sequences. In a further embodiment the vector comprises a recombinase sequence flanked by the first and second recombinase recognition site sequences. Preferably the recombinase is operably 25 linked to an inducible promoter sequence. Preferably the recombinase and/or inducible promoter sequences are derived from plants, preferably from the same plant species as the ' DNA border-like sequences. In preferred vectors, when the recombinase recognition sites are a LoxP-like sequences, the 30 recombinase sequence is Cre and when the recombinase recognition sites are anfrt-like sequences, the recombinase sequence is FLP. Alternatively a negative selection marker may be flanked by the fast and second recombinase recognition site sequences. Preferably the negative selection marker is CodA, 4 In a further embodiment neitber the T-DNA border-like polynucleotide sequences, nor any base polynucleotide sequence of the T-DNA -like sequence, nor the first or second recombinase recognition site sequences, nor the plant polynucleotide sequence additional to 5 tie T-DNA-like sequence, contain regulatory elements, such as promoters, which may influence the expression of inserted genes of interest. In a further embodiment neither the T-DNA border-like polynucleotide sequences, nor any base polynucleotide sequence of the T-DNA-like sequence, nor the first or second 10 recombinase recognition site sequences, nor the plant polynucleotide sequence additional to the T-DNA-like sequence, contain introns, which may influence the expression of inserted genes of interest. In a further embodiment neither the T-DNA border-like polynneoleotide sequences, nor any 15 base polynuclcotide sequence of T-DNA-like sequence, nor the first or second recombinase recognition site sequences, nor the plant polynucleotide sequence additional to the T-DNA like sequence are derived from hoterochromartic regions of the genone from which they are derived. 20 In a further embodiment the polynucleotide encompassing the T-DNA border-like sequences, the base polynucleotide sequence of the T-DNA-like sequence and the plant polynucleotide sequence additional to the T-DNA-like sequence are constructed from fewer than 10, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most 25 preferably 2 or I sequence fragments derived from plants. In a further embodiment the plant transformation vector of the invention further comprises an origin of replication sequence. Preferably the origin of replication sequence is derived from a plant, preferably from the same plant species as the T-DNA border-like sequences and/or the 30 base polynucleotide sequence of the T.-DNA-like sequence, and/or the sequence additional to the T-DNA-like sequence. In a further embodiment the T-DNA-like sequence of die plant transformation vector of the invention comprises a selectable marker polynucleotide sequence for selection of a plant cell or plant harboring the T-DNA-like sequence. Preferably the selectable marker sequence is derived from a plant, more preferably from the same plant species as the T-DNA border-like sequences and/or the base polynucleotide sequence of the T-DNA-like sequence, and/or the sequence additional to the T-DNA-like sequence. 5 In a further embodiment the plant transformiation vector of the invention further comprises a selectable marker polynucleotide sequence for selection of a bacterium harbouring the vectos Preferably the selectable marker sequence is derived from a plant, more preferably from the same plant species as the T-DNA border-like sequences and/or the base polynucleotide 10 sequence of the T-DNA-like sequence, and/or the sequence additional to the T-DNA-like sequence. In a further embodiment the selectable marker polynucleotide sequence for selection of a plant harboring the T-DNA-like sequence also frmnetions in selection of a bacterium 15 harbouring the vector. In a further embodiment the T-DNA-like sequence further comprises a genetic construct as her6hi defined. Preferably the genetic construct comprises a promoter polynucleotide sequence operably linked to a polynucleotide sequence of interest and a terminator 20 polynucleotide sequence, wherein all of said polynucleotide sequences are derived from plants, preferably from the same plant species as the T-DNA border-like sequences. In a preferred embodiment the polynucleotide sequence of the entire vector is derived from plant species, preferably from the same plant species. 25 In a further aspect the invention provides a plant transformation vector including a T-DNA like sequence, the T-DNA like sequence comprising: a) a polynucleotide sequence of at least about 20 hp in length derived from a plant species, comprising, the nucleotide sequence 5'-GR-3' (wherein R = G or A); and 30 b) a chinmeric T-DNA-border-like sequence comprising at its 5' end, the nucleotide sequence 5'-GR-3' front a) wherein the chimeric border is capable of functioning as a T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant 6 In a further aspect the invention provides a plant transformation vector including a T-DNA like sequence, the T-DNA like sequence comprising: a) a polynucleotide sequence of at least about 20 bp in length derived from a plant species, comprising, the nucleotide sequence 5'-GRC-3' (wherein R = G or A); and 5 b) a chineric T-DNA-border-like sequence comprising at its 5' end, the nucleotide sequence 5'-GRC-3' from a) wherein the chimeric border is capable of finctioning as a T-DNA border sequence in integration of a polynucleotide sequence into the genone of a plant 10 In a further aspect the invention provides a plant t-ransformation vector including a T-DNA like sequence, the T-DNA like sequence comprising: a) a polynucleotide sequence of at least about 20 bp in length derived from a plant species, comprising, the nucleotide sequence 5'-GRCA-3' (wherein R = G or A); and b) a chimeric T-DNA-border-like sequene coinprising at its 5' end, the nucleotide 15 sequence 5'-GRCA-3' from a) wherein the chimeric border is capable of functioning as a T-DNA border sequence iii integration of a polynucleotide sequence into the genome of a plant. In a one embodiment, the T-DNA-like sequence includes, 5' to the chimTeric T-DNA border 20 like sequence, first and second recombinase recognition sequences, wherein the recombinase recognition sequences are derived from plant species. Preferably the first recombinase recognition site and the second recombinase recognition sequence are loxP-like sequences. Alternatively the first recombinase recognition sequence 25 and the second recombinase recognition sequences arefrt-like sequences. In a preferred embodiment the plant transformation vector comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences. Preferably the selectable marker sequence is derived from plants. 30 In a more preferred embodiment, the polynucleotide of at least 20 bp in length and any recombinase recognition site sequences are constructed from fewer than 10 fragments, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer 7 than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most preferably 2 or I sequence fragments derived from plants. Preferably the plant transformiation vector further comprises an origin of replication 5 polynucleotide sequence derived from plant species. In a preferred embodiment, the T-DNA-tike sequence includes, 5' to the chimeric I-DNA border-like sequence, a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the T-DNA-like sequence, wherein the selectable 10 marker sequence is derived from plant species. Preferably the plant transformation vector comprises a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived ftom'a plant. 15 Preferably the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the T-DNA-like sequence is also capable of functioning in selection of a bacterium harbouring the vector. 20 In a preferred embodiment the T-DNA-like sequence of the plant transformation vector further comprises a genetic construct as herein defined, wherein all pulynucleotide sequences of the genetic construct are derived from plant species. Preferably all of the polynucleotide sequence of the the plant transformation vector, except for 25 the chinmeric T-DNA border-like sequence, is derived from plant species. More preferably all of the polynucleotide sequence of the the plant transformation vector, except for the chineric T-DNA border-like scquenec, is derived front plant species which are interfertile. 30 Most preferably all of the polynueleotide sequence of the the plant transformation vector, except for the chimeric T-DNA border-like sequence, is derived from the same plant species.
S
In a further aspect the invention provides a plant transformation vector including a chimeric sequence, the chimeric sequence comprising: a) at the 5' end a plant-derived sequence of at least 20 bp in length including the nucleotide sequence 5'-GR-3' (wherein R = G or A); and 5 b) at the 3' end a border sequence capable of performing the function of a T-DNA border sequence in integration of a polynuclcotide sequence into the genome of a plant, wherein the nucleotide sequence 5 -GR-3' from a) forms the 5' end of the border sequence. 10 In a further aspect the invention provides a plant transformation vector including a chincric sequence, the chimeric sequence comprising: a) at the 5' end a plant-derived sequence of at least 20bp in length including the nucleotide sequence 5'-GRC-3' (wherein R = G or A); and b) at the 3' end a border sequence capable of performing the function of a T-DNA 15 border sequence in integration of a polynuoleotide sequence into the genome of a plant, wherein the nucleotide sequence 5'-GRC-3' from a) forms the 5' end of the border sequence. In a further aspect the invention provides a plant transfonnation vector including a chimeric 20 sequence, the chimeric sequence comprising: a) at the 5' end a plant-derived sequence of at least 20 bp in length including the nucleotide sequence 5' -GRCA-3' (wherein R = G or A); and b) at the 3' end a border sequence capable performing the function of a T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant, 25 wherein the nucleotide sequence 5'-GRCA-3' from a) forms the 5' end of the border sequence. Preferably the plant-derived sequence of at least 20 bp in length is at least about 50bp in length, more preferably at least about 1 00bp in length, more preferably at least about 200bp in 30 length, more preferably at least about 500bp in length, most preferably at least about 1kb in length. In a preferred embodiment the plant transformation includes, 5' to the border sequence, first and second recombinase recognition sequences derived from plant species. 9 Preferably the first recombinase recognition site and the second recombinase recognition sequence are toxP-like sequences. 5 Alternatively the first recombinase recognition sequence and the second recombinase recognition sequences arefr-like sequences. In a further embodiment the plant transformation vector comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences. 10 Preferably the selectable marker sequence is derived from plants. In a further embodiment the polynucleotide of at least 20 bp in length and any recombinase recognition site sequences, of the phint transformation vector, are constructed from fewer than 15 10 fragments, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most preferably 2 or 1 polynucleotide sequence fragments derived from plant species. In a further embodiment the plant transformation vector further comprises an origin of 20 replication pollynucleotide sequence derived from plant species. In a further embodiment the plant transformation vector includes, 5' to the border sequence, a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the selectable marker polynucleotide sequence, wherein the selectable 25 marker sequence is derived from plant species. In a further embodiment the plant transformation vector comprises a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium barbouring the vector, wherein the selectable marker sequence is derived from a plant. 30 Preferably the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the delectable marker polynucleotide sequence is also capable of finctioning in selection of a bacterium harbouring the vector. 10 In a further embodiment the plant transformation vector further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plant species. 5 In a preferred embodiment all of the polynuclcotide sequence of the plant transformation vector, except for the border sequence, is derived from plant species. In a more preferred embodiment all of (he polynucleotido sequence of the plant transformation vector, except for the border sequence, is derived from plant species which are 10 interfertile. In a yet more preferred embodiment all of the polynucleotide sequence of the plant transformation vector, except for the border sequence, is derived from the satne plant species. 15 In a further aspect the invention provides a plant transformation vector comprising a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harboring the selectable marker polynucleotide, wherein the selectable marker sequence is-derived from plant species. 20 In a further aspect the invention provides a plant transformation vector comprising first and second recombinase recognition sequences, wherein the recombinase recognition sequences are derived from plant species, In one embodiment the first recombinase recognition sequence and the second recombinase 25 recognition sequence are loxP-like sequences derived from a plant species. In an alternative embodiment the first recombinase recognition sequence and the second recombinase recognition sequences areft-like sequences derived from plant species. 30 In a preferred embodiment the plant transformation vector comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences. Preferably the selectable marker sequence is derived from plants.
II
In a further embodiment the plant transformation vector further comprises an origin of replication pulynucleotide sequence derived flora plant species. In a father embodiment the plant transformation vector further comprises a selectable marker 5 polynucleetide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived from plant species. In a preferred embodiment the selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector is also capable of functioning in 10 selection of a plant cell or plant harbouring the selectable marker polynucleotide. In a further aspect the invention provides a plant transformation vector comprising: a) an origin of replication polynucleotide sequence, and b) a scletable marker polynucleotide sequence capable of functioning in selection of a 15 bacterium harbouring the vector in which all of said sequences are derived from plant species. In one -embodiment the plant transformation vector further comprises additional base polynucleotide sequence. the additional base polynucleotide sequence being derived from 20 plant species. In a preferred embodiment the plant trausformation vector is constructed from fewer than 10, preferably fewer than 9, preferably fewer than 8, prefembly fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most 25 preferably 2 or 1 polynucleotide sequence fragments derived from plants. In a further embodiment the plant transformation vector further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plants. 30 In a preferred embodiment all of the polynucleotide sequence of the plant transformation vector is derived from plant species, more preferably from plant species which are interfertile and most preferably from the same plant species. 12 In a further aspect the invention provides a plant transformation vector comprising a selectable marker polynucleotide sequence for selection of a bacterium harbouring the vector. Preferably the selectable marker sequence is derived from a plant. More preferably the vector also comprises an origin of replication sequence functional in bacteria, preferably in R coh. 5 Preferably the origin of replication sequence is derived from a plant, more preferably from the same plant species as the selectable marker polynucleotide sequence for selection of a bacterium harbouring the vector. Yet more preferably the vector further comprises a genetic construct as herein defined. Preferably the genetic construct sequence is derived from a plant, more preferably from the same plant species as the selectable marker polynucleotide sequence 10 for selection of a bacterium harbouring the vector. Preferably the polynucleotide sequence of the entire vector are derived from plant species, most preferably from the same plant species. In a further aspect the invention provides a method of producing a transformed plant cell or plant, the method coilprising the step of transformation of the plant cell or plant using a 15 transformation vector of the invettion. In a preferred embodiment any polynucleotide stably integrated into the plant cell or plant is derived from a plant. Preferably any polynucleotide stably integrated into the plant cell or plant is derived from a plant interfertile with the plant or plant cell to be transformed. Most 20 preferably any polynucleotide stably integrated into the plant cell or plant is derived from a plant of the same species as the plant or plant cell to be transfonned. The invention also provides a method of modifying a trait in a plant cell or plant comprising: (a) transforming of a plant cell or plant with a vector of the invention, the vector 25 comprising a genetic construct capable of altering expression of a gene which influences the trait; and (b) obtaining a stably transformed plant cell or plant modified for the trait. In one embodiment transfonation is vir gene-mediated. 30 In a futher embodiment transfonnation is Agrobacterimn-inediated. In an alternative embodiment transformation involves direct DNA uptake. 13 In a further aspect the invention provides a method for modifying a plant cell or plant, comprising: (a) transforming a plant cell or plant with the vector of the invention comprising a selectable marker flanked by loxP-like recombinase recognition sites; 5 (b) selecting a plant cell or plant expressing the selectable marker flanked by ioxP-like recombinase recognition sites; (c) inducing the expression of the Cre gene in the plant cell or plant; (d) culturing the plant cell or plant for sufficient time to allow excision of the selectable marker. 10 In a further aspect the invention provides a method for modifying a plant cell or plant, comprising: (a) transforming a plant cell or plant with the vector of the invention comprising a selectable marker flanked byfrt-like recombinase recognition sites; 15 (b) selecting a plant cell or plant expressing the selectable marker flanked byfrt-like recombinase recognition sites; (c) inducing the expression of the FLF gene in the plant cell or plant; (d) culturing the plant cell or plant for sufficient time to allow excision of the selectable marker. 20 The invention provides a plant modified by a method of the invention. In a preferred embodiment the plant cell or plant modified is of the same species as the vector sequence used to modify it. 25 The invention also provides a plant cell or plant produced by a method of the invention In a preferred embodiment the plant cell or plant produced is of the same species as the vector sequence used to produce it. 30 The invention also provides a plant tissue, organ, propagule or progeny of the plant cell or plant ef the invention. 14 DETAILED DESCRIPTION The term "polynucleotide(s)," as used herein, means a single or double-stranded 5 deoxyribonucleotide or ribonucleotide polymer of any length, and include as non-limiting examples, ceding and non-coding sequences of a gene, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozyrnes, recombinant polynucleotices, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, 10 fragments, genetic constructs, vectors and modified polynucleotides. As used herein, the term "variant" refers to polynucleotide or polyp eptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is -deleted, substituted, or added. Variants may be naturally occurring allelic variants, 15 or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogucs and orthologues. In certain embodiments, variants of the inventive polypeptides and polynucleotides possess biological activities that are the same or similar to those of the inventive polypeptides or polynucleotides. The term "variant" with reference to polynucleotides and polypeptides encompasses all forms of polynuclcotides 20 and polypeptides as defined herein. Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, and most preferably at least 99% identity to a sequence of 25 the present invention. Identity is found over a comparison window of at least 5 nucleotide positions, preferably at least 10 nucleotide positions, preferably at least 20 nucleotide positions, preferably at least 50 nucleotide positions, more preferably at least 100 nucleotide positions, and most preferably over the entire length of a polynucleotide of the invention. 30 Polynucleotide sequence identity can be determined in the following manner. The subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), "Blast 2 sequences - a new tool for comparing protein 15 and nucleotide sequences", FEMS Microbiol Lett. 174:247-250), which is publicly available from NCBI (ftp://fpnobi.nih.gov/blast/). The default parameters of bl2seq may be utilized. Polynucleotide sequence identity may also be calculated over the entire length of the overlap 5 between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mot. Biol. 48, 443-453). A full implementation of the Needlernan-Wunsch global alignment algoritlun is found in the needle program in the EMBOSS package (Rice, P. Longden, . and Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 10 6. pp.276-277) which can be obtained from http:Hwww.hgm.mre.ac.uk/SofavareEMBOSS/, The European Bioinformatics Institute server also provides the facility to perform EMBOSS-needle global alignments between two sequences on line at http:/www.ebi.ac.uk/emboss/align/. 15 Alternatively the GAP program may be used which computes an optimal global alignment of two sequences without penalizing tenninal gaps. OAP is described in the following paper: Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235. 20 Use of BLASTN as described above is preferred for use in the determination of sequence identity for polynucleotide variants according to the present invention. Alternatively, variant polynucleotides of the present invention-hybridize to the polynucleotide sequences disclosed herein, or complements thereof under stringent conditions. 25 The term "hybridize under stringent conditions", and gramriaical equivalents thereof, refers to the ability of a polyiucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt 30 concentration. The ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency. 16 With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 3 0* C (for example, 100 C) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al., 5 1987, Current Protocols in Molecular Biology, Greene Publishing,). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + 0. 41% (G + C-log (Na+). (Sambrook et at. Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton and McCarthy, 1962, PNAS 84;1390). Typical stringent conditions for polynucleotide molecules of greater than 100 bases in length would 10 be hybridization conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65*C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in 1X SSC, 0.1% SDS at 65* C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 654C. 15 With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 100 C below Tin. On average, the Trn of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleodde length)' C. 20 Variant polynucleotides of the present invention also encompasses polynucleotides that differ from the sequences of the invention but that, as a consequence of the degeneracy of the genetic code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention. A sequence alteration that- does not change the amino acid sequence of the polypeptide is a "silent variation". Except for ATG (methionine) and 25 TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism. Polynucleotide sequence alterations resulting in conservative substitutions of one or several amino acids in the encoded polypeptide sequence without significantly altering its biological 30 activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al., 1990, Science 247, 1306). 17 Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002)) from NCBI (ftp://ftp.ncbi.nih.2ov/blast/) via the tblastx algorithm as previously described. 5 A "fragment" of a polynueleotide sequence provided herein is a subsequence of contiguous nucleotides that is at least 5 nucleotides in length. The fragments of the invention comprise at least 5 nucleotides, preferably at least 10 nucleotides, preferably at least 15 nucleotides, preferably at least 20 nncleotides, more preferably at least 30 nucleotides, more preferably at 10 least 50 nueleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide of the invention. The tenn "primer" refers to a short polynucleotide, usually having a free 3'OH group, that is hybridized to a template and used for priming polymerization of a polynucleotide 15 complementary to the target The term "probe" refers to a short polynucleotide that is used to detect a polynucleotide sequence, that is complementary to the probe, in a hybridization-based assay. The probe may consist of a "fragment" of a polynucleotide as defined herehiL 20 The ten polypeptidee", as used herein, encompasses amino acid chains of any length, including fill-length proteins, in which amino acid residues are linked by covalent peptide bonds. Polypeptides of the present invention may be purified natural products, or may be produced partially or wholly using recombinant or synthetic techniques. The term may refer 25 to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof. The tern "isolated" as applied to the polynucleotide sequences disclosed herein is used to refer to sequences that are removed from their natural cellular environment. An isolated 30 molecule may be obtained by any method or combination of metbods including biochemical, recombinant, and synthetic techniques. The tern "genetic construct" refers to a polynucleotide molecule, usually double-stranded DNA, which may have inserted into it another polynucleotide molecule (the insert 18 polynucleotide molecule) such as, but not limited to, a cDNA molecule. A genetic construct may contain the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. The insert polynucleotide molecule may be derived from the host cell, or may be derived from a 5 different cell or organism and/or may be a recombinant or synthetic polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA. The term "genetic construct" includes "expression construct" as herein defined. The genetic construct may be linked to a vector. 10 The term "expression construct" refers to a genetic construct that includes the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. An expression construct typically comprises in a 5' to 3' direction a) a promoter functional in the host cell into which the construct will be 15 transformed, b) the polynucleotide to be transcribed and/or expressed, and c) a terminator functional in the host cell into which the construct will be transformed. 20 The term "vector" refers to a polynucleotide molecule, usually double stranded DNA, which may include a genetic construct and be used to transport the genetic construct into a host cell. The vector may be capable of replication in at least one additional host system, such as Escherichia coli or Agrobacterium tumefaciens. 25 The term "coding region" or "open reading frame" (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences. The coding sequence is identified by the presence of a 5' translation start codon and a 3' translation stop codon. When inserted into a genetic construct, a "coding sequence" is 30 capable of being expressed when it is operably linked to promoter and terminator sequences. "Operably-lnked" means that the sequence to be expressed is placed under the control of regulatory elements that include promoters, tissue-specific regulatory elements, temporal 19 regulatory elements, chemical-inducible regulatory elements, environnent-inducible regulatory clements, enhancers, repressors and tenninators. The term "noncoding region" refers to untranslated sequences that are upstream of the 5 translational start site and downstream of the translational stop site. These sequences are also referred to respectively as the 5' UTR and the 3' UTR. These regions include elements required for transcription initiation and termination and for regulation of translation efficiency. 10 Terminators are sequences, which terminate transcription, and are found in the 3' untranslated ends of genes downstream of the translated sequence. Terminators are important detenninants of RINA stability and in some cases have been found to have spatial regulatory functions. The term "promoter" refers to nontranscribed cis-regulatory elements upstream of the coding 15 region that regulate gene transcription. Promoters comprise cis-initiator elements which specify the transcription initiation site and conserved boxes such as the TATA box, and motifs that are bound by transcription factors. A transformedd plant" refers to a plant which contains new genetic material as a result of 20 genetic manipulation or transformation. The new genetic material may be derived from a plant of the same species or from a different species in which case it can also be known as a "transgenic plant". An "inverted repeat" is a sequence that is repeated, where the second half of the repeat is in 25 the complementary strand, e.g., (5'I)GATCTA.....TAGATC(3') (3')CTAGAT.....ATCTAG(5') Read-through transcription will produce a transcript that undergoes complementary base pairing to form a hairpin structure provided that there is a 3-5 bp spacer between the repeated 30 regions. The terms "to alter expression of' and "altered expression" of a polynucleotide or polypeptide of the invention, are intended to encompass the situation where genomic DNA corresponding to a polynucleotide of the invention is modified thus leading to altered expression of a 20 polynucleotide or polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations. The "altered expression" can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in altered activity of a polypeptide due 5 to alterations in the sequence of a polynuclcotide and polypeptide produced. The term "IoxP-ike sequence" refers to a sequence derived from the genome of a plant which can perform the function of a Cre recombinase recognition site. The loxP-like sequence may be comprised of one contiguous sequence derived from the genome of a plant or may be 10 formed by combining two sequences derived from the genome of a plant. A loxP-like sequence is between 24-100 bp.in length, preferably 24-80 bp in length, preferably 24-70 bp in length, preferably 24-60 bp in length, preferably 24-50 bp in length, preferably 24-40 bp in length, preferably 24-34 bp in length, preferably 26-34 bp in k 1ngth, 15 preferably 28-34 bp in length, preferably 30-34 bp in length, preferably 32-34 bp in length, preferably 34 bp in length. A ioxP-like sequence preferably comprises the consensus motif 20 5' ATAACTTCGTATANNNNNNNNTATACGAAGTTAT 3' (where N = any nucleotide), or similar sequences, The tenn 'frt-like sequence" refers to a sequence derived from the genome of a plant which 25 can perform the function of an FLP recombinase recognition site. Thefrt-like sequence may be comprised of one contiguous sequence derived from the genome of a plant or may be formed by combining two sequences derived from the genome of a plant Anfrt-like sequence is between 28-100 bp in length, preferably 28-80 bp in length, preferably 30 28-70 bp in length, preferably 28-60 bp in length, preferably 28-50 bp in length, preferably 28-40 bp in length, preferably 28-34 bp in length, preferably 30-34 bp in length, preferably 32-34 bp in length, preferably 34 bp in length. Aft-like sequence preferably comprises the consensus motif 21 5' GAAGTTCCTATACNNNNNNT1EYGWATAGGAACTTC 3' (where W = A or T, N - any nucleotide). 5 The term "T-DNA border-like sequence" refers to a sequence derived from the genome of a plant whikh can perform the function of an Agrobacterium T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant. The T-DNA border-like sequence may be comprised of one contiguous sequence derived from the genome of a plant 10 or may be formed by combining two or more sequences derived from the genome of a plant. A T-DNA border-like sequence is between 10-100 bp in length, preferably 10-80 bp in length, preferably 10-70 bp in length, preferably 15-60 bp in length, preferably 15-50 bp in. length, preferably 15-40 bp in length, preferably 15-30 bp in length, preferably 20-30 bp in length, 15 preferably 21-30 bp in length, preferably 22-30 bp in length, preferably 23-30 bp in length, preferably 24-30 bp in length, preferably 25-30 bp in length, preferably 26-30 bp in length. A T-DNA border-like sequence preferably comprises the consensus motif 5'GRCAGGATATATNNNNKSTMAWN3' 20 (where R G or A, K = T or G, S = G or C, M = C or A, W = A or T and N= any nucleotide. The T-DNA border-like sequence of the invention is preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at 25 least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99% identical to any Agrobacterian-derived T-DNA border sequence. Although not preferred, a T-DNA border-like sequence of the invention may include a sequence naturally occun-ing in a plant which is modified or mutated to change the efficiency 30 at which it is capable of integrating a linked polynucleotide sequence into the genome of a plant. The teun "T-DNA-like sequence" refers to a sequence derived from a plant genuine which includes at one or both ends a T-DNA border-like sequence, or a chimeric T-DNA-border-ike 22 sequence as herein defined. A T-DNA-likc sequence may include additional base sequence between the T-DNA border-like sequences, or to one side of a T-DNA border-like sequence. The base sequence of the T-DNA-like sequences of the invention preferably includes restriction sites or alternative cloning sites to facilitate insertion of further polynucleotide 5 sequences. The ten "chimeric T-DNA border-like sequence" refers to a sequence which can perform the function of an Agrobacteriwn T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant, wherein part of the sequence is derived from a plant and 10 part of the sequence is derived from another source, such as Agrobacterium. Upon plant transformation, it is well understood that T-DNA integration from the right border is very precise. Molecular cloning and sequencing across T-DNA/plant genornic DNA junctions has repeatedly established that T-DNA integration at the right border is highly 15 conserved, with only the first few nucleotides of the right border being integrated into plant genomes (Gheysen, G., Angenon, G., van Montagu, M., Agrubacierium-mediated plant transformation: a scientifically intriguing story with significant applications, pp. 1-33, in Transgenic Plant Research, editor Lindsey, K., Ifarwood Academic Publishers, Amsterdam, 1998). 20 For this reason, when deriving a chimeric border for use as a "right border" in intragenic transformation, it is only necessary for the first few nucleotides (up to four nucleotides) to be of plant origin; i.e. 5'GRCA.. .3'. The remaining DNA sequence of such rights borders can be authentic sequences from Agrobacteriun T-DNA borders. 25 It will be well understood by those skilled in the art that a DNA sequence of 5'GRCA3' will occur frequently in any genome. It is expected to be found at random once in every 256 nucleotides and is likely to be found on any other fragment useful for the construction of vectors for plant transfonnation. 30 The term "border sequence" refers to a sequence derived from a plant which can perform the function of an Agrobacteriun T-DNA border sequence for integration of a polynucleotide sequence into the genome of a plant. 23 A "border sequence" is between 10-100 bp in length, preferably 10-80 bp in length, preferably 10270 bp in length, preferably 15-60 bp in length, preferably 15-50 bp in length, preferably 15-40 bp in length, preferably 15-30 bp in length, preferably 20-30 bp in length, preferably 21-30 bp in length, preferably 22-30 bp in length, preferably 23-30 bp in length, 5 preferably 24-30 bp in length, preferably 25-30 bp in length, preferably 26-30 bp in length. A "border sequence" preferably comprises the consensus motif: 5'GRCAGGATATA TNNNNNKSTMAWN3' 10 (where R G or A, K - T or G, S = G or C, M = C or A, W = A or T and N any nucleotide). The tenn "border sequence" as used herein includes known Agrobacterium borders, including 15 those disclosed herein. The term "border sequence" also includes modified versions of known Agrobacterium sequences, wbich have been modified, for example by substitution, addition or deletion, to improve the efficiency at which they are capable of performing function of an Agrobacterium 20 T-DNA border sequence for integration of a polynucleotide sequence into the genome of a plant. The terns "origin of replication derived from a plant" or "plant-derived origin of replication" or grammatical equivalents thereof refers to a sequence derived from a plant which can 25 support replication of a vector in which it is included in a bacterium. The "plant-derived origins of replication" may be composed of one, two or more sequence fragments derived from plants. Preferably the "plant-derived origins of replication" are composed of two sequence fragments derived from plants. 30 The plant-derived origin of replication may comprise the consensus motif: AGAYCAATAAGCCT TANCAJ ATAACAGCfrCC WhereR= G orA (Pu), Y= C orT (Py) and W=AorT 24 Alternatively the plant-derived origin of replication comprises the consensus motif: 5 AGAf4CA4ATAAGCC TA CAiNATAACAGOCC Where R Gor A (Pu), Y =C or T (Py) and W =A or T The terms "selectable marker derived from a plant" or "plant-derived selectable marker" or 10 grammatical equivalents thereof refers to a sequence derived from a plant which can enable selection of a plant cell harboring the sequence or a sequence to which the selectable marker is linked. The "'plant-derived selectable markers" may be composed of one, two or more sequence fragments derived from plants. Preferably the "plant-derived selectable markers" are composed of two sequence fragments derived from plants. 15 In one embodiment, the plant-derived selectable marker is at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at 20 least 99% identical to the sequence of SEQ ID NO:10. Alternatively the plant-derived selectable marker is at least 90%, preferably at least 95%, and most preferably 100% identical to SEQ ID NO:39 or SEQ ID NO:40. 25 Methods for transforming plant cells, plants and portions thereof with polynucleotides are described in Draper et al., 1988, Plant Genetic Transformation and Gene Expression, A Laboratory Manual. Blackwell Sci. Pub. Oxford, p. 365; Potrykus and Spangenburg, 1995, Gene Transfer to Plants. Springer-Verlag, Berlin.; and Gelvin et al,, 1993, Plant Molecular Biol. Manual. Kluwer Acad. Pub. Dordrecht. A review of transgenic plants, including 30 transformation techniques, is provided in Galun and Breiman, 1997, Transgenic Plants. Imperial College Press, London. 25 It will be well understood by those skilled in the art that the intragenic vectors of the invention can function in the place of the binary vectors for Agrobacterium-mediated transformation and as vectors for direct DNA uptake approaches. 5 The invention provides novel plant derived loxP-like and fr-like recombinase reognition sequences, novel T-DNA border-like sequences, T-DNA-like sequences, transformation vectors, methods for producing transfonn d plant cells and plants, and plant-cells and plants produced by the methods. 10 The majority of selectable markers for plant transformation are antibiotic or herbicide resistance genes; their presence in transgenic crop plants has given rise to public concerns on environmental safety. Regardless of their origin, once a transgenic plant has been established marker genes are no 15 longer required. Moreover it is desirable to remove the promoter and enhancer elements used to drive the expression of the marker genes as these may interfere with the expression of neighboring endogenous genes. Previously site-specific recombination systems have been elegantly used to excise precise 20 sequences corresponding to selectable marker constructs in transgenic plants (reviewed by Gilbertson, L Cre-lox combination: Cre-ative tools for plant biotechnology TRENDS in Biotechnology 21(12) 550-555 2003). Two such recombination systems are the Escherichia coli bacteriophage P1 Cre/loxP system 25 and the Saccharumyces cerevisiae FLP/ft systems, which require only a single-polypeptide recombinase, Cre or FLP and minimal 34bp DNA recombination sites, loxP orfrt. When two recombination sites in the same orientation flank integrated DNA such as a selectable marker, recom binase mediates a crossover between these sites effectively excising 30 the intervening DNA. The recombinase enzyme can either be located next to the selectable marker gene so that it is in effect auto excised (Mlynarova, L and Nap J-P, A self-excising Cre recombinase allows efficient recombination of multiple ectopic heterospecific lox sites in transgenic tobacco, 26 Transgenic Research, 12: 45-57, 2003), or it can be transiently expressed (Gieave, A.P, Mitra. D.S, Mudge, S.R and Morris, B.A.M. Selectable marker-free transgenic plants without sexual crossing: transient expression of ore reconbinase and use of a conditional lethal dominant gene, Plant Molecular Biology, 40: 223-235, 1999). 5 Following excision only one recombination site remains. The applicants have identified novel T-DNA border-like sequences from plant genomes and devised improved methods for transformation which minimise or eliminate transfer of foreign 10 DNA to the transfonned plant cell or plant. The invention provides T-DNA border-like sequences, T-DNA-lilce sequences, transfonnation vectors, methods for transforming plant cells and plants, and the plant cells and plants produced by the methods. 15 The applicants have also identified novel plant derived loxP--like and fit-like recombinase recognition sequences from plant genomes and devised further improved methods for transformation which inimiise or eliminate transfer of foreign DNA to the transformed plant. 20 It will be understood by those skilled in the art that corresponding recombinase sequences can be expressed in plants in order to facilitate recombination of the loxP-like and frt-like recombinase recognition sequences of the invention. The invention provides methods which allow for within-species or "intragenic" as opposed to 25 transgenic transformation of plants. Vectors useful for this approach can therefore be described as intragenic vectors. The invention provides such intragonic vectors and methods of using them to produce intragenic transformed plants without any foreign DNA. It will be understood by those skilled in the art that DNA sequences used to construct such 30 "intragenic vectors" are preferentially derived from DNA sequences (ESTs or cDNAs) known to be expressed in plant genomes. In this manner sequences derived from heterochromatic regions, promoters or introns can be avoided. The use of such sequences for the construction of intragenic vectors may influence the subsequent expression of genes of interest following their transfer to plants via intragenic vectors. 27 The invention provides novel T-DNA border-like sequences from several plant species (as shown in Example 1) formed by combining two to three fragments of genomic DNA, with all fragments being from a single plant species of interest or a closely related species. The 5 common nature of such sequences in plant genomes is shown in Example 1. The invention further provides isolaLed T-DNA-like sequences from several plant species as shown in Example 2. The T-DNA-liko region sequences in Example 2 include the T-DNA like sequences flanked (and delineated) by T-DNA border-like sequences (high-lighted) and 10 additional sequence on either one or both sides of the T-DNA-like sequence. Plant-derived selectable marker sequences which are useful for selecting transformed plant cells and plants harbouring a particular T-DNA-iike sequence include PPga22 (Zuo et al, Curt Opin Biotechnol. 13: 173-80, 2002), Ckil (Kakimoto, Science 274: 982-985, 1996), Esrl 15 (Banno et al., Plant Cell 13: 2609-18, 2001), and dhdps-rI (Ghislain et al, Plant Journal, 8: 733-743, 1995). It is also possible to use pigmentation markers to visually select transformed plant cells and plants, such as the R and Cl genes (Lloyd et al., Science, 258: 1773-1775, 1992; Bodeau and Walbut, Molecular and General Genetics, 233 379-387, 1992). A preferred plant-derived selectable marker is the acetohydroxyacid synthase gene as shown in 20 Example 6 and Example 7. Non-plant derived selectable markers are also described herein, Preferred intragenic vectors of the invention contain a plant-derived selectable marker which function in selection of bacteria harbouring the marker as described in Example 3 and Example 5. 25 The preferred intragenic vectors of the invention consist entirely of plant-derived polynucleotide sequence from the species to he transformed, or from closely related species, such as species interfertile with the plant to be transformed, considered to be within the germplasm pool accessible to traditional plant breeding. Such vectors preferably include a 30 plant-derived origin of replication which is functional in bacteria, particularly in Agrobacterimn species and preferably also in B. coli. The invention provides plant transformation vectors comprising such sequences. Preferred origin of replication sequences include those shown in Example 4. 28 The invention provides novel oxP-like and ft-like recombinase recognition sequences from several plant species as shown in Example 9 and Example 10. Construction of a vector of the invention is described in Example 6 and Example 8. Plant 5 transformation using these vectors is described in Example 7 and Example 8. Example 6 and Example 7 also illustrate the construction and successfd use of a vector with a chimeric T-DNA border-like sequence. In this instance the "right order" is composed of 5'GAC3' from the end of a sequence isolated from Arabidopsis thaliana, with the remainder 10 of the chimeric T-DNA border-like sequence, 5'AGGATATATTGCGC-GGTAAAC3', being derived from the binary vector pART27 (see sequence of pTCI in Example 6). Such chirneric T-DNA border-like sequences are preferably used as the right border when two border-like sequences are used to flank the T-DNA-Iike sequence. When vectors with only one border like sequence are used, the plant derived end (e.g. 5'GRC3') end of the T-DNA border-like 15 sequence must be contiguous with the plant derived sequence(s) destined for integration into a plant genome. The polynucleotide molecules of the invention can be isolated by using a variety of techniques known to those of ordinary sill in the art By way of example, such 20 polynuoleotides can be isolated through use of the polymerase chain reaction (PCR) described in Mullis er al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser, incorporated herein by reference. The polynucleotides of the invention can be amplified using primers, as defined herein, derived from the polynucleotide sequences of the invention. 25 Further methods for isolating polynucleotides of the invention include use of all, or portions of, the disclosed polynuclootide sequences as hybridization probes. The technique of hybridizing labeled polynucleotide probes to polynuclootidos innobilized on solid supports such as nitrocellulose filters or nylon membranes, can be used to screen the genomic or cDNA libraries. Exemplary hybridization and wash conditions are: hybridization for 20 hours at 30 65 0 C in 5. 0 X SSC, 0. 5% sodium dodecyl sulfate, 1 X Denhardt's solution; washing (three washes of twenty minutes each at 55"C) in 1. 0 X SSC, 1% (w/v) sodium dodecyl sulfate, and optionally one wash (for twenty minutes) in 0. 5 X SSC, 1% (w/v) sodium dodecyl sulfate, at 60'C. An optional further wash (for twenty minutes) can be conducted under conditions of 0. I X SSC. 1% (w/v) sodium dodecyl sulfate, at 60'C. 29 The polynucleotide fragments of the invention may be produced by techniques well-known in the art such as restriction endonuclease digestion and oligonucleotide synthesis. 5 A partial polynucicotide sequence may be used, in methods well-known in the art to identify the corresponding further contiguous polynucleotide sequence, Such methods would include PCR-based methods, 5'RACE (Frohman MA, 1993, Methods Enzymol. 218: 340-56) and hybridization- based method, computer/database-based methods. Further, by way of example, inverse PCR permits acquisition of unknown sequences, flanking the polynucleotide 10 sequences disclosed herein, starting with primers based on a known region (Triglia et al., 1998, Nucleic Acids Res 16, 8186, incorporated herein by reference). The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template. Divergent primers are designed from the known region. In order to physically hssemhle full 15 length clones, standard molecular biology approaches can be utilized (Sambrook at al., Molecular Cloning: A Laboratory Manial, 2nd Ed. Cold Spring Harbor Press, 1987). It will be understood by those skilled in the art that in order-to produce intragenic vectors for further species it may be necessary to identify the sequences corresponding to essential or 20 preferred elements of such vectors in other plant species. It will be appreciated by those skilled in the art that this may be achieved by identifying polynucleotide variants of the sequences disclosed. Many methods are known by those skilled in the art for isolating such variant sequences. 25 Variant polynucleotides may be identified using PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Typically, the polynucleotide sequence of a primer, useful to amplify variants of polynucleotide molecules of the invention by PCR, may be based on a sequence encoding a conserved region of the corresponding amino acid sequence. 30 Further methods for identifying variant polynucleotides of the invention include use of all, or portions of, the polynucleotides disclosed herein as hybridization probes to screen plant genomic or cDNA libraries as described above. Typically probes based on a sequence encoding a conserved region of the corresponding amino acid sequence may be used, 30 Hybridisation conditions may also be less stringent than those used when screening for sequences identical to the probe, The variant polynucleotide sequences of the invention, may also be identified by computer 5 based methods well-known to those skilled in the art, using public domain sequence aligmunent algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic Acids Res. 29: 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed 10 (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments. An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]) including BLASTN, BLASTP, 15 BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp://ftp.ncbi.nihov/blIast4 or from the Nadional Center for Biotechnology Information (NCBI), National Library of Medicine, Building 38A, Roorn 8N805, Bethesda, MD 20894 USA. The NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases. BLASTN compares a nucleotide query sequence 20 against a nucleotide sequence database. BLASTP compares an amino acid query sequence against a protein sequence database. BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database, tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames, tBLASTX compares the six-frame translations of a nucleotide query 25 sequence against the six-frame translations of a nuclectide sequence database. The BLAST programs may be used with default parameters or the parameters may be altered as required to refine the screen. The use of the BLAST family of algorithms, including BLASTN, BLASTP, and BLASTX, is 30 described in the publication of Altschul et al., Nucleic Acids Res, 25: 3389-3402, 1997. The "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm, align and identify similar portions of sequences. The hits are arranged in order of the degree of similarity and the 31 length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence. The BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce 5 "Expect" values for alignments. The Expect value (E) indicates the number of hits one can "expect" to see by chance when searching a database of the same size containing random contiguous sequences. The Expect value is used as a significance threshold for determining whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the 10 database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in that database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm. 15 To identify the polynucleotide variants most likely to be functional equivalents of the disclosed sequences, several further computer based approaches are known to those skilled in the art. 20 Multiple sequence alignments of a group of related sequences can be carried out with CLUSTALW (Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-4680, http://www-igbrnc.u-strasbg.fr/Biolnfo/ClustaIW/T html) or T-COFFEE 25 (Cedric Notredame, Desmond G, Higgins, Jaap Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. Mol. Biol. (2000) 302: 205-217)) or PILEUP, which uses progressive, pairwise alignments (Feng and Doolittle, 1987, J. Mol. Evol. 25, 351). Pattern recognition software applications are available for finding motifs or signature 30 sequences. For example, MEME (Multiplc Em for Motif Elicitation) finds motifs and signature sequences in a set of sequences, and MAST (Motif Alignment and Search Tool) uses these motifs to identify similar or the same motifs in query sequences. The MAST results arc provided as a. series of alignments with appropriate statistical data and a visual 32 overview of the motifs found- MEME and MAST were developed at the University of California, San Diego. PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et aL, 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized 5 proteins translated from genomic or cDNA sequences. The PROSITE database (www.expasy.org/prosite) contains biologically significant patterns and profiles and is designed so that it can be used with appropriate computational tools to assign a new sequence to a known family of proteins or to determine which known domain(s) are present in the sequence (Falquet at al, 2002, Nucleic Acids Res. 30, 235) Prosearch is a tool that can 10 search SWISS-PROT and EMBL databases with a given sequence pattern or signature. The fiction of a variant of a polynucleotide of the invention may he assessed by replacing the corresponding sequence in an intragenic vector with the variant sequence and testing the functionality of the vector in a host bacterial cell or in a plant transformation procedure as herein defined. 15 Methods for assembling and manipulating genetic constructs and vectors are well known in the art and are described generally in Sambrook et aL, Moleciular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing, 1987). 20 Numerous traits in plants may also be altered through methods of the invention. Such methods may involve the transformation of plant cells and plants, using a vector of the invention including a genetic construct designed to alter expression of a polynucleotide or polypeptide which modulates such a trait in plant cells and plants. Such methods also include 25 the transformation of plant cells and plants with a combination of the construct of the invention and one or more other constructs designed to alter expression of one or more polynucleotides or polypeptides which modulate such traits in such plant cells and plants. 30 A number of plant transformation strategies are available (e.g. Birch, 1997, Ann Rev Plant Phys Plant Mol Biol, 48, 297). For example, strategies may be designed to increase expression of a polynucleotidelpolypeptide in a plant cell, organ and/or at a particular 33 developmental stage where/when it is normally expressed or to ectopically express a polynucleotidc/polypeptide in a cell, tissue, organ and/or at a particular developmental stage which/when it is not normally expressed. The expressed polynucleotide/polypeptide may be derived from the plant species to be transformed or may be derived from a different plant 5 species. Transformation strategies may be designed to reduce expression of a _ polynucleotide/polypeptide in a plant cell, tissue, organ or at a particular developmental stage which/when it is normally expressed. Such strategies are known as gene silencing strategies. 10 Direct gene transfer involves the uptake of naked DNA by cells and its subsequent integration into the genome (Conner, A.3 and Meredith, C.P., Genetic manipulation of plant cells, pp. 653-688, in The Biochemistry of Plants: A Comprehensive Treatise, Vol 15, Molecular Biology, editor Marcus, A., Academic Press, San Diego; 1989; Petolino, J. Direct DNA 15 delivery into intact cells and tissues, pp.137-143, in Transgenic Plants and Crops, editors Khachatourians et al., Marcel Dekker, New York, 2002,. The cells can include those of intact plants, pollen, seeds, intact plant organs, in vitro cultures of plants, plant parts, tissues and cells or isolated protoplasts. Those skilled in the art will understand that methods to effect direct DNA transfer may involve, but not limited to; passive uptake; the use of 20 electroporation; treatments with polyethylene glycol and related chemicals and their adjuncts; electrophoresis, cell flsion with liposomes or spheroplasts; microinjection, silicon carbide whiskers, and microparticle bombardment Genetic constructs for expression of genes in transgenic plants typically include promoters for 25 driving the expression of one or more cloned polynucleotide, terminators and selectable marker sequences to detect presence of the genetic construct in the transformed plant. The promoters suitable for use it the constructs of this invention are functional in a cell, tissue or organ of a monocot or dicot plant and include cell-, tissue- and organ-specific 30 promoters, cell cycle specific promoters, temporal promoters, inducible promoters, constitutive promoters that are active in most plant tissues, and recombinant promoters, Choice of promoter will depend upon the temporal and spatial expression of the cloned polynucleotide, so desired. The promoters may be those normally associated with a transgene of interest, or promoters which are derived from genos of other plants, viruses, and plant 34 pathogenic bacteria and fungi. Those skilled in the art will, without undue experimentation, be able to select promoters that are suitable for use in modifying and modulating plant traits using genetic constructs comprising the polynucleotide sequences of the invention. Examples of constitutive promoters used in plants include the CaMV 35S promoter, the nopaline 5 synthase promoter and the octopine synthase promoter, and the Ubi 1 promoter from maize. Plant promoters which are active in specific tissues, respond to internal developmental signals or external abiotic or biotic stresses are also described in the scientific literature. Exemplary promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference. 10 Exemplary terminators that are commonly used in plant transfonnation genetic constructs include, e.g., the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators, the Zea mays zein gene terminator, the Oryza saliva ADP-glucose pyrophosphorylase terminator and the Solanvm tuberosum PI-II terminator. 15 Selectable markers commonly used in plant transformation include the neomycin phophotransferase II gene (NPT II) which confers kanamycin resistance, the aadA gene, which confers spectinorycin and streptomycin resistance, the phosphinothricin acetyl transferase (bar gene) for Ignite (AgrEvo) and Basta (oechst) resistance, and the 20 hygromycin phosphotransferase gene (lipt) for hygromycin resistance. It will be understood by those skilled in tihe art that non-plant derived regulatory elements described above may be used in the intragenic vectors of the invention operably linked to selectable markers placed between the recombinase recognition sites. 25 Gene silencing strategies may be focused on the gene itself or regulatory elements which effect expression of the encoded polypeptide. "Regulatory elements" is used here in the widest possible sense and includes other genes which interact with the gene of interest. 30 Genetic constructs designed to decrease or silence the expression of a polynucleotide/polypeptide of the invention may include an antisense copy of a polynucleotide of the invention. [n such constructs the polynucleotide is placed in an antisense orientation with respect to the promoter and terminator. 35 An "antisense" polynucleotide is obtained by inverting a polynucleotide or a segment of the polynucleotide so that the transcript produced will be complementary to the mRNA transcript of the gene, e.g., 5'GATCTA 3' (coding strand) 3 'CTAGAT 5' (antisense strand) 5 3'CUAGAU 5' mRNA 5'GAUCUA 3' antisense RNA Genetic constructs designed for gene silencing may also include an inverted repeat as herein defined, The preferred approach to achieve this is via RNA-interference strategies using genetic constructs encoding self-complementary "hairpin" RNA (Wesley et al., 2001, Plant 10 Journal, 27: 581-590). The transcript formed may undergo complementary base pairing to form a hairpin structure. Usually a spacer of at least 3-5 bp between the repeated region is required to allow hairpin formation. 1s Another silencing approach involves the use of a small antisense RNA targeted to the transcript equivalent to an miRNA (Llave et al, 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the invention is expressly contemplated 20 The term genetic construct as used herein also includes small antisense RNAs and other such polynucleotides effecting gene silencing. Transformation with an expression construct, as herein defined, may also result in gene silencing through a process known as sense suppression (e.g. Napoli et al, 1990, Plant Cell 2, 25 279; de Carvalho Niebel et al., 1995, Plant Cell, 7, 347). In some eases sense suppression may involve over-expression of the whole or a partial coding sequence but may also involve expression of non-coding region of the gene, such as an intron or a 5' or 3' untranslated region (UTR). Chimeric partial sense constructs can be used to coordinately silence multiple genes (Abbott et aL, 2002, Pant Physiol. 128(3): 844-53; Jones et al, 1998, Planta 204: 499 30 505). The use of such sense suppression strategies to silence the expression of a polynucleotide of the invention is also contemplated. 36 The polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding sequence and/or non-coding sequence, such as promoter and/or intron and/or 5' or 3' TIER sequence, or the corresponding gene. 5 Other gene silencing strategies include dominant negative approaches and the use of rib ozyme constructs (McIntyre, 1996, Transgenic Res, 5, 257) Pre-transcriptional silencing may be brought about though mutation of te gene itself or its regulatory elements. Such mutations may include point mutations, frameshifts, insertions, 10 deletions and substitutions. The following are representative publications disclosing genetic transformation protocols that can be used to genetically transform the following plant species: onions (WOOO/44919); peas (Grant et al., 1995 Plant Cell Rep., 15, 254.258; Grant et al., 1998, Plant Science, 139:159 15 164); petunia (Deroles and Gardner, 1988, Plant Molecular Biology, 11: 355-364); Medicago truncatula (Trieu and Harrison 1996, Plant Cell Rep. 16: 6-11); rice (Alam et al, 1999, Plant Cell Rep. 18, 572); maize (US Patent Serial Nos. 5, 177, 010 and 5, 981, 840); wheat (Ortiz et al, 1996, Plant Ccll Rep. 15, 1996, 877); tomato (JS Patent Serial No. 5, 159, 135); potato (Kumar et al., 1996 Plant J. 9, : 821); cassava (Li et al., 1996 Nat. Biotechnology 14, 736); 20 lettuce (Michelmore et al., 1987, Plant Cell Rep. 6, 439); tobacco (Horsch et al, 1985, Science 227, 1229); cotton (US Patent Serial Nos. 5, 846, 797 and 5, 004, 863); grasses (US Patent Nos. 5, 187, 073 and 6. 020, 539); peppermint (Niu e al., 1998, Plant Cell Rep. 17, 165); citrus plants (Pena et at, 1995, Plant Sci.104, 183); caraway (Krens et al., 1997, Plant Cell Rep, 17, 39); banana (US Patent Serial No. 5, 792, 935); soybean (US Patent Nos. 5, 416, 25 011 ; 5, 569, 834 ; 5, 824, 877 ; 5, 563, 04455 and 5, 968, 830); pineapple (US Patent Serial No. 5, 952, 543); poplar (US Patent No. 4, 795, 855); monocots in general (US Patent Nos. 5. 591, 616 and 6, 037, 522); brassica (US Patent Nos. 5, 188, 958 ; 5, 463, 174 and 5, 750, 871); and cereals (US Patent No. 6, 074, 877). It-will be understood by those skilled in the art that the above protocols may be adapted for example, for use with alternative selectable 30 marker for transformation. The plant-derived sequences in the vectors of the invention may be derived from any plant species. 37 In one embodiment the plant-derived sequences in the vectors of the invention are from gymnosperm species. Preferred gymnosperm genera include Cycas, Pseudotsuga, Pinus and Picea. Preferred gymnosperm species include Cycas rumphii, Pseudotsuga menziesii, Pinzus radiate, Pnis taeda, Pinus pinaster, Picea engelmannia x sitchensis, Picea sitchensis and 5 Picea glauca. In a further embodiment the plant-derived sequences in the vectors of the invention are from bryophyte species. Preferred bryophyte genera include Marchanda, Tortula, Physeonitrella and Ceratodon. Preferred bryophyte species include Marchantia polymorpha, Tortula 10 ruralis, Physconitrella patens and Ceratodon purpureous. In a further embodiment the plant-derived sequences in the vectors of the invention are from algae species. Preferred algae genera include Chlamydomonas. Preferred algae species include Chliamydomonas reinhardtii. 15 In a fTrther embodiment the plant-derived sequences in the vectors of the invention are from angiosperm species. Preferred angiosperm genera include Aegilops, Allium, Amborella, Anopterus, Apin, Arabidopsis, Arachis, Asparagus, Atropa, Avena, Beta, Betula, Brassica, Cainellia, Capsicum, Chenopodiun, Cicer, Citrus, CiMtullus, Coffea, Cucumis, Elaeis, 20 Eschscholzia, Eucalyptus, Fagopyrum, Fragaria, Glycine, Gossypium, Helianthus, H1evea, Hordeum, Humulus, Iponoa, Lactuca, Limonium, Linun, Lolium, Lotus, Lycopersicon, Lycoris, Malus, Manihot, Medicago, Meseinbryanthemnu, Musa, Nicutiaa Nuphar, Oiea, Oryza, Persea, Petunia, Phaseolus, Pisum, Plumbago, Poncirus, Populus, Prunus, Puccinellia, Pyrus, Quintinia, Raphanus, Saccharum, Schedonoruy, Secale. Sesamun, 25 Solanum, Sorghum, Spinacia, Thellungiella, Theobroma, Triticum, Vaccinium, V/tis, Za and Zinnia. Preferred angiosperm species include Aegilops speltoidas, Allium cepa, A mborella trichopoda, Anopterus macleayanus, Apium graveolens, Arabidopsis thaliana, Arachis 30 hypogaea, Asparagus officinalis, Atropa belladonna, Avena sativa, Beta vulgaris, Brassica napus, Brassica rapa, Brassica oleracea, Capsicum annuum, Capsicurnfrutescens, Cicer arietinum, Citrullus lanatus, Citrus clementina, Citrus reticulata, Citrus sinensis, Coffea arabice, Coffea canephora, Cueumis sativus, Eiaeis guineesis, Eschscho/zia californica, Eucalyptus tereticornis, Fagopyrun esculentum, Fragaria x ananassa, Glycine max, 38 Gossypium arboreun, Gossypium hirsutum, Gossypium raimondii, Helianthus annuus, Helianthus argophyllus, Hevea brasiliensis, Hordewn vulgare, Humulus lupulus, Ipomoea batatas, Jpomoca nil, Lactuca sativa, Limonium bicolor, Linum usitatissimum, Lolium multiflorum, Lotus corniculatus, Lycopersicon esculentun, Lycopersicon penellii Lycorts 5 longituba, Malus x domestica, Manihot esculenta, Medicago truncatula, Mesembryanthemum crystailinum, Nicotiana benthamiana, Nicotiana tabacum, Nuphar advena, Olea europea, Oryza sativa, Otyza minuta, Pet-sea americana, Petunia hybrida, Phaseolus coccineus, Phaseolus vulgaris, Pisum sativum, Plumbago zeylanica, Poncirus rifohiata, Populus alba x tremula, Populus tremula x tremuloides, Populus tremula, Populus balsamifera x teldoides), 10 Prunus americana, Prunus armeniaca, Prunus domestica, Prunus dulcis, Prunus persica, Puccinellia tenuiflora, Pyrus communis, Quintinia verdonii, Raphanus staivus, Saccharum officinarum, Schedonorus arwundinaceus, Secale cereale, Sesamum indicum, Solanum habrochaites, Solanum nigrum, Solanum tuberosum, Sorghum color, Sorghum propingwiqm, Spinacia oleracea, Thellungiella halophila, Thellungiella salsuginea, Theobroma cacao, 15 Triticwn aestivum, Triticun durum, Trilicum nzonooccwn, Vaceinium corymbosum, Vitis vinifera, Zea mays and Zinnia elegant, Particularly preferred angiosperm genera include Solanum, Petunia and Allium. Particularly preferred angiosperm species include Solanun tuberosum, Petunia hybrida and Allium cepa. 20 The plant calls and plants of the invention may be derived from any plant species. In one embodiment the plant cells and plants of the invention are from gymnosperm species. Preferred gynmospenn genera include Cycas, Pseudossuga, Pinus and Picea. Preferred 25 gymnosperm species include Cycas rumphii, Pseudotsuga menziesii, Pinus radiata, Pins taeda, Pinus pinaster, Picea engelinannia x sitchensi, Picea sitchensis and Picea glauca. In a further embodiment the plant cells and plants of the invention are from bryophyte species. . Preferred bryophyte genera include Marchantia, Tortula, Physcointrella and 30 Ceratodon. Preferred bryophyte species include Marchantia polymorpha, Tortula ruralis, Physcomi/rellapatens and Ceratodon pmpureous. 39 In a further embodiment the plant cells and plants of the invention are from algae species. Preferred algae genera include Chlanydomonas. Preferred algae species include Chlamydomonas reinhardl. 5 In a further embodiment the plant cells and plants of the invention are from angiospern species. Preferred angiosperm genera include Aegilops, Allium, Amborella, Anopterus, Apium, Arabidopsis, Arachis, Asparagw, Atropa, Avena, Beta, Betula, Brassica, Camellia, Capsicum, Chenopodium, Cicer, Citrus, Citrullus, Coffea, Cucumis, Elaeis, Eschscholzia, Eucalyptus, Fagopyrum, Fragaria, Glycine, Gossypium, Helianthus, Hevea, Hordeum , 10 Humulus, 4pomoea, Lactuca, Lirnoniun, Linum, Lolium, Lotus, Lycopersicon, Lycoris, Malus, Manihot, Medicago, Mesembryanthemum, Musa, Nicotian, lNuphar, Olea, Oryza, Persea, Petunia, Phaseolus, Pisum, Plumbago, Ponciru Populus, Prunus, Puccinellia, Pyrus, Quintinia, Raphanus, Saccharum, Schedonorus, Secale, Sesamum, Solanura, Sorghum, Spinacia, Thellungiella, Thedbroma, Triticuin Vaccinium, iis, Zea and Zinnia. 15 Preferred angiospenn species include Aegilops speltoides, Allium cepa, A mborella trichopoda, Anopterus macleayanus, Apium graveolens, Arabidopsis thalana, Arachis hypogaea, Asparagus officinalis, Atropa belladonna, Avena sativa, Beta vulgaris, Brassica 20 napus, Braswica rapa, Brassica oleracea, Capsicun annuum, Capsicumfutescens, Cicer arietinum, Ctrullus lanatus, Citus clementina, Citrus reticulata, Citrus sinensis, Coffea arabica, Coffea eanephoi, Cucunis sativus, Elaeis guineesis, Eschscholzia californica Eucalyptus tereticornis, Fagopyrum esculentum, Fragaria x ananassa, Glycine max, Gossypium arboreum, Gossypium hirsutum, Gossypium raimondi, Helianthus annuus, 25 Helianthus argophyllus, Hevea brasiliensis, Hordeum vulgare, Humulus lupulus, Ipomoea baatas, Iponzoeca ni, Lactuca sativa, Linonium bicolor, Linum us1itatissinum, Lolium multiflorum, Lotus corniculatus, Lycopersicon esculentun, Lycopersicon penellii, Lycoris longituba, Malus x domestica, Manihot esculenta, Medicago trundatula, Mesembryanthemun crystallinum, Nicotiana henthaniana, Nicoi ana tabacum, Nuphar advena, Olea europea, 30 Oiyza saliva, Oryza minuta, Pei-sea americana, Petunia hybrida, Phaseolus coccineus, Phaseolus vulgaris, Pisum sativuin, Plumnbago zeylanica, Poncirus tifoliata, Popuus alba x fremula, Populus tremula x tremuloides, Populus tremula, Populus balsamifera x teldoides), Prws americana, Prunus armeniaca, Prunus domestica, Prunus dulcis, Prunus persica, Puccine/ia tenuizlora, Pyrus communis, Quintinia verdonii, Raphanus staivus, Saceharum 40 officinarum, Schedonorus arundinaceus, Secale cereale, Sesamun indicum, Solanwn habrochaites, Solanum nigrum, Solanwn tuberosum, Sorghwn bicolor, Sorghum propinquum, Spinacia oleracea, Thellungiella halophila, Theilungiella salsug inea, Theobroma cacao, Triticum aestivum, Triticum durum, Triticum monococcum, Vacciniwn corymbosum, Vitis 5 vinifera, Zea mays and Zinnia elegans. Particularly preferred angiosperm genera include Solanum, Petunia and Ailium. Particularly preferred angiosperm species include Solanum tuberosum, Petunia hybrida and Allium cepa. 10 The cells and plants of the invention may be gro-wA in culture, in greenhouses or the field. They may be propagated vegetatively, as well as either selfed or crossed with a different plant strain and the resulting hybrids, with the desired phenotypic characteristics, may be identified. Two or more generations may be grown to ensure that the subject phenotypic characteristics are stably maintained aid inherited. Plants resulting from such standard breeding approaches 15 also form an aspect of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS 20 Figure I shows PCR verification the propagation of plasmid pPOTCOLE2SPEC in E. coli mediated by a potato-derived COLE2-like origin of replication. Lanes I and 2 are plasmid preparations restricted with a BamHI/EcoRl double digest from two independent transformation events of pPOTCOLE2SPEC into E, coli DH5a already possessing pBX243; they show 3.9 kb, 2.5 kb, and 1.5 kb fragments, representing the pBX243 backbone, 25 linearised pPOTCOLE2SPEC, and the pBX243 Rep gene respectively. Lane 3 is a plasmid preparation restricted with a BamHI/EcoRI double digest from a culture transformed with only pBX243 and shows 3.9 kb and 1.5 kb fragments, representing the pBX243 backbone and the pBX243 Rep gene. Lane 4 is the GeneRuler DNA ladder mix #SM0331 (Fermentas, Hanover, Maryland) size marker. 30 Figure 2 shows PCR verification the potato-derived LacO 1-like sequences functioning as a plasnid selectable element by operator-repressor titration. Lane 1 is the GeneRuler DNA ladder mix #SM0331 (Fennentas, Hanover, Maryland) size marker. Lanes 2-6 are plasmid preparations restricted with PstI from five independent transformation events of 41 pBR322POTLACOI into E. coli strain DHllacdapD using repressor titration selection; they show the expected 1.3 kb and 3.8 kb fragments. Lane 7 is a plasmid preparation restricted with Pstr following transformation of pBR322POTLACO1 into A coli strain DHa using ampillicin selection and also shows the expected 1.3 kb and 3.8 kb fragments. Lane 8 is 5 linearised pBR322 visualised as a 4.4 kb fragment. Figure 3 shows PCR verification of Arabidopsis thaliana 'Columbia' transformed with the intragenic vector pTCAHAS. Lanes 1&2, 3&4 and 5&6 are threc A. thaliana lines transformed with the intragenic vector, lanes 1,3,5 using primers E-F, lanes 2,4,6 using 10 primers G+H; lanes 8&9 are untransformed A. thaliana, lane 8 using primers E+F, lane 9 using primers G+H; lanes 10& 11 are no template controls, lane 10 using primers F+F, lane I1 using primers G+H; lanes 12&13 are the intragenic vector pTCAHAS, lane 12 using primers E+F, lane 13 using primers G+H; lanes 7&14 are the 100 bp molecular ruler (170-8206, BioRad laboratorie-s, USA). Primers E+F amplify an expected 643 bp fragment and primers 15 C-H amplify an expected 149 bp fragment from the T-DNA-like region of pTCAHAS. Figure 4 shows PCR verification of potato cultivar 'Iwa' transformed with the intragenic vector pPOTINV. This involved a multiplexed PCR using primers I1J to amplify the 570 bp fragment from the pPOThINV T-DNA-like region and primers K+L to amplify the 1069 bp 20 product from the endogenous actin gene of potato. Lanes 1 &7 are the I kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California), lane 2 is the co-transformed hairy root line #18, lane 3 is the co-transformed hairy root line #74, lane 4 is a control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPOTINV, lane 5 is the intragenic vector pPOTINV, lane 6 is a no template controL 25 Figure 5 shows PCR verification of the absree of Agrobacierium DNA in the samples used for PCR analysis in Figure 4. This involved a PCR using primers M-N to amplify the 590 bp of the Agrohacteriun virG gene. Lanes 1&7 are the I kb plus molecular rul-er 10787-018 (Invitrogen, Carlsbad, California), lane 2 is the couransformed hairy root line #18, lane 3 is 30 the co-transformed hairy root line #74, lane 4 is a control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPOTINV, lane 5 is Agrobacierium strain A4T, laue 6 is a no template control. 42 Figure 6 shows PCR verification of potato cultivar -Iwa' transformed with the intrageni vector pPETINV. This involved PCR using primers 0P to amplify the 447 bp fragment from the pPETINV T-DNA-like region (lanes 2-5) and primers K+L to amplify the 1069 bp product from the endogenous actin gene of potato (lanes 6-8). Lane 1 is the 1 kb plus 5 molecular ruler 10787-018 (Invitrogen, Carlsbad, California); lanes 2 and 6 are the co transformed hairy root line #24; lanes 3 and 7 are a control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPETINV; lane 4 is the intragenie vector pPETINV; hanes 5 and 8 are a no template controls. 10 Figure 7 shows PCR verification of the absence of Agrobacterium DNA in the samples used for PCR analysis in Figure 6, This involved a PCR using primers M+N to amplify the 590 bp of the Agrobacterium virG gene. Lane 1 is the I kb plus molecular ruler 10787-018 (Invitro gen, Carlsbad, Califbrnia), lane 2 is the co-transformed hairy root line #18, lane 3 is a control hairy foot line transformed with Igrobacterium strain A4T without the binary vector 15 pPOTINV, lane 4 is Agrobacterium strain A4T, lane 5 is a no template control. Figure 8 illustrates recombination between the POTLOXP sites mediated by Cre recombinase. Plasmid was isolated from E colt strain 294-Crc transformed with pPO'ILOXP2 and restricted with Sail Expression of Cre recombinase was induced by raising the temperature 20 from 23 "C to 37 *. Lane 1 is the 1 kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California); lane 2 illustrates the expected 3.0 kb and 2.3 kb Sall fragments of unrecombined pPOTLOXP2 isolated from a culture maintained at 23 "C; lanes 3-8 illustrate the 3.0 kb and 1.5 kb Sail fragments expected from Cre-mediated recombination between the POTLOXP sites in six different colonies cultured at 37 IC. 25 Figure 9 illustrates recombination between the POTFRT sites mediated by FLP recombinase. Plasmid was isolated from.. coli strain 294-FLP transformed with pPOTFRT2 and restricted with SalI. Expression of FLP recombinase was induced by raising the temperature from 23 0C to 37 *C. Lanes I and 8 are the GeneRuler DNA ladder mix #SM0331 (Ferinentas, 30 Hanover, Maryland) size marker; lane 2 illustrates the expected 3.0 kb and 1.4 kb SalI fragments of unrecombined pPOTPRT2 isolated from a culture maintained at 23 *C; lanes 3-7 illustrate the 3.0 kb and 1.4kb fragments, and the 1.1 kb SalI fragments expected from FLP mediated recombination between the POTFRT sites in five different colonies cultured at 37 0C. 43 EXAMPLES The invention will now be illustrated with reference to the following non-limiting examples. 5 Example 1 Identification of T-DNA border-like sequences in many plant species Agrobacterium T-DNA borders coniain the following consensus motif 5'GRCAGGATATAT\NNNNKSTMAWN3' 10 (Where R= G or A, K T or G, S = G or C, M= C or A, W - A or T and N = any nucleotide). A search on NCBI GenBank Qtp//wwwncmbi.nih.goy/BLAST_/ and TICTR database (httfp://tiirblast.tigr.org/tg/) using the BLAST tooi "search for short, nearly exact matches" 15 and searching within the EST databases, yielded multiple accession numbers for each motif 5'GACAOATATAT3' and 5'GGCAGGATATAT3' as shown in Table L The search was limited to Viridiplanteae and the expect value was 10000. Searches were also conducted in the EST Database of Japan carried out using Expect values of 10000 and the gap tool off (http://www.ddbi .nig. ac.p). 20 Table. Plant species and DNA accession numbers in which a partial T-DNA border has been identified in EST sequences. All accession numbers were found from searches in the NCBI Genbank EST databases, except for those labelled A which were identified using the TIGR database and those labelled 3 which were found in the EST Database of Japan. 25 Note: ' indicates 5'GRCAGGATAT 2 indicates 5'GRCAGGATA3'; 3 indicates 5'GRCAGGAT3'; 4 indicates 5'GRCAGGA3';and "+" indicates there are many more accessions than the example(s) listed. 30 Plant group and species 5'GACAGGATATAT3' 5'GGCAGGATATAT3' Dicotyledonous plants Camolliaceae 44 Camellia (tea) 2CV013936 CV066981 Cheriopodiaceae Beta vulgaris (beet) 'BI096344 BQ586429 Compositae Lactuca sativa (lettuce) 'BU005745, 'BU005333, fQ851200, BUC11977.i 'BU002323 + Ifelianthus annuus (sunflower) -BU0123919. BU024595, BU018078, BQ976399, BU025229 4 BQ976382 + Zinnia elegans AU288531 AU303793 Convolvulaceae Ipomnoea batatas (sweet potato) CB330857, CB330537, B329905 CB330346, CN330857 + Cruciferae Arabidopsis thaliana AV783572 CB264522 + Bras sica oleracea 2 CV973863 3 CV973875 Brassicanapus |CD812561 'CN737684 Cucurbitaceae Cucums sativus (cucumber) 'CK086108 7CK085499 Ericaceae Vaccinium (blueberry) 2 CV190833 1CF810976 Euphorbiaceae Hevea brasiliensis (rubber) 1CB376888 -CB376996 Manihot esculenta (cassava) 'CK644474 CK647455, CK646256, CK643162 Fagacoac Betula (birch) 'CD276790 'CD278538 Lauraceae Persea americana (avocado) TCK766454, CV457849 CK754032, CK749566 Leguminosae Glycine max (soybean) CX705662, CX548491, C0985845, CD398345, CF922194 CD390961 Lotus corniculatus BP046527 BP085776 + 45 Medicago truncatula CB891412 + CA9218 10 + Pisum sativum (pea) zD861031,CD860484 59175, CD859173 Piswn sativun (pea) - chloroplast BXO5395 Linaceae Linwn usitatissimwn (linseed, CV478515 ICV478657 flax) Malvaccee Gossypiun arboreum (cottori) BQ403352 + BF270004 + Gossypun hirsutumi (cotton) 'CA993786 C0491158, A1729959 Gossypin raimondil C0107555 Mesembryantheniaceae Mesembryanthemum crystallinum AW053481 + Maraceac Humulus lupulus (hop) 4 CD527122 Musaceae Musa (banana) 4 CV012662 Nymphaeaceae Nuphar advena CK753223 CD467171 Oeraceae Olee europaea (olive) 4 0K087200 Papaveraceae Eschscholzia californica CK755701 Pedaliaceae Sesamum indicum (sesame) BU669955 BU668412 Plumbaginaceae Plumbago zeylanica CBS17698 Rosaceae Fragaria x ananassa (strawberry) 'CX309734, C0817569 'CO8 17444, CO381912 Malus x domestica (apple) CN579782 Prunus dowstica Prunuspersca 'M87605S AJ873533 'AJ826265, 'AJ827659 Prunus armeniaca CBS19601 CK754032 + 46 Rubiaceae Coffea arabica (coffee) 1CF89163 I CF589153 Coffea canephora (coffee) Rutaceae Poncirus trifoliate CD574807, CD573690 CD574743 CX672356 + Citrus sinensis - CNI88154 + CB293973 Citrus (grapefruit) DN960139 'DN798417 Salicaece Populus trenwla CK108404 + Populous alba x tremula CF231132 + Populus tremula x tremuloides BU828279 + Populous sp. (poplar) CX659694, CX659667, DN495050, DN484787, CX658712 CV255709 + Solanaceae Capsicum annuum (pepper) C0911113, C0908671, CA524776, BM06678, Capsicunfutescens (pepper) CA515326 + |3BM066170 + Lycopersicon esculentun (tomato) AW217429 BM410480 + Lycopersicon penellit AW399741 Nicotiana bentham iana CI297930 + CK286647 + Nicotiana tabacum daL29276 Solaman tuberosum (potato) CN516032 + CK716936 + Sterculiaceae Theobroma cacao (cacao) 'CA797461, 'CA797357, 'CA795783 'CA797340 Umbelliferae Apium graveolens (celery) BU693260 'CN254199 Vitaceac Vitis vimfera (grape) CD715300, CD714256, CB3981221, CX017627, CD009006 CN547415 + Monocotyledonous plants Amaryllidaceae 47 Lycoris longituba CN447505 CN448914 Gramineac Aegilops speltoides BF292132 Jordeum vulgare (barley) DN184623, DN184566, CA031595, DN182886, DN177451, CK567740 + DN177809, DN177690 + Lohium multifofirum (ryegrass) AU249845 Oryza sativa (rice) - CR278518, CR755701 + CK07R41 1, CK068012, CK056225, CB682490 + Puccinellia tenuiflora CN486642 Saccharum (sugarcane) CF573560 Saccharun officinarum CF576361, CA293676 + CA243368, CA235389, (sugarcane) CA225160 + Sorghum bicolor (sorghum) CN131489, CN135330, CD426230, CD424405 CN124024 Sorghum propinquum BG05 1239 + Triticun aestivum (bread wheat) CV777378, CV776448, BJ319521, BJ318204, CV764]325, CK216594 CK152028 + Triticwn durun (pasta wheat) AJ716746 Secale cereal (rye) BF145815 BE586285 Zea mays (corn, maize, sweetcorn) DN221450, CF050111, DN223506, DN222326, CR370367, CF055801 + DN212047, CF057191 + Liliaceae Allurm cepa (onion) CF452050 + CF445160 + Asparagus officinalis (asparagus) 1CV290039 CV289577 Palmae Efacis guineesis (oil palm) Gymnosperms Cycas rwuphii CB090878 Picea glauca C0242316 C0484796, C0474325, C0257134, CK439582 + Picea sitchensis C0223865 C0226349, C0225190 Picea sp.
AC
0 2 5 1892, TC8803, 48 TC10688 Pius pinaster BX784355 + Pinus radiata "AA230194 AA220891, AA220909 Pinus taeda CF666840 + CF672772 + Bryophytes Ceratodon purpureus AW098060 PhysComitrellapatens BJ586625 + BJ585772 Tortula ruralis CN 206945 Algae Chlanydomoias reinhardtii BM002336 + BI717507 + The initial 5'GRCAGGATATAT3' of the T-DNA border-like rnotif is less likely to be 5 identified in database searches than the shorter sequence 5'KSTMAWN3'. If the entire border sequence is formed using 2 EST sequences as shown in Example 2 of th.e patent application, then a second BLAST search is undertaken using 5'KSTMAWN3' from known T-DNA border sequences. A list of such sequences arc: 5'TGTCATG3' 5'TGTAAAC3', 5'GGTAAAC3', 5'TGTAAAA3', 5'GGTAAAA3'; which correspond to the following 10 border sequences: 5'gacaggatatatgttcttgtcatg3' (pRi), 5'gacaggatatatggcgggtaaac3' (pTiT37 ard pTiC58), 5'ggcaggatatatcgaggtgtaaaa3' (pTil5955), 5'ggcaggatatattgtggtgtaa aC3' (pART27 lb) and 5'gacaggatatattggcgggtaaac3' (pART27 rb). BLAST searches using these sequences produce multiple matches. For example just within 15 Solanum tuberosvm (a plant whose genorme has not been completely sequenced), a search (BLAST "search for short, nearly exact matches" Expect 20000 and descriptions 1000) for only 5'TGTAAAC3' in NCBI GenDank yields 997 exact matches of which 985 are . tuberosun ESTs (search performed 2 June 2004). 20 Alternatively, the sequences defined in Table I can be used for the design of "chimeric right borders" for plant-dervied T-DNA-like sequences. 49 Example 2 Identification of T-DNA-like regions from plant genomes The design of T-DNA- like regions for possible intragenic vectors was undertaken by searching plant EST databases for Agrobacter tum border-like sequences. Limiting searches to 5 EST sequences facilitates the design of intragenic vectors by: 1. The base DNA making up the T-DNA-like region (including the T-DNA-like sequence and additional sequence at either one or both sides of the T-DNA-like sequence) does not involve regulatory elements such as promoters that may influence expression of inserted target genes; and 10 2. The DNA on which the T-DNA-like region is based is not derived from heterochromatic regions (non coding, non expressed, condensed DNA) as this may suppress activity of the genes intended for transfer. BLAST searches were conducted as described by Altschul et at. (Gapped BLAST and PSI BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25: 3389 15 3402, 1997). Border sequences used to search the databases: Sequence motifs used to search the databases were 5'GACAGGATATAT3' or 5'GGCAGGATATAT3', 5'TGTAAAC3', 5'GGTAAAC3', 5'TOTAAAA3', 20 5'GGTAAAA3. Other known borders were used as query sequences, these being: 5'GACAGGATATATGTTCTTGTCATG3' (pRi) 5'GACAGGATATATTGC4CGGGTAAAC3' (pTiT37 and pTiC5 8) 5'GGCAGGATATATCGAGGTGTAAAA3' (pTil5955) 5'GGCAGGATATATTGTGGTGTAAAC3' (pART27 lb) 25 5'GACAGGATATATTGOCGGOTAAAC3' (pART27 rb) Potato, Petunia and tomato vectors NCBI BLAST - www.ncbi.nlm.nih.gov/BLAST/ blastt" and "search for short, nearly exact matches" was used to search the EST database. Expect values of 10000 or 20000 (dependent 30 cn word size) were used and the search was limited by entrez query, potato (Solanurm), tomato (Lycopersieon), or Petunia. All Petunia EST sequences from the NCBI site were also downloaded in FASTA format and searched using the "find" tool in Microsoft Notepad. Solanaceae genomics network - http://soldb.cit.comell.edu/cgi-bin/tools/blast/simple.pl 50 BLAST settings included expect values of 10,000 (due to short sequences) and the default settings. All searches were done in EST databases. Unigene sequences were identified using the EST searches. 5 Pinus, Nicotiana, Medicago, apple and onion vectors NCBI BLAST - www.ncbi.nrlm.nih.gov/fBLAST/ BLAST was carried out as above with an Expect value of 10,000 and limited by entrez query to Pinus, Nicotiana, Medicago, apple or onion (Alliun). 10 Rice vector NCBI BLAST - www.ncbi.nlm.nih.gov/BLAST. Settings were as above but limited by entrez query rice or Oryza. TIGR - http://tigrblast-tir.org/tgi (searched unique gene indices). Used an expect value of 10,000 and matrix blosum62 or blosumlO0. All other values were the default settings. The 15 searches identified some TC# sequences (tentative consensus sequences) and ESTs containing the region of interest were identified from these. Staff - htpLeb~staff.orip/. The RGP EST database was used to search for ESTs containing the sequences of interest, using Expect values of 10000 and the remaining options at default settings. 20 Design of extended intragenic T-DNA- like regions ESTs were identified that showed sequence identity to parts of the Agrobacteriun border-like sequences. These identified EST sequences were then assessed for homology, length of sequence flanking the borders and unique restriction sites. This was carried out using 25 DNAMAN (version 3.2, Lynnon BioSoft. copyright©1994-1997). ESTs were adjoined (usually 3 ESTs) to give a T-DNA-like region containing two border sequences, unique restriction sits between the border sequences (that can be used as cloning sites) and extra plant EST sequence beyond the borders to minimize the opportunity for non-intragenic vector backbone sequences being transferred with the T-DNA-like region into plant genomes. 30 Multiple intragenic T-DNA-like regions were designed and compared. Those designed to have the optimum sequence and useful unique restriction sites are presented below. T-DNA-like region of a potato intragenic vector 51 This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sanl sites that are underlined. The nucleotides in italics arc not part of the potato genome sequence. Nucleotides 6- 334 are the reverse complement of nucleotides 315 - 643 of sgn-U179068. 5 Nucleotides 335 - 974 are nucleotides 131 - 770 of sgn-U174278, Nucleotides 975 - 1265 are nucleotides 117 - 407 of CN216800. The T-DNA border-like sequences are shown in bold. The left border is nucleotides 314 - 337 and the right border is nucleotides 957 - 980. Unique restriction sites in the resulting binary 10 vector that are located within the T-DNA-like region are: Aflil at 611 AgeI at 518 ApaBI at 912 Asul at 516 15 AvaI at 357 Avail at 516 BanHI at 687 BstD102I at 514 Cfi-10I at 518 20 CfrI at 723 G l at 507 CspI at 516 EcoHl- at 683 EcoRI at 340 25 HaeTI at 725 HgiAI at 916 MaeII at 405 NalH at 875 PinAI at 518 30 Scil at 359 Xbal at 433 Xhol at 357 Xholl at 687 52 There are also two EcoRV sites within the T-DNA-like region (698 and 853) that could be used as cloning sites. 1 GTCGACAGTA AAACTTGCAC CTGGAATAAG GTTTTCATTC TTCACAGGAG GCA7TCTCACT 5 61 CTTTCTAGCA GGTCTTGAAC GCTTAGATTG AACAGATGTA GGACTCACAT CIGATATGGA 121 GGATTCTTGA CTTGTTTCAG CAGCATCAGA TGAAGCTTCT GAGACTTCAC CTGATCCATC 181 ATCTGTAGCA GTTGCTTCTA CTTCTTCCAC TGCTACATCA GTCTCAGTTG CTGATACTAT 241 AAGACCTCTT AATTTAGGTC GTAAAATGCA ACCAACTCTA AAATGGGAA ACAATTTAAT 301 AGATGC- GAC AGAGGCACGA TATATTTT-G GGTAAACGGG AAITCTTCAG CAGTT GCTCG 10 361 AGGGAGATTG GCGGTGCITT CAGCTCACCT TGCAGCTTCA CTC-ACGTCT CCGATTTAAC 421 AACCTTCAAA CTTCTAGAAA CTTCCGGTGT ATCCGCCGTT TCCGGCGTTG CACCTCCGCC 481 GAATCTAAAA GGTGCGTTGA CGATCATCGA TGAGCGGACC GGTAAGAAGT ATCCGGTTCA 541 GGTTTCTGAG GATCGGCACTA TCAAAGCCAC CGACTTAAAG AAGATAACAA CAGGACAGAA 601 TGATAAAGGT CTTAAGCTTT ATGATCCAGG CTATCTCAAC ACAGCACCTG TTAGGTCATC 15 661 AATATSCTAT ATAGATGGTC ATGCCGGGAT CCTTAGATAT CGAGGCTACC CTATTGAAGA 221 GCTGGCCGAG GGAAGTTCCT TCTTGGAAGT GGCATATCTT TTGTTGTATG GTAATTTACC 71 ATCTGAC-AAC CAGTTAGCAG ACTGGGAGTT CACAGTTTCA CAGCATTCAG CGGTTCCACA 841 AGGACTCTTG GATATCATAC AGTCAATGCC CCATGATGCT CATCCAATGG GOGTTCTTQT 901 CAGTGCAATG ACTGCTCTTT CCCTTTTTCP. TCCTGATGCA AATCCAGCTC TGAGAGGACA 20 961 GGATATATAC AkTGTAAAC AATTTAAAAG CATATCCTGG CACTGCTCAA TATATGAGGT 1021 GGCCCCGAGA AGCAGG ACC AATGTGTCCT CATCAAGAGA TGCATTCTTT ACCAATCCAA. 181 CGGTCPAAC ATACTACAAG TCTTTTGTCA AGGCTATTGT GACAAGAXAAA AACTCTATAA 1141 GTGGAGTTAA ATATTCACAA CAGCCCGCCA TATTTGCGTG GGAACTCATA AATGAGCCTC 1201 GTTGTGAATC CAGTTCATCA GCTGCTGCTC TCCAGGCGTG GATAGCAGAG ATGGCIGGAr 25 1261 TTGTCGAC (SEQ ID NO:I) T-DNA-like region of a petunia intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the SalI sites that are underlined. The nucleotides in italics are not 30 part of the petunia genomre sequence. Nucleotides 6-399 are the complete sequence of the 394 nucleotide fragment from sgn e521144. Nucleotides 400-855 are the reverse complement of nucleotides 85-540 from sgn-e534315. Nueleotides 856-1071 are the reverse complement of nucleotides 121-336 from sgn-u20769 1 35 The T-DNA border-like sequences are shown in bold. The left border is nucleotides 347-370 and right border is nuclectides 844-867. Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are: 53 AccIII at 392 Agel at 788 BbvI at 453 BspMll at 392 5 Bs711 at 453 Cfi10T at 788 ClaI site at 398 Fnu4Hl at 442 Mae at 665 10 Nsil at 752 PinAI at 788 There are also two AspI sites (RCATG/Y) within the T-DNA-like region (616 and 755) that could be used as cloning sites. The most useful restriction site for cloning into the T-DNA like region is the Clal site which is shown in underlined bold. 15 1 GTCGACTTTA TGATCCTGGC TATCTCAACA CAGCGCCTGT TCGGTCATCA A'ATGTTATA 61 TAGATGGTGA TG(:CCGGGATC CTAGGTATC GAGGTTACCC TATTGAAGAG CTCrCTGAsC 121 GAAGCTCCTT CTTGGAAGTG GCTTATCTTT TATTGTACGG TAATTTGCCA YCTGAGAACC 101 AGTTGGCAGA CTGTGACTTC ACAGTTTCAC AACATTCAGC AGTTCCACAA GGACTCCTTG 20 241 GATATCATAC AGTCAATGCC CCATYGATGCT CATCCGATGG GTGTTCTTGT CAGTSCAATG 301 AGCGCTCTTT CTGTCTTTCA CCCTGATGCC AATCCAGCTC TTAGGGGACA GGATATATAC 361 AAGTCTAAAC AAATGAGACA TAAACAAATA GTCCGGATCG ATACGTGAAG ATCAAAATGA 421 AAAGGGGAGG CGATAGAtTTA GCAGCATGAG CCTATATTTC TCTCACAAAA ATICCCAGAT 481 ATTCGACACA ATAGCTCTAA CAACACTGAG CTTTTGATTA CTTGGGTCAC TTCTTCATTT 25 541 CTCTATCCTC TGTTCAGTCT TTTCCTCTGA TTTAGTTTCT GCATCATAAG TTTTGCCAAA 601 GCCAAGTTCT GACATGTCTT GCTTTGCCAT CAAATTCTTC "CCATACGAC ACTCCAGGTA 661 CTTCCTAGAG AGGTGTCTAC ACTGCTCAGA TTTATGCCCA GCGGATTTTA GACAACTAAG 721 G-TATTCCTTC TTCTCCACGT CACATAAATG CATGTGATCC AAAGGGAAAA CTCCTTTTTC 781 TGGTGGAACC GGTCTCAATC CTCTATT2CC ACCAAATGCT CCCCCTGCAC TCATTACGGA 30 841 GATGGCAGGA TATATGTTCT TGTCATGGAA TAGGCCACTG CTTTCAGCTC- TCTGCAGACC 901 GTCAAGTGTA CGTTGAGCCA CAGCCCATTG TGCTTCCCTC TCACCTTTTC CGTAATCCTT 961 CTTGGTTGTG AAGGCAGTCT TATTCTGCAT CATTGATTGC CAGGCGTCAC CACTCAACGT 1021 GTAACCGCTG ATGAATTTAA GAATATCAAG AGGGAAATAG GTGATAATTG TCGAC (SEQ ID NO:2) 35 T-DNA-like region of a tomato (Lycopersicon esculentwn) intragenic vector: 54 This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sall sites that are underlined. The nucleotides in italics are not part of the tomato genome sequence. Nucleotides 5 - 537 are nucleotides 2-534 of SGN-E260320, 5 Nucleotides 538 - 976 are the reverse complement of nucleotides 79 - 517 of SGN-E291502 Nucleotides 977 - 1188 are the reverse complement of nucleotides I - 212 of CK575027. The T-DNA border-like sequences are shown in bold. The left border is nucleotides 375 - 398 and the right border nucleotides 960 - 983, The restriction sites and positions that could be 10 used for cloning within the T-DNA are shown below (as calculated by DNAMAN): Alw26I at 881 AlwNI at 876p Bbyl at 798, 843 and 442 BgI at 740 15 Bsp14071 at528 .PspMI at 705 Bs[71I at 798, 843 and 442 ClaI at 637 Eco311 at 881 20 Eco571 at 787 EcoNI at 431 Fnu4H at 456, 787 and 832 Mael at 573, 711 and 744 Mfel at 444 25 MspAl at 455 Ndel at 511 NspBIJ at 455 NspI at 535 and 583 PstI at 833 30 PvulI at 455 Rsal at 530 Style at 427 XcmI at 925 55 l GTCGACAACA GGACAGAATG ATAAGGGTCT TAAGCTTTAT GATCCAGGCT ATCTCAACAC 61 GGCACCTGTT AGGTCATCAA TATGTTATAT TGATGGTGAT GCCGGGATCC TTAGATAT2CG 121 AGGCTACCCT ATTGAAC-AGC TGGCCGAGC-G AAGTTCCTTC TTGGAAGTGG CATATCTTTT 5 181 GTTGTATGGT AATTTACCAT CTGAGAATCA GTTAGCAGAC TGGGAGTTCA CAGTTTCACA 241 GCATTOAGCA GTTCCACAAG GACTCTTGGA TATOATACAC TCAATGCCAC ATGATGCTCA 301 TCCAATGGGG GTTCTTGTCA GTGCAATGAG TGCTCTTTCC GITTTTCATC CTGATGC5AAA 361 TCCAGCTCTG AGAGGGCAGG ATATATACAA GTCTAAACAA CTGACAGATA AACAAATAGT 421 TCGGATUCTT GGCAAGGCAC CTACAATT GC TACAGCTGCT TACTTAAGAA TG-CTGGCAG I0 481 GCCACCTGTC CTTCCATCCA ACAATCTCTC ATATGCGGAG AACT1TCTTGT ACATGCTTGC 541 TTCCTACATC CTTTACATAA CTATCACTCA ACCTAGAAAC ATGCACCAAT CCATCCGPAA 601 AAGCTCCAAA ATCAATAAAA GCACCGAATG GCTGTATCGA TCTGACCTTT CCAGGAAAAG 661 TiGCACCTGG AATAAGGTCT TCATTCTTCA CAGGAGGCAT CTCACTCTTT CTAGCAGGTC 721 TTGAACGCTT AGACTGAACA GATCTAGGAC TCACATCTGA TACAGAGGAT TCTTCACTTA 15 781 TTTCAGCAGC ATCAGATGAA GCTTCAGCAA CTCCACCAGA TCCATCATCT GCAGCAGTTG 841 CTTCTACTTC TTCCACTGCT ACATCGGTTT CAGTTGCTGA TACTACGAGA CCTCTTAATT 901 TATGTCGTAA AATGCAACCA ACTCTAPAAT GGGGAAACAA TTTAATAGAT GTTGACAGGG 961 GCAGGATATA TTTTCTGTA AACCTGTTTC TTGCACTAAT CCTGCTTTGT CTTCCTCAGT 1021 TGGATAAGGC CACTTAGAAT GTGATTGCCA CCAAGCTTTC AACACAGATG TAGTATCACC 20 1081 AGGCAGTTTT CTGCTCTTC TTTTJCGTAA AATTTCCTCT CTAMTGTCAA CAATTTTTTC 1141 CTTATAACCC TGTTTGAGTT CATGCTTGAG TTCTTGCCTA ACACGCTCGT CGAC (SEQ ID NO:3) T-DNA-like region of a Nicotiana benthamiana intragenic vector 25 This sequence can be ligated into pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203 1207) backbone using the Sall sites that are underlined. The nucleotides in italics are not in the N benthamiana genume sequence. Nucleotides 5 - 853 are nucleotides I1I - 959 of CK292156 Nucleotides 854 - 1469 are the reverse complement of nucleotides 81-696 of CK286377, 30 Nucleotides 1470 - 1787 are nucleotides 285 - 602 of CN748849. The T-DNA border-like sequences are shown in bold. The left border is nucleotides 566 589 and the right border is nucleotides 1455 - 1478. Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are: 35 AccIIl at 611 AfilI at 654 AhaIII at 1160 56 BanHI at 614 Ds1 at 1362 Bsp14071 at 719 BspMI at 611 5 Dral at 1160 EcoNT at 622 Maell at 840 NspI at 726 ScaI at 921 10 Sspl at 1420 VspI at 1085 XhoII.at 614 There are also two AvaI sites (773 and 1072), two BanI sites (627 and 906), two HaeIII (672 15 and 1393), three MaeI sites (727, 1182 and 1355), and three NlaV sites (616, 629 and 908) within the T-DNA-like region that could be used as cloning sites. I OTCGACCTCG CCGCTTCAGT CAATCTCTCC GATTCCAAAC TTTTAGAJIAC TTCCGTTGTA 61. TCCGCCACTT CCGTCCGTCGC GCCGCCGCCG AATCTAAAAG GCGCTTTGAC GATCATCGAT 20 121 GAGCGAACCG GTAAGAGGTA TCCAGTTCAA GTTTCGGAGG AAGGCACTAT CAAAGCCACC Iu1 GACTTGAAAA AGATAACAGC AGGACATAAT GATAAGGGTC TCAAGCTTTA TGATCCGGGA 241 TATCTCAACA CAGCACCTGT TCGGTCATCA ATATGTTATA TAFlGACTA TGCTGGTATC 301 CTTAGATATC C-AGGTTACCC AATTGAAGAG CTGGCTGAGG GAAGTTCCTT CTTGGAAGTG 361 GCTTATCTTT TGATGTATGG TAATTTACCA TCTGAGAACC AGTTGGCAGA TTGGGAGTTC 25 421 ACAGTTTCAC AACATTCAGC AGTTCCACA GGAATCATGG ATATTATACA TTCGATGCCC 481 CATGATGCTC ATCCAATGGG TGTTCTTGTC AGCGCAATGA GTGCTCTITC TGTCTTTCAT 541 CCTGATGCCA ATCCAGCTCT GAGACGACAG GATATATACA AGTOTAAACA AGTGACAGAT 601 AAACAAATAG TCCGGATCCT TGGCAAGGCA CCTACAATTG CTGCGGCTCC TTACTTAAGA G61 ATGGCTGGAA GGCCACCTGT CCTTCCATCC AACAATCTCT CTTATGCAGA GAACTTCTTG 30 721 - TACATGCTAG ATTCATTAGG TAATAGGTCT TACAA4ACCCA ATCCTCGACT CGCTCGGGTG 781 CTCGACATTC TTTTCATATT ACACGCGGAA CATGAAATGA ATTGCTCTAC TGCT3CAGCA 841 CGTCATCTTG CTTAAATGCA ACTGCTCTAT TTTGTGTCAG ATTTGGTGA AAAATGCACT 901 GTTTTGGCAC CATAAGTTAG TACTTTTGGA CAACTTTTTG G''GAACCAAA ATCTGTCCAA 961 AATGACTTGT TTACCTACTT AAAGACGTCA TTTTTTCATA CCAGGGGACA TCCCCGACAT 35 1021 OCCAGGATAC ATAGCTTTTG AAAAATTTTT TACACTCAAG AATACACAAA ACTCGGGAGC 1081 AAAATTAATA GCTGAATGTT TAATACTAAG CTGAAACTTG AGAGTTTTGG AGTGAGTTTT 1141 TTGAGAGAAA ATAACACTTT AAAAAACAAA AGTCCATACA GCTAGTTTAT AGTTTTTCTT 57 1201 TCACTAAAGA TGCTGACTTT TACGGTTTGT TTTTGGTTGT TTTGGGTTCA ATTTATTGCT 1261 GTTTTTTTTA CTATTTTTAC TGTCACTGCT GCTGCATTTT TGCTACTGCT GTATTTTTGC 1321 TCTTCAGGTA ACCTGAGAAG CTTATTTTTT GATACTAGCC ACTCGTGTTG TATTTGTCCT 1381 TTTTAATTTA AGGCCAAATA GTTTCAGTTG TAGAAGTAAT ATTTTCTCCT TTCATTAGTA 5 1441 AAGTTCAATT AAAAGGCAGG ATATATTGTG ATGTAAACAC CGTCCTGAG TGTACCAGCT 1501 AAGGACAAGG GATCAAAGAA TTTGCCGCCA GC-GTAACCCT GTTCTCCAGT GAACTTGGCA 1561 AAGTTCTCAG CACTCTTGGA CCATGGAGTT GCCCACTCTA CTGACTGAGA CTCAGGGTTG 1621 AAGAAGTCCA CCCACCTTTT GCTCTCAACC CACCCCATGA GTAAAGTTG AGTCGCCAAGA 1681 AGTGAGCCAA AAGAGAAAGT GCAATAGCAC CAGGGTCAGC ACCAGCCICG A.ACCATGGGA 10 1741 TGCCACCGA GGCTTG-ACCA ACAAAGAGCC CAATACTGCA GCCATTGTCG AC (SEQ ID NO:4) T-DNA-like region of an apple intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 15 1203-1207) backbone using the SalI sites that are underlined. The nucleotides in italics are not part of the apple genome sequence. Nucleotides 5 - 246 are nucleotides 1 - 242 of CN862631. Nucleotides 247 - 64-4 are the reverse complement of nuclecotides 28 .- 425 of CN94253 1. Nucleotides 645 - 943 are the reverse complement of nucleotides 1 - 299 of C0541348, 20 The T-DNA border-like sequences are shown in bold. The left border is nucleotides 229 252 and the right border is nucleotides 627 - 650. The restriction sites and positions that could be used for cloning within the T-DNA are shown below: Acll at 392 25 AluI at 338 Aiw261 at 593 AsuI at 353 and 387 AvaI at 270 AvaII at 353 30 BanI at 415 BRaGI at 374 and 466 Bspl2861 at 418 BsID 1021 at 262 Cal at 466 35 EcoHI at 269 and 270 58 EcoNI at 348 EcoRV at 438 FnuDI at 392 Fold at 619 and 235 5 Hhal at 394 HinPl I at 392 Ipal at 565 MaefI at 449 MaeII at 509 10 MspAll at 400 VlaIV at 289 and 417 NspBII at 400 Pvul at 466 RleAl at 269 15 ScrFl at 271 and 272 Sdul at 418 SmaI at 272 StuI at 653 ThaI at 392 20 XhoII at 586 and 818 Xmal at 270 XorII at 466 1 GTCGACTAAT GAGGCTTTGA TCTACCACAA GGCTTTTCCA ATGCCGGCAT TGTCATACAA 25 61 GTTTCAGAAC ACAGACTCAC TTTCCGGCCA TGACACAGAT GATGCTGCAC AGTTTATCTC 121 TTCCGTTTGT TGGCGAGGCC AAACCTCCAC CTTAATTGCT GCAIATTCGA CGGGGAATAT 181 A&AAATTTTG GAGATGGTTT GATGATCTCC AAGGTGATTC TTGAATCTGG CAGGATATAT 241 2GGGTGGTCA TCCCACATCG AGCGGATCAC CCGGGAGAAG GTGAACGGTT CCACCGTCAA 301 TGTCGGCATC AAC(2CCCTCC AAGGTCGTCA TCACCAAGCT CCGCCTCGAC AAGGACCCCA 30 361 AAGTTCTGCT CGACCGCAAA SGGCCAAGGGC CGCGCCGCCG CTGACAACGA CAAGGGCACC 421 AAC-TTCACTG CCGAGGATAT CATGCAGAAC GTCGATTGAT TTCGATCGAT TTCATTTCGG 481 TTTGTGTTTT TGTTAGTTAA ATGAAAGTAG TAACTGTCAA GTTAAGCACT TTAGTCGGAA 541 TCACTTTTAA TTTGAAGTAT GCGTTAACGG ATTTGGTGTT TAATCGGATC TTCGATTTGA 601 CACATGGATG GATTTGTGCT TTTTTTGACA GGATATATTA TATTGTMAC AGGCCTCCCT 35 661 CAGACGATAC AAATGAACCC TCATGTAAAT TTGTTTCATT ATTTATTCTC ATTAACAATG 721 ACTAACACAC AAATATAAAA GAAATAAATC ACATTTGGGG TCTTGTCTGG ACAACATAGA 59 781 GTTTACCGTC CCTGATCACG CCTTCAATGT CTTGTGGAGA TCCATACAGT TCCTCGATTG 841 CACTTCCTGC ACGAGCAATG CTAGAGAGGA TTGTCTTGCG AAAGTTTCCG TCAACCATAA 901 GCGGGTCAGA TGAGTAGTCG ACCAAGACTT TC'-CTTCCTC GTC (SEQ ID NO:5) 5 T-DNA-llke region of a Medicago truneatula intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined. The nucleotides in italics are not part of the M trunatula genome sequence. 10 Nucleotides 6-357 are nucleotides 2- 353 of CA9218 10. Nucleotidos 358 - 694 are nucleoctides 112 - 448 of AL375389. Nucleotides 695 - 1055 are the reverse complement of nucleotides 2-362 of CF069972. The T-DNA border-like sequence is shown in bold. The left border is nueleotides 339 - 362 15 and the right border is nucleotides 677 - 700. Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are: AccI at 403 Al/IT at 465 Agel at 409 20 AsuII at 522 BsaOI at 410 BsmIat 539 Cfr101 at 409 Csp45I at 522 25 HpaI at 410 Maeli at 391 MboII at 511 MJp at 4 10 NIaIV at 585 30 PinAl at 409 Rsal at 394 There are also two AhaIII sites (462 and 567), two DraI sites (462 and 567) and three TaqI sites (522, 615 and 636) that could be used as cloning sites. 60 I GTCGACTCAT TAAACAAATA AAAGPACTAT TCAAATGTTT AGCACATTTG AAACTGAGTC 61 AGCATAAAAA CATTTACCAT CCTACTTTAA CTAGTTCAGA CGCAACCAAA ACACCATG4A 5 1.21 ACTTAATTGC ATAGGAAAGC ACCAACCTGT TTCAGCAGCA AGACATGCTG ACTACAGGTC 181 AACTACTGTT TCTGCATAAT AACTATTTAT CAACTACTAA TATTOCATGG TAGAATAGCC 241 ATCAAAACCA TCATTGCGCA GCAGAGGGTC AAAAAGGAAC AATGATTTTC AACAGTTACT 301. CCAAGGATAA CTGATCCTCC ACCTCGTAAC AACTTATTGG CAGGATATAT TACCATGTAA 361 AATTCTAGGC TATGTTTACA AAAAAATTGA ACGTACTTAA TGTATACGAC CGGTAAGGA 10 421 GAAAAAGGAA GTATAAGTCA CTTAATTTAA TTTTTTAACT TTAAACATGT' TTTTTAGGAG 481 GCACAATTAT AACTTAAAM TGTAAGGAAA ACCTATTTTC TTCGAATATA TAGATTTGGC 541 ATTCCATTTT AGTTAAGGAG TTAATTTAAA AATATGAAAG TAGGAGCCTC TGTTCGTAAA 601 ATTTGTGAAA AATGTCGATT GATACGCAGG CGAGGTCGAA TTATAGTAAT TTGTTCCAAC 661 CCAATAACAA ATACAACCCA GGATATATTT AACTGTAAAC GACCATGAGC CCTGTGCTCT 15 721 GCAGG7GCAT GCCAATGAAG TTGTTTCAAT GAATAATTCA TTCCATTTAT ATTAATATCG 781 CGCACTTTTC CTTCAVATG CACCCCAATA CTGTATTGGT GGTTAACAAG TGTGGCATTT 81 GTAGGAAGGT AGTTTCTGTC TAAGGATTTC ATLTACATTGT TCACAACAAT ATTTCTCATT 901 GCAAC-ATCCA CTGGACTCTG TCCTTTCCCA TTTGACATCG CTGCGAATGA TTTTTTAGT 961 GTTCCCCATT TCAGAG-ACC ATTTGQTCCA ATATAACTAA AATTAACCGA ATCATGATTT 20 1021 GCTGAAG'VGC ATAGAGCCAA AGCAGCTATG AAAGGTCGAC (SEQ ID NO:6) T-DNA-like region of an onion intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 25 1203-1207) backbone using the Sal sites that are underlined. The nueleotides in italics are not part of the onion genome sequence. Nucleotides 5 - 537 are nucleotides 4 - 536 of CF449263. Nucleotides 538 - 1186 are nucleotides 94 -742 of CF441521. Nucleotides 1187 - 1503 ae nucleotidos 162-478 of CF452730. 30 The T-DNA border-like sequences are shown in bold. The left border is nucleotides 520 543 and the right border is nucleotides 1169 - 1192. Unique restriction sites in the resulting binary vector that are located in the T-DNA-like region are: AccI at 2 and 739 35 Asul at 1046 Avall at 1046 BclI at 1124 61 Cial at 556 DrallI at 869 Eco57I at 910 and 975 HindIIl at 628 5 MfeI at 852 Ndel at 1006 PJIMI at 649 RsaI at 999 SapI at 580 10 Xbalat578 I GTCGACTTCC CTTTCCTCTUA CTCCACTTGT TTCTCGCTTT CTCTACTTCC TTTTTCTCTC 61 TTTTCTTTAT ATTTATTGCT CACCTCGGAT TAATTACTGT CATTTATTCC TCATATCTAT 15 121 TTTATTGAAT 'AAAACGGTT ATTTAGCTCG AGGCCTTCTC TCTTATTCTT TGCTTCCAAG 181 GAGAGAGAAT ATGGCGAGTG GTAGCAATCA TCACCATGGT GCAGAGGAA GAAGAAGAGG 241 CGGAATGTTA GTCGC2GCGA CCTTGCTTAT TCTTCCTGCC ATTTTCCCCA ATTTGTTTGT 301 TCCTCTTCCC TTTGCTTTT GTAGTTCTGG CAGCGGTGCA TCTCCTTCTC TCTTCTCCGA 361 ATGGAATGCT CCTAALCCTA GCCATCTCTC TCTTCTGAAA GCAGCCATTG AGCGTGAGAT 20 421 TTCTGACCAA CAAAATCAG AGCTGTGGTC TCCCTTGCCT CCACAGGGAT GGAAACCGTG 421 CCTTGAGACT CAATATAGTA CGGGCTACC CAGTACATCC ACAGGATATA TTCAAGTGTA 5J1 AAACAAGATC CTGAATCGAT TAGCPATGGT TCGCTCTTCT AGACTTGCTT CTCGCATAAT 601 CAATCCTCAG TTTTTGATTC CTTCTCGAAG CTTCCTTGAT CTCCATAAGA TGGTAAACAA 661 GGAGGCGATA AAAAAAGAAA GGGCTAGACT TGCTGATGAG ATGAGCACAG GATATTTTGC 25 721 GGATATGGCA GAGATTCGTA TACATGGTGG CAAGATTGCT ATGC-CAAATG AAATTCTTAT 781 TCCATCAGGG GAAGCAATCA AATTTCCTGA TTTGACAGTA AAATTGTCTG ATGATAGCAG 841 TTTGCATTTA CCAATTGTAT CTACACAAAG TGCTACAAAT AACAATGCTA AATCCACTCC 901 TGCTGCCTCA TTGTTGTGCC TTTCCTTCAG AGCAAGTTCA CAGACAATGG TTGAATCATG 961 GACTCTTCCT TTTTTGGACA CTTTTAACTC TTCAGAAGTA CAAGCATATG AGGTATCATT 30 1021 TTTGGATTCT TGG-TTTTCT CATTCGCACC AATCAAGAGA ATGTTTCTTA ACATGACGAA 1081 GAAACCCACT GCTACTCAGC GGAAGATTGG TTATTTCATT TGGTGATCAC TATGATTTTA 1.141. GGAAGCAGCT TCAAATTGTA AATCTTTTGA CAG A'DATAT ATTACTGTAA AAAGTGAAGA 1201 GAGAAATGTG ATATATGCTG ATGTTTCCAT GGAGAGGGGT GCATTTCTTG TTCAACAAGC 1261 TATGAGGGCT TTCCATGGAA AGAATATAGA AAGCGCAAAA TCAAGGCTTA GTCTTTGCGA 35 1321 GGAGGATATT CGTGGGCAGT TAGAGATGAC AGATAACAAA CCAGAGTTAT ATTCACAGCT 1361 TGGTGCTGTC CTTGGAATGC TAGGAGACTG CTGTCGAGGA ATGGGTGATA CTAATGGTGC 1441 GATTCCATAT TATGAAGAGA GTGTGGAATT CCTCTTAAAA ATGCCTGCAA AAGATCCCGA 1501 GGTCGAC (SEQ ID NO:7) 62 T-DNA-like region of a rice intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20; 5 1203-1207) backbone using the SalI sites that are underlined. This requires a partial digest due to a SalI site within the T-DNA like region. The nucleotides in italics are not part of the rice genomne sequence. Nucleotides 6 - 634 are nucleotides 1 - 629 of CR287857. Nucleotides 635 - 1258 am nucleotides 156 -779 of AKO00350. 10 Nucleotides 1259 - 1740 are nucleotides 222 - 703 of CB619781. The T-DNA border-like sequences are shown in bold. The left border is nucleotides 616 639 and the right border is nucleotides 1247 - 1270. Unique restriction sites in the resulting binary vector that are located in the T-DNA-like region are: 15 Accl at 945 AclI at 716 AfII at 984 AhallI at 893 Alw26I at 1102 20 Apal at 1166 Banli at 662 and 1166 Bgl1 at 1026 BsaOI at 1137 and 1200 BspHI at 771 25 ClaI at 1200 DraI at 893 DraII at 1162 HgiAl at 675 HindUl at 946 30 MaeII at 716, 842 and 1125 Msel at 892 and 985 Pssl at 1165 PvuI at 1137 and 1200 SalI at 944 63 SnaBI at 1126 Sspl at 1073 XorlI at 1137 and 1200 5 1 GTCCACGGGA ATTCGCCATT ATGGCCGGGG GAAGCTTCCC TGTCACTACT GCAGGATCAT 61 CAAAAGCAAG CTAGGGCGCA TCTTCTTGAC ACTGAACCTT TTGAGCATGC ATTTGGACCA 121 AAGGGCAAGA GGPAACGCCC AAAACTAATG GCTCTTGATT ATG-ATCTCT? ATTG'AAGAAA 181 GCTGATGATT CTCAAGGTGC ATTTGAGGAT AAGCATGCTA CAGCGAACTV GCTGAAAGAG 10 241 GAAGAGGAAG ATGGCTTACC ATACCTAGTC CGGCACACAA TGTTTGAGAA GGACAGAGC 301 AAAAGAATTT GGGGrGAACT CTATAAGTT ATTGACTCTT CAGATGTTGT CGTGCAGGTG 361 TTGGATGCCA GGGATCCAAT GGGTACTAGA TGCTACCATC TGGAGAAACA TCTGAAGGAG 421 AATGCCAAGC ACAAACACTT GGTATTCTTA CTAAATAAGT GTGATCTAGT ACCTGCTTGG 482 GCCACAAAAG GATGGTTGCG CACTTTATCA AT4GGACTATC CCAACCTAGC ATACCATGCA 15 541 AGCATCAACA GTTCATTTGG CAAAGG-ATCA CTTCTTTCAG TGTTACGA GGATGGACGC 601 CCTGAGAGAT GTGACGACAG GATATATAGT GAGGTCATGC AGTGCAAGCC CCTCCCCGAG 661 CCCGAGGTCA GAGCACTTTG CGAGAACGCA AAAGAGATAT TGATGGAGGA CAGCAACGTT 721 CAACCTGTAA AGAGTCCTCT TACAATATGT GGTGATATTC ATGGGCAGTT TCATGACCTT 781 GCAAACCTGT TCCGAATCGG TGGAAAGTGC CCAGATACAA ACTACTTGTT TATGGGAGAT 20 841 TACGTGGATC GTGGTTATTA TTCTGTTGAA ACTGTCACGC TTTTCCTGGC TTTAAGGTT 901. CGTTATCCTC AGCGAATTAC TATTCTCAGA GGAAACCACG AAAGTCGACA GATCACTCAA 961 STTTATGGAT TCTATGACGA GTGCTTAACG AAGTACGGGA ATGCAAATGT GTGGAAAACT 1021 TTTACAGATC TCTTCGATTA CTTCCCCTTG ACAGCATTGG TTGAGTCAGA AATATTTTGC 1081 CTGCATGGTG GATTATCGCC ATCCATTGAG ACACTTGATA ACATACGTAA CTTCGATCCT 25 1141 GTCCAAGAAG TTCCCCATGA AGCGCCCATG TGTGATCTTC TCTGGTCTGA TCCAGACGAT 1201 CGATGTGGTT GGGGTATTTC TCCTCGAGGT GCTGGATACA CCTTCGGGCA GGATATATTG 1261 GCGGGTAAAC CAATTCCTGG TTTTCCCGAC AAACCCTCGA GAATAAATTC ATTCTTTGCA 1321 GAAGGATGTC AAACTGGTGA CAATGGTGCT GGTTCCTCGC AAGAGTTGAA TGGTCATTGC 1381 AATGGACAAC CCAGTTGCCC ACAGCAAGGA GTTCTGACCA ATGGTGGCAA CACGCCCTCT 30 1441 CCAAGCACAC AATGCTATGA A2PATAAGTTT GCAACATCCA CCAACGGCAA CTATTCTATT 1501 GGGAATGGTG ATACATTATC TAGCAGCAAC TCATTACATG CGGGCAAACA GAATGCTGGC 1561 TTTACCTATA ATGGTTTCAA TCCAAAACCT TACAAAGPAC CATCAGGAAC CAACACATAT 1621 CTGAATAATA CATGCAATGG TAAACCATCG SAAGATAATC ACAATAAATG TGCCCCAAkAC 1601 CTGCCGGCAA AAGATTGCCA AGGGGGCATG CCATTCTTAC AICCTGCCTT CCTTCTAAGG 35 1741 TCGAC (SEQ ID NO :8) T-DNA-like region of Piuis taeda intragenic vector 64 This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sall sites that are underlined. The nucleotides in italics are not part of the P. taeda genome sequence. Nucleotides I - 333 are nucleatides 114 - 446 of BM133642. 5 Nucleotides 334 - 914 are nucleotides 81 - 661 of CF392877. Nucleotides 915 - 1172 are nucleotides 138 - 395 of CX715693. The T-DNA border-like sequences are shown in bold. The left border is nucleotides 314 337 and the right border is nucleotides 898 - 921. Unique restriction sites in the resulting 10 binary vector that are located in the T-DNA-like region are: AccIf at 442 Aiw26I at 513 Asvl at 813 AvalI at 813 15 BspMII at 442 DraII at 813 DraII at 879 Eco72I al 876 EcoNI at 808 20 EcoRV at 555 FokI at 871 HaeITJ at 339 HpaM at 443 MaeI at 534 25 MspI at 443 PmaCI at 876 PpuMI at 813 PssI at 816 30 There are also to AccI sites (2 and 888) and two BspI-l sites (587 and 806) that could be used as cloning sites. 65 1 GTCGACATTC O-CAGCOATOA CGOTTGCC TTTCATTATC TTACAGTCGA TGCATAAACT 61 CCACOTOTOG ATTGCTCTCC GTCAAGACGA AAAGAGGGAG AGGCAAATC AGCAATT~AGA 5 121 GATTGCAAAA, ATGA2AAGA AATTATTGGC GGAACTTAA\ GAGAAAGAGT CAGC GTATA 181 CCTTTTTGTA GTGATAAITG TTAACCTCC-A ATGGTJAATCA TTATTTTGAA TGATAGCTXL' 241 TCGATTATTT GGTGAAAAAA CAAACTTCAA AIATGA&TT-TG GACAGTTATT 10 TOT CITGAAG 301 CCACAGCAGT GTTGGCAGSA TALTATCCAAT TGTAaAAGGC CAAGGAGATT CT CAT GGAAkG 361 D)JAGTAATGT CCAGCCTGTC AAGTGCCCTG TTACAATCTG TOCTGACATA CATGGTCAAT 15 421 TTCACGATCT TGCCGAGCTC TTCCCGATTG GTGGAAAGTG TCCAGATZCG AATTkTTTGT 481 TCATGGGTGA CTATGTTGAC COAGGATACT ATTCAGTCGA GACTGTCACT CTTCTAGT CT 541 CA'VTGAAGG2 CCGA.TATCCC C2AATCGP.ATTA CCATTCTTCC ACGAAATCAT 20 GRAGTCGTC 601 ACATTACTCA AGTA.TATGA TT2TATGATG AATGTTTACC CAAGTATQCA AWL C-CPAAACG 661 TCTGG2iALIAT ATTTACAGAj)C CTTTTTG-ACT ACTTCCCATT GACAGOACTG GTAGAATCA.G 25 721 AAATTTTCTG CTTACATGGT GGTTTGTCAC CTTCCATTOA CACATTAGAT AACATAA GGA 761 ATTTTGACCG TGTTCAAGAA GTGCCTCATG AAkGGTCCCAT GTGCGA-TCTT TTGTGGTCAG 841 ATC=AGATGA T-AGATOGA TGGGGAAZTCT CTCCACGGG TCCAGGGTAT 30 ACATTTGGAC 901 AGQATATATC TGAAGGTAAA CCGAAGGGAT CCTTCAAAGfT 'GACCAATAT CAGAGATAAT 961 TATGTTGGCA TTGAATATGA4 T4ACCAACCCT GAATATATTGT GCTAAAGAGA GATGCTGAGG 35 1021 TTTTAAAATT TCTATCAGCT T-ACGAGCAC ATGATACATA ATAT.ATGCCA CAAGAATGCA 66 1081 ATGGAATTTC CATTTGGCTT TAAAAAATGA TTTGTAATGT CACGTACATT AGCATCTACA 1141 AAGAATTGGA TTGCCTTCAT TCACTTTTCG TCGAC (SEQ ID NO:9) 5 67 Example 3 Identification of plant-derived sequences that function as a selectable marker in bacteria: complementation of deficient bacteria In preferred intragenic vectors of the invention, the complete vector is made up entirely of 5 plant-derived sequences. One desirable component for effective vector manipulation is a bacterial selectable marker. Preferred marker sequences include plant genes that complement bacterial-natants deficient in genes essential for their growth, such as amino acid biosynthesis genes. One such gene is acetohydroxyacid synthase. 10 Acetohydroxyacid synthase is an enzyme which catalyses the formation of acetolactate pyruvate, the first step in valine, leucine and iscleucirie biosynthesis, Furthcrmore, plants with mutant forms of AHAS can confer resistance to sulfonylurea herbicides and related compounds (Mazur and Falco, Annual Review of Plant Physiology and Plant Molecular Biology, 40: 441-470, 1989). For example, the Arabidopsis thaliana mutant AHAS gene 15 confers resistance to the herbicide chlorsulfuron upon transformation into tobacco (Haughan et al, Molecular and General Genetics, 211: 266-271, 1988). Wild-type ALAS Genbank details are: LOCUS NM_114714 2270 bp mRNA linear PLN 19-FEB-2004 20 DEFINITION Arabidopsis thaliana acetolactate synthase, chloroplast /acetohydroxy-acid synthase (ALS) (At3g48560) mRNA, complete cds. Located on chromosome 3. A discontiguous megablast of the gene sequence above against all publicly available 25 Virdiplantae genomo sequences using the standard NCBI parameters shows that the AHAS gene is present in many plant species. Genes encoding acetohydroxyacid synthase are found in both the E. coli genome and the Agrobacterium tumefaciens C58 genome (Genbank accessions NC00913 and NC003062 respectively). Furthehmore, functional expression of plant AHAS genes in bacterial systems to complement deficiencies in AHAS has been well 30 established. For example, the AHAS genes from Arab idopsis thaliana (Smith et al., Proceedings of the National Academy of Science, USA, 86: 4179-4183, 1989), Nicotiana rabacum (Kim and Chang, Journal of Biochemistry and Molecular Biology, 28: 265-270, 1995), and Brassica napus (Wiersma et al., Molecular and Genoral Genetics, 224: 155-159, 68 1990) have been used to complement AlIAS-deficient bacteria such as Escherichia coli and Salmonella typhimurium. Furthernoe, it will be understood by those with ordinary skill in the art, that plant-derived 5 sequences such as AHAS known to complement bacterial deficiencies can be placed under the control of plant promoters known to be transcriptionally active in bacteria. For example, Jacob er aL (transgenic Research, 11: 291-303, 2002) describe several such plant promoters, one of which is the potato ST-LS I promoter. In order to provide an example in which all the components of the present invention are derived from a single plant species, we have isolated 10 the potato (Solanum luberosum) AHAS gene. This gene can be used in the manner described above to provide a bacterial selectable marker gene to maintain vectors in bacteria. Using potato (Solanuvn tuberosum) cultivar 'lwa' genomic DNA as a template, various fragments of the AHIAS gdne were isolated based on primers designed from related species. 15 These fragments were cloned, their DNA sequence determined, and a composite consensus sequence gCnerated for the potato AlAS gene. In order to generate the complete sequence for a single allele, the following primers flanldng to coding regon were designed: Primer Q: 5' TAGCCATTTTGCCTCCTTTC3' Primer R: 5'CAACGGCAAACTAGACAGATAGAA3' 20 A polymerase chain reaction was then performed with high fidelity Pwo polymerase with primers Q and R to ampl it a fragment using genomic DNA from potato cultivar 'Iwa' as a template. This product was A-tailed, and ligated into pC-emT (Promega) following the manufacturers' instructions. The cloned AHAS allele was then sequenced using primers based on the consensus sequence anchored about every 400 bp along the cloned fragment. 25 The following sequence for the coding region of a potato cultivar 'Iwa' AHAS allele (from the start Codon to the stop codon) was obtained: 1 ATGGCGGCTG CTGCCTCACC ATCTCCATGT TTCTCCAAAA CCCTACI2TCC ATCTTCCTCC 30 61 AAATCTTCCA CCATTCTTCC TAGATCTACC TTCCCTTTCC ACAATCACCC TCAAAAGCC 121 TCACCCCTTC ATCTCACCCA CACCOCATCAT CATCGTCGTG GTTTCGCCGT TTCCAATGTC 181 GTCATATCCA CTACCACCCA TPACGACGTT TCTGAACCTG AAACATTCGT TTCCCGTTTC 241 GCCCCTGACG AACCCAGAA GGGTTGTGAT GTTCTTGGG AGGCACTTGA AAGGGAGGGG 301 GTTACGGATG TATTTGCGTA CCCAGGAGGT GCTTCTATGG AGATTCATCA GGCTTTGACA. 35 361 CGTTCGAATA TTATTCGTAA TGTGCTGCCA CGTCATGAGC AAGGTGGTGT GTTTGCTGCA 421 GAGCTTACG CACCCGCGAC TGGGTTCCCT GGTGTTTGCA TTGCTACCTC TGGTCCGGGA 69 481. GCTACGAATC TTGTTAGTGG TCTTGCCAT GCTTTGTTGG ATAGTATTCC GATTGTTGCT 541 ATTACGGTC AAGTGCCGAG GAGGATGATT GGTACTGATG CGTTTCAGGA AACGCCTATT 601 GTTGAGGTAA CGAGATCTAT TACSAAGCAT AATTATCTTG TTATGGATGT AGAGGATATT 661 CCTAGGGTTG TTCGTC-AAGC GTTTTTCTA GCGAAATCG3G GACGGCCTGG GCCGGTTTTG 5 721 LTTGATGTAC CTAAGGATAT TCAGCAACAA TTGGTGATAC CTAATTGGGA TCAGCCAATG 701 AGGTTGCCTG GTTACATSTC TAGOTTACC-T AAATTGCCTA ATGAGATGCT TTTGGAACAA 843 ATTATTAGGC TGATTTCGGA GTCGAAAGAG CCTGTTITGT ATGTGGGTGG TGGGTGTTTG 901 CAATCAAGTG AGGAGCTGAG ACGATrTGTG GAGCTTACGG GTATTCCTGT GGCCAGTACT 961 TTGATGG'-'C TTGGAGCTTT TCCAA-TCGGG GACAGCTTT CCCTTCAAAT GTTGGGTATG 10 1021 CATGGGACTG TGTATGCTAA TTATGCTGTG CATGGTAGTC ATTTGTTGCT TGCATT'1GGG 1081 GTGAGGTT'G ATGATCGAGT TACTGGTAAA TTGGAAGCTT TTGCTAGCCG AGCGAAAATT 1141 GTCCACATTG ATATTGATTC GGCTGAGATT GGAAAGAACA AGCAACCTCA TGTTTCCATT 1201 TGTGCAGATA TCAAGTTGGC ATACAGGGT TTGAATTCCA TATTGGAG-GG TAAAGAAGGT 1261 AAGCTGAAGT TGGACTTTTC TGCTTGGAGA CAGGAGTTAA CGGAACAGAA GGTGAAGTAC 15 1321 CCATTGAGTT TTAAGACTT TGGTGAAGCC ATCCCTCCAC AATATGCTAT TCAGGTTCTT 1381 GATGA3TTAA CTAACGGAAA TGCCATTATT AGTACTGG GG TCCSGCAACA CCAGATCTGC 1441 GCTGCCCAAT ACTATAAGTA CAAAAAGCCA CACCAATGGT TGACATCTGG TGGATTAGGA 1501 GCAATGGGAT TTGGTTTGCC TGCTGCAATA GGTGCGGCTG TTGGAAGACC GGGTGACATT 1561 GTGGTTGACA TTGATGGTGA CGGGAGTTTT ATCATGAATG TGCA\GGACTT ACCAACAATT 20 1621 AAGCTG0A-GA ATCTGCCACT TARGATTATC TTGCTGAATA ATCAAACACTT GGGAATGGTG 1681 GTTCAATGGG AGGATCGATT CTATAAGGCT AACAGAGCAC ?CACTTACTT GGC-TGATCCT 1741 GCTAATGAGG AAGAGATCTT CCCTAATATG TTC-AAATTCG CAGAC-GCTTG TGGCGTACCT 1801 C-CTGCAAGAG TGTCACACAG GGATGATCTT AGAGCTGCCA TTCAAAACGAT GTTAGAICACT 1061 CCTGGGCCAT ACTTGTTGGA TGTGATTGTA CCTCATCAGG AGCACGTTCT ACCTA\TCATT 25 1921 CCCAGTGGCG GTGCTTTCAA AGACTG'PATC ACAGACCCTG ATGCCACACG TTCATATTGA (SEQ ID NO:10) 70 Example 4 Identification of a plant-derived sequences that function as plasmid origins of replication in bacteria Preferred intragenic vectors of the invention comprise an origin of replication that functions in 5 R coil and Agrobacteriun tumefaciens. Plant derived bacterial origins of replication in this example are based on the smallest known prokaryotic replication origins of Colicin E plasmaids (ColE plasmids), specifically ColE2-P9 (from Shigella sp.) and CoIE3-CA38 (from . coli). The minimal replication origins of these 10 plasmids, named COLE2 and COLE3, require only 1 specific factor (Rep) to be provided in trans. Plasmids pBX243 and pBX343 provide Rep in trans for ColE2 and CoIE3 respectively. The rninimal origins also require host DNA polymerase I and other factors (see Yasueda et al, Molecular and General Genetics, 215: 209-216, 1989; Shinohara and Itoh, Journal of Molecular Biology, 257: 290-300, 1996). 15 There are 2 differences between ColE2 and ColE3 origin sequences, one mismatch and a deletion of a single nucleotide in CuIE2 (or an insertion in ColE3). The deletion/insertion, not the mismatch, is responsible for determining the plasmid specificity in the interaction of the origins with the trans-acting factors. 20 Characteristic features of these sequences are two direct repeat sequences of 7 bp (5'CAPuA.TAA) or of 9 bp (APvCAPuATAA) which are separated from each other by 7 bp or 5 bp in ColE2 and by 8 bp or 6 bp in ColE3. 25 ColE2 AGACCAGATAAGCCT TATCAGATAACAGCGCC (SEQ ID NO:l 1) ColE3 AGACCAAATAAGCCTATATCAGATAACAGCGCC (SEQ ID NO:12) 30 The one nucleotide mismatch G/A can be substituted without effect. Only T/A is acceptable in the insertion position and the third to last position can be G or an A. It is likely that otlier changes can also be made that do not affect the composition of the two direct repeat sequences. Consensus sequences for ColE2 and CoLE3 can be described as; 71 R = G or A (Pu) Y = C or T (Py) W A or T 5 Consensus CoIE2 AGACAI.ATAACGCCT TANCAjTAACAGC CC Consensus ColE3 AGA CAiATAAGCCT7A4CAATAACAGCCC Other minimal replication origins and Rep genes from other (Colicin E) plasmids could also 10 be used when constructing plant-derived replication origins (Table 2). Table 2. Replication origins from ColE plasmids that could be used to construct plant derived replication-origins, 15 Original Most Plasmid (putative) minimal origins NCBI Accession Shigella sp ColE2-P9 agaccagataa-get-tatcagataacagcgcc D30054 20 Escherichia coli CoIE3-CA38 agaccaaataa-gcctatatcagataacagcgcc D30055 Escherichia coli CoIE2-CA42 -ga-aaata--gctatatcagataacagogcc D30056 Escheridhia coli CoIE2-GE1602 -ga--aaata--gcotatatcagataacagogcc D30057 Escherichia coli ColE2imm-K317 -ga-aaata--gctatatcagataacagcgc D30058 Shigella sonnei CoI4-CT9 agaccagataa-gcct-tatcagataacagcgcc D30059 25 Shigella sonnei CoIB5-099 agaccaaataaaacetatatcagatsaeagegct D30060 Shigella sonnei ColE6-CT14 agaccaaataaaacctatatcagataacagcget D30061 Escherichia coli ColB7-K317 agaccaaataa-gctatatcagataacaggcc D30062 Escherichia coli ColES-J agaccaaataa-gectatatcagataacagcgcc D30063 Escherichia coli CoIE9-J agaccaaataaaacotatatcagataacagcgct D30064 30 Potato COLE2-like replication sequence The Co]E2 consensus sequence was used to search publicly available potato (Solanurn tuberosun) DNA sequences. The potato COLE2-like replication sequence POTCOLE2 was 35 constructed in silicon from two sequences, accessions: 72 SON U254575 nucleotides 359-721 correspond to POTCOLE2 1-363 TIGR EST494490 nucleotides 248-693 correspond to POTCOLE2 362-807 5 TC-GCCACAAAACAAGCGCCAAACAACGAGCAACAACAAATCAAGATTC-CACCAAAACTAGAA AATTAAAGAAGAGTATCACCCCAAATGCGTTACTGTTCACGACCTCAAATCAGAATCTACAG ATCTCT AAA TCCGATCTCCACTGTTGAATTGCAAGAACCAGATGCTGAGAACTCTCAGTTCA AATTTGAGCACGATCCAACGGTT AACGAAGCGGCAAACTCTGTCTGAAGCGGACTGCCTGAG CAGAAAATTTCCAGAAGCAAPAACGGGATTTTCTTTTTTCTCTCAATC TCTAAACGAATC 10 TCTCTTGATTTTTCTCTCTTGTGTTTCTGAAAATAAGACCAAATAAGCCTTATCAGATAACA GCACCTGAAGCAGCTCATGTAGCTTGTCAGCACCAGGTCCTGGCCTAAACACTGTATCATTG CCACGCAAAGAGCACGGGTCTGC TCCACCATCTGATGACCCAATACACCATGCACCTGGCGA AAACCTATGTGTGCGCCCCAAAAGTTCTTTGTCAATCTTGTCTAGGACTGGATCATCCCTTG CAA A-T TTTCGGGCAAAGGGAGCATTGCTCTTGGCCATTTTGTCGAAGTTC TTCATAG TTAGA 15 CACATGGGATGTTGCTTTGGTGGACTGTCCCAAGCAATGTAATGAAGATCGTGGCTTATTGC TGTGTGCCGAAATTTCT GAGTGTTGCAAATGACAGTGTGAAAATATCCCTCTGGCGAAGAGA CAAAATTTGTATAA TACATAAGCATAGTCCGTGGAAAGT TATCCCATCCC CATATGCAGTAC T (SEQ ID NO:13) 20 The POTCOLE2 replication sequence, the minimal origin sequence, is underlined. The 807 bp POTCOLE2 sequence was synthesised by Genscript Corporation (Piscatawa, NJ, www.genscrit.corn) and supplied cloned into the SmaI site of pUC57 (pUC57POTCOLE2). 25 The following primers were designed to PCR arnplify the spectinomycin resistance gene of pART27 (Cleave, Plant Molecular Biology, 20: 1203-1207, 1992), Primer S: 5'GTGTCGACAACTACGATACGG3' (SEQ ID NO:14) Primer T: 5'CGTAAGTTGAACGAATTCTTAG3' (SEQ ID NO: 15) 30 Nucleotides underlined represent a Sal site in primer S and represent HindIII and EcoRI sites in primer T. A 1661 bp fragment with the spectinomycin resistance gene was PCR amplified from pART27 using high fidelity Pwo polymerase. This fragment was ligated as a SalI to 73 Hindill region into pUIC57POTCOLE2 to give pUC57POTCOLE2SPEC and position the spectinomycin resistance gene immediately adjacent to the POTCOLE2 fragment. The fragment corresponding to the spectinomycin resistance gene and the POTCOLE2 was 5 isolated as a 2.5 kb EcoIU fragment from pUC57POTCOLE2SPEC and self-circulariscd to generate pPOTCOLE2SPEC. The ligation was transformed into E. coli DH5a harbouring helper plasmid pBX243 (with an ampicillin resistance gene) and transformation selected on L plates supplemented with ampicillin and spectinomycin (100 ig/iL). Resulting colonies were picked, plasmid DNA isolated and analysed by restriction enzyme digest using BaMH1 10 and EcoRL A BamHI/EcoRl double digest will release the Rep gene from pBX243 and will linearise pPOTCOLE2SPEC. Successful bacterial propagation of pPOTCOLE2SPEC using the rotato-derived origin of replication is evident as three bands on a gel at 3.9 kb, 2.5 kb, and L5 kb, representing the 15 pBX243 backbone, linearised pPOTCOLE2SPEC, and the pBX243 Rep gene. Control digests of only pBX243 results in two bands, the 3.9 kb pBX243 backbone and the 1.5 kb Rep gene. Figure I provides confirmation of replication of pPOTCOLE2SPEC in bacteria mediated by the potato-derived origin of replication. 20 COLE2-like sequences from the genomes of other plant species A search on NCBI GenBank (http://www.nebi.nlm.nih.ov/BLAST/) and TICR database (http://tigr1bast.iir.or/tnif) using the BLAST tool "search for short, nearly exact matches" and searching within the EST databases, yielded COLE2-iko sequences in the genomes of other plant species. Searches were made for the consensus CoIE2 sequence: 25 AGAjCANATAAGCCT TAICAhATAACAGCRCC It was possible to readily assemble COLE2-like sequences by joining two sequences from the same species with a few mismatches unlikely to impact on the functionality of the origin of 30 replication. In the examples below the position of the join between two EST sequences is indicated by "/" and mismatches to the consensus sequence are indicated in bold. Species Sequence 74 Consensus ColE2 AGAWCA-A&TAAGCCT TAlkCAPATAACACCC Allium cepa AGACCAAATAAGCTC/TATCAGATAGCAGCTGC (SEQ ID NO:16) 5 CF43611 I/CF452305 Beta vulgaris AGGCCAAATAAOCCT/TATCAGATAACAGCGCC (SEQ ID NO: 17) BQ589076/BQ590618 10 Medicago trunculata AAATCAAATAAGCCTTATCA/GATAACAGCACC (SEQ ID NO:18) TC111839/TC102142 15 Gossypium arboreum AGACCAGATAATCCT/TAACAGATAACAGCGCC (SEQ ID NO:19) BM3 58442 /AW729597 Hlordewn vulgare ACATCAGATAAGCCTTA/TCAGATAACAGCOCC (SEQ ID 20 NO:20) DN158808/AV924388 Sorghum bicolor GACCAOATAAGCATTATTAG/ATAACAGCGCC (SEQ ID NO:21) 25 CF427156 /CX613542 Picea glauca AGACCTAATAAGCCT/TATCAGATAACTGTGCG (SEQ ID NO:22) C0485190/ C0235782 30 Theobroma cacao AGACCAAATAAGACTTA/TCAGATAACAGCACG (SEQ ID NO:23) CA796667/CF974720 75 Mesembryanthenum crystallinuin CA838853 / BE036300 AAACCAAATAAGCTTTA/TCAGATAACAGCACA (SEQ 1D NO:24) 3 Petunia hybrida GCATCAGATAAGCCT/AACCAAATAACAGCAAC (SEQ ID NO:25) NP1240078/TC390 Brassica napus AGACCAGATAAGACT/CATCAGATAACAACACA (SEQ ID 10 NO:26) CD814492/CD814199 Zea mays CCACCAGATAAGCCTT/ATCAGATAACAGTTGC (SEQ ID NO:27) 15 DN211845/DN232238 Pinus taeda AGTACAGATAAGCCTT/ACCAAATAACAACACC (SEQ ID NO:28) DRC19180/ BQ699992 20 COLE3-like sequences from the genowes of plant species A search on NCBI GenBank (http://www.ncbl.nln.ni.gov/BLAST/ and TIGR database (http://tigrblast.tig.org/t i/) using the BLAST tool "search for short, nearly exact matches" and searching within the EST databases, yielded COLE3-like sequences in the genomes of 25 other plant species. Searches were made for the consensus Co1E3 sequence: AGA;CAIATAAGCCTTYiw Ai ATAACAGCRCC It was also possible to readily assemble COLE3-like sequences by joining two sequences 30 from the same species with a few mismatches unlikely to impact on the functionality of the replication origin. In the examples below the position of the join between two EST sequences is indicated by "/"and mismatches to the consensus sequence are indicated in bold. Species Sequence 76 Consensus ColE3 AGCAJRATAAGCCTjWffACAKATAACAGC*CC Allium cepa AGACCAAATAAGC/TTATATCAGATAGCAGCTGC (SEQ ID 5 NO:29) CF43611 l/CF452305 ViLis vinifera AGATCAGATAACCCTTTA/TCAGATAACAGCCCC (SEQ ID NO:30) 10 CF207293 /CF515867 Nicotiana tabacwn AGACCAAATAAGCA/TATATCAGATAACTTCGGA (SEQ ID NO:31) TC1407/BP530912 15 Glycine max TGACCAAATAAGCTTATAT/CAGATAACAGAGTC (SEQ ID NO:32) BE209626/AI959871 20 Saccharum officinarum AGACCAAATAACCCTAAAT/CAGATAACAACGC (SEQ ID NO:33) CA156596/CA092850 Secale cereale AOACCAAATAATCATAT/TTCAGATAACAGCGCC (SEQ ID 25 NO:34) BE704886/CD453313 Capstin annum AAACCAAATAAGCAAA/TATCAGATAACTTCGCA (SEQ ID NO:35) 30 CA525915/TC6186 Populus euphratica GCACCAAATAAGCCAATA/TCAGATAACAGCTGC (SEQ ID NO:36) A7777378/ AJ768273 77 Lotus japonicus CTACCAAAI'AAGCAFI'ATATCAGATAACAGCGTA (SEQ ID NO:37) TC15168/AV774815 5 Medicago trunculata AGATCAAATAAGCCTTTA/TCAGATAACAGCAGA (SEQ ID NO:38) . CR931730/AC148360 10 Note: the last example was derived from nr database rather than an EST database, 78 Example 5 Identification of plant-derived sequences that function as a selectable marker in bacteria: operator-repressor titration Antibiotics and antibiotic resistance genes traditionally used for the selection and maintenance 5 of recombinant plasmids in hosts such as E. coli and A. iunefaciens. Their continued use is undesirable in plant biotechnology, where the threat of horizontal transfer to other microbes exists. An alternative plasmid selection strategy based on the phenomenon repressor titration was developed by Cobra Biomanufacturing Plc (WO 03/097838 Al; Williams et aL, Nucleic Acids Research, 26: 2120-2124, 1998; Cranenburgh et aT, Nucleic Acids Research, 29: c26, 10 2001; Cranenburgh et al, Journal of Molecular Microbiology and Biotechnology, 7: 197-203, 2004). Background 15 The Operator-Repressor Titration (ORT) system enables selection and maintenance of plasnmids that are free from expressed scocetable marker genes and require only the short non expressed lac operator for selection and maintenance. F. col ORT strain DHl lacdapD (genotype recA endAi gyrA96 hi hsdr 17 supE44 relA1 20 A(dapD)::kan hipA: :lac-dapD) contains a chromosomal conditionally essential gene dapD under the control of the lac operator/promoter system. Under normal conditions, a repressor protein encoded by a second chromosomal gene binds to the chromosomal lac operator and prevents transcription of dapD, and cells lyse. Growth is permitted when an induce (IPTG) is provided i.e. on a nutrient agar plate. Alternatively, growth is also permitted when a 25 plasmid containing a lac .operator sequence is introduced into the cell. The repressor protein binds to the plasmid-borne operator sequence, derepressing the chromosomal operator and allowing dapD expression. Two lac operator sequences have previously been shown to function as plasmid selectable 30 elements: LacOl is 21 bp and is derived from the wild-type . cohl lac operon, LacO is 20 bp and is an 'ideal' version of LacOl, being a perfect palindrome of the furst 10 bp of LacO1. 79 LacOl: AATTGTGAGCGGATAACAATT (SEQ ID NO:39) LacO; AATTGTGAGCGCTCACAATT (SEQ ID NO:40) 5 Previous research conducted to understand the lac operator has involved the analysis of various operator analogues, or LacOl-like sequences, i.e. sequences that are able to titrate the lac repressor. As little as 13 bp of a 14 bp symmetrical consensus sequence TGTGAGCOCTCACA is able to bind the lac repressor (Sirnons et at, Proceedings of the National Academy of Science, USA, 81: 1624-1628, 1984). No work has been conducted to 10 show that these LacO-like sequences will function as plasmid selectable elements but it appears likely. With only 13-14 bp required, it is statistically probable that sequences capable of binding the lac repressor and acting as a plasmid selectable element will be found in all plant genomnes. 15 Search for LacO-like sequences in plant genomes A search on NCBI Genfank (htp://www.ncbi.nin.nih.gov/BLAST ) and IiGR database (ttp://tigrblast.tigr.org/tgi/) using the BLAST tool "search for short, nearly axact matches" and searching within the EST databases, were made for the LacO sequence: 20 AATTGTGAGCGCTCACAATT (SEQ ID NO:40) The following list gives NCBI accession numbers that have sequences identical to at least 10 bp that comprise one of the two inverted repeats that make up LacO: 25 Dicotyledonous plants Canelliaceae Canellia sp. CV014004 Chenopodiaceae Beta vulgaris CV301904 30 Chenopodium sp. CN782052 Composite Lactuca sativa BQ999659 Helianthus annuus CD848561 BU671795 BU672101 Helianthus argophyllus CF097400 80 Convolvulaceac Iponoea batatas CB330510 Ipomoea nil BJ577170 BJ576074 BJ570027 Cruciferae 5 Brassica rapa L33645 Brassica rapa pekinensis CV523215 Brassica napus CD837028 Thellungiella halophila BM985805 Thellungiella salsuginea DN777083 10 Cucutbitaceae Cucumis salivus DN910885 Ericaceae Vaccinium corymbosum CV191519 Euphorbiaceae 15 Manihot esculenta CK651449 Lauraceae Persea americana CK758014 Legumiinosae Arachis hypogaea CX127972 CD038632 20 Cicer arietinum CD051347 Glycine max CX708729 Glycine soja BG041485 Lotus corniculatus var.japonicus BP073115 Phaseolus vulgaris CV542405 25 Phaseolus coccineus CA914174 Linaceae Linum usitatissimum CV478930 CV478503 Malvaceae Gossypium hirsutum DR044140 30 Gossypian raimondii C0131784 Myrtaceac Eucalyptus tereticornis CD669011 Pedaliaceac Sesam vmn indicum BU668313 81 Plumbaginaceae Linonimw bicolor CX263567 Rosaceae Fragaria x ananassa AB208578 5 Malus x domesrica CV 882575 Prunus persica AJ825706 Prunus armeniaca CV048462 Prunus dulcis B1203104 Pyrus communis AJ504986 10 Rutaceae Citrus sinensis DN618703 CN191267 Citrus reticulata CF828122 Salicaeac Populous tremula BU823277 15 Solanaceae Capsicum annuum BM066713 Lycopersicon esculentum BP883198 BP876932 Medicago Iruncatula AL384864 Petunia x hybrida CV300353 20 Solanwn habroahaites DN168862 Solanum tuberosum DN849072 CV469139 Sterouliaceae Theobroma cacao CF974287 Vitaccae 25 Vitis vinfera CX127882 Monocotyledonous plants Gramineae Avena sariva CN821127 Hordeun vulgare CV062014 30 Oryza sativa CR290368 Saccharum officinarum CA104782 Sorghum bicolor CX607714 Schedonorus arundinaceus CK802645 Triticwn aestivum BQ578949 82 Triticum monococcum BQS01760 Zea mavs C0526196 Liliaceae Alilium cepa CP448121 5 Gymnosperms Pinus taeda DR013559 Picea engelimannii x sitchensis C0213279 Picea glauca CK441720 Pinus pinaster BX676975 10 Pseudo/suga menziesii CN638414 Bryophytes Marchantia polyinorpha AU081717 Algae Chlamydomonas reinhardti CF558875 15 Search for LacOl-like s-epiences in plant genomes A seah oin NCBIl Genl3ank (hittp~im-v.ncbi.nihminih.gov/BLAST/) and TIOR database (hfn;/tirhlst~ia. oe/W!)using the BLAST tool Lseaw-h fox shod, nearly exact Matches" 20 and searching within the E ST databases, were made fox (GC-ATA-ACAATT. Thu 21 lip LacO I seqrtence is identical in its first 10 bp to tacO. The following list gives accession numbers where at least the last I1 Ibp of the hrnOisequence, GGATAACAATT, are found; 25 Dicotyledonous plants Chenopodiacese Beta vulgaris CX779649 CF542856 Conapositac Lactuca sativa BU004821 BU008839 30 Helianthus annues P1U671 786 BQ965452 Coiwolvnlaeeae Iponoea ni BJ567255 Crueiferac Brs/ca rava CV433907 CV432343 83 Brassica napus CXI 95012 CD838296 Raphanus sativus AFOSI115 Cucurbitaceae Citrullus lanatus A1563425 5 Leguninosae Cicer arietinum CK148974 Glycine max C0036432 CX709893 Medicago trunculata BQ144942 Phaseolus vulgaris CV533775 CB543020 10 Phaseolus coccineus CA913133 Pisum sativum CD860446 Linaceae Linum usitatissimum CA482669 Malvaceae 15 Gossypium rainondii C0128755 Gossypium hirsutzm C0497326 Rosaceae Malus x domestica CV997415 CN879093 CN882088 Prunuspersica AJ823535 20 Prunus armeniaca CV048921 Prunus americana CV458467 CK758903 Pyrus communis AJ504896 Rutaceae Citrus sinensis CX675412 CX075530 25 Citrus clementina CX298649 Solanaceae Capsicum annuum CA516533 Lycopersicon esculentum B1926125 Nicotiana tabacum CN949741 BP535353 30 Solanum tuberoswm CK719419 Vitaceae Vitis vinifera CD715798 Monocotyledonous plants Gramineae 84 Avena sativa CN820280 Hordezun vulgare CK568615 Loiun multiflorun AU247989 OryJza sativa CF986696 5 Saccharun officinaruni CA279301 Secale cereal BE495021 Sorghum bicolor CX615619 Triticun aestivum CK215572 Zean mays CF046268 10 Liliaceae Alliurn cepa BE205560 CF449604 Gymnosperms Pinus taeda AW065199 DN614133 Picea glauca C0251715 C0241938 15 Pinus pinaster BX682941 Pseudotsuga imenziesli CN640766 20 Potato LacOl sequence as a recombinant plasmid selectable element The 21 bp LacO 1 sequence was used to search publicly available potato (Solanurn tuberosuni) EST sequences. Sequences were found in NCBI accessions CV501815 and CK259105 joined in silicon with BglII restriction enzyme recognition sites (agatot) added to termini to make 693 bp POTLACOI: 25 agatctAATATTTACTTCTCCACTTATACAAATACCCCAATCAGAATCACTAGCTGGCAGAT TCCTTGTCCC CTATTGACAGCAAACATAGACGTACATTATAGACCCACCACAACATTAGACA AACATTCTTAAACAAGAGGTGGATACTGCTTAGACTGCAGGCGCACCCTCTTTCGGTACTC CAGAACATCCTCAATAAACATATGATACCCTTCAGTTTGGGCAGGATCAGCAGGGTTTGGCT 30 GATCTAACAAGTCCTGGATACCAACCAGTATCTGTTTCACGGTGATGGCTGGTCTCCACCCA CTATCTTCATT GAGGATC GACAAGCAAACTGTTCCAGATGGATAGACATT GGGATGGAAAAA GCCTGGTGGGAATTTACACTTTGGCGGTTTACTCGGATAATCTTCACTGAAGTGAATTGTGA GCGGATAACAATT GGGGAAAT CAT TATGTAAATTCAiCAAATATTTCAAT TTATGCATTAGC AAATTGTTATCAGGATCTACCACATCAGGATTGTCTTCTATCTACGCAGCTAGTCGAACTC S5 GACTCCCTCGTTGTCTTCCTGGTAAATCCGGTCGAATATATCTCGACGGATGTTTTCTCCGG TACGATCAATACAATTTTTTCAACGAAACTAC'GATTCAGCTAAAGATACAGTGAACTGTAG CAGCTagatet (SEQ ID NO:41) 5 LacOl sequence is underlined. First nucleotide of CK259105 underlined and in bold. Terminal BgIll restriction enzyme sites (agatet in lowercase) are not of potato sequence origin. 10 The 693 bp POTLACO1 sequence was synthesised by Gensoript Corporation (Piscatawa, NJ, www.genscript com) and supplied cloned into the Smal site of pUC57 (pUC57POTLACOl). POTLACOL was excised from pUC57POTLACOI with BglII and ligated into pBR322 previously linearised with BamHL. The resulting plasmid pBR322POTLACOI was 15 t-isforied into . coli strain DI lacdapD and colonies were selected using repressor titration. Plasmid DNA was isolated from selected colonies and digested with restriction enzyme PsI (see Figure 2), Linearised pBR322 is visualised as a band at 4.4 kb. Psd digested pBR322POTLACO1 is visualised as two bands, one at 1.3 kb and one at 3.8 kb. The results indicate that POTLACOI functions as plasmid selectable element. 20 Onion LacO and LacOl sequences Onion-derived LacO1 and LacO sequences, ALLLACO and ALLLACO1, have also been made in silico. 25 NCBI accessions CF448121 and CF450773 were used to generate a 756 bp ALLLACO (LacO sequence underlined): agatottcgtcagoctacaactaccgacaatcccaaacccacatccgacgacgataactacg aaaatagggaggtggattctgacggagcttcggattcogacgagattgggaaggggttgag 30 agcacggagttggatgagatttttagtgcggcgacbacgtttataqctgcgactgctgugga taagaattctgcaaaagtttcgaatgatctgcagctgcagttatatgggttttacaagattg ctactgaggggccttgtaccgttccccaaccttctgcacttaaaatgacagctcgtgccaag tggaatgcatggcagaaacttggttccatgcct cctgaagaagctatggagaagtacattgc 86 aattgtgagcqctcaca at tgctt ttacgct a tgta tgaca a tatggataatca Lggt gggg cccagagagccccaatg aatcctcagcaaattccatttqgaaat tcattat at ggaqc ggg tctggactcatccgaggt gqgcttggqtgcct atggagagagatttttaggttcaaget ccga gtttatgcagagcaatataagtagat ggttctccaaccctcagtattactttcaagLgaatg 5 accagtatgtgaggaacaagttgaaagttgttttgtttccotttttacacagagggcattgg acaaggatcactgaaccggttggtggcaggctttcttacaaacctccaatttttgacatcaa tgccccagatet (SEQ ID NO:42) 10 NCBI accessions CF448121 and CF449604 were used to generate a 662 bp ALLLACO1 (LacO 1 sequence underlined): agatctggggcattgatgtcaaaaattggaggtttgtaagaaagcctgccaccaaccggt tc agtgatccttgtccaatgccctctgtgtaaaaagggaaacaaaacaactttcaacttgttcc 15 twacatactggtcattcacttgaaagtaatactgagggttggagaaccatctacttatattg ctctgcataaactcggagcttgaacctaaaaatctctctccataggcacccaagccacctcg gatga gtccaqacccagc t ccat ataatgaat t t ccaaat gga a t ttgctgaggattcattg gggtctctgggccccaccatgattatccatattgtcatacatagcgtaaaagcaattgtga gcggataacaattcatttcaaaagggaggaggaggaggacaacagagtcagggtcttacgct 20 LtttgtgaaaggttttgatagctctcaagatccattcacgattcgtgatactcLLcgatcgc attttgagtcctgtggagagatttctcgtgtttcagttccaaaagattttgaaaccggcago tccaggggg a tLtgcgtacattgatttcaatgaacaagagagttttaacaaagccctagaa ct gaatggatcagaaatagatggatactacctg gttgttgatca (SEQ ID NO:43) 25 Other LacO1-like sequences from plant genomes It is highly likely that LacO 1-like sequences xvill also function as plasmid selectable elements. For example, the following sequence was also found. 30 gijl4495426|_gb|BE205560.1 API26F NPI Onion cDNA library Allium cepa cDNA clone API26F similar to catalase, mRNA aequenco. Length - 628 35 87 Score = 28.2 bits (14), Expect = 0.34 Identities = 21/22 (95%), Gaps = 1/22 (4%) Strand = Plus / Minus 5 Query: 1 aattgtgagcgg-ataacaatt 21 IlllllillIl 111111| Sbjct: 477 aattgtgagcgggataacaatt 456 10 88 Exarnple 6 Design and construction of an intragenic vector for Arabidopsis thaliana The consensus T-DNA border sequence can be defined as: 5 5
GGCAGGATATATXXXXXTGTAAXX
3 ' Although other variants can include: 5 GACAGGATATATXXXXXGGTCAXX (nucleotides in bold represent possible substitutions in soei T-DNA borders). 10 Searches for such DNA sequences identified a single sequence in the A. thahana genome corresponding to:
"GACAGGATATATCGTGATGTCAAC
3 ' (SEQ ID NO:44) [ex ALl38652 from chromosome 3, bp 60629-60606) 15 This "T-DNA border" is remarkably similar to authentic T-DNA borders from Agrobacterium Ti or Ri plasmids, with all nucleotide substitutions occurring in variable regions: 5 GACAGGATATATGGTGATGTCACG' pTiS4 (SEQ ID NO:45) OACAGGATATATGTTCTTGTCATG pm (TR rb) (SEQ ID 20 NO:46) s GGCAGGATATATCGAGGTGTAAAA' pTil 5955 (TR ib) (SEQ ID NO:47) 'GACAGGATATATTGGCGGGTAAAC pTiT37 (rb) (SEQ ID NO:48) 25 5GACAGGATATATTGGCGGGTAAAC pTiC5S ('N (SEQ ID NO:49) (nucleotides in bold represent nucleotide substitutions) The A thaliana "T-DNA border" is from an open leading frame (nucleotides 59676-63206 30 from ALI3 8652) for a putative protein of unknown function [i.e. no promoters and presumably not a heterochromatic regionJ. 89 Examination of sequences flanking this "T-DNA border" reveal a 2838 bp fragment (nucleotides 59735-62572 from AL 138652) with several unique restietion sites suitable as potential insertion sites for other genes and Southern analysis of plants transformed using this vector. If the "T-DNA border" found at nucleotides 60629-60606 is considered the "left border" of a binary vector there are several unique restriction sites, including Xbal, between this left border and the first three nucleotides equivalent to a right border at positions 59735-59737. The right border beyond these three nucleotides can be provided by authentic right border 10 sequences of non-plant origin, thereby resulting in a "chimeric right border'. In assembling an intragenic vector all plasmid constructions were performed using standard molecular biology techniques of plasmid isolation, restriction, ligation and transformation into Escherichia coli strain DH5a (Sambrook et aL, Molecular Cloning: A Laboratory Manual, 15 2nd Ed. Cold Spring Harbor Press, 1987). The following primers were designed: 20 Primer A: 5'CCGAGGAGGTGCTAGAGCTCTA GAGCGTAAAGGAATGTCC3' (SEQ ID NO:50) Primer B: 5'AAAGGCTCGAGGTTTACCCGCCAATATATCCTGTCTATGTTTC ACATGAACACGTGAATCTTC3' (SEQ ID NO:5 1) Primer C: 5'AAAGGGTCGACTAGATCTTTCGGTTGTGTGAATGATTCCGATGA 25 GAGAAGAAGAC3' (SFQ I) NO:52) Primer D: 5'GGACATTCCTTTACGCTCTA GAGCTCTAGCACCTCCTCGG3' (SEQ ID NO:53) Restriction sites within the primers are indicated in italics; TCTAGA -- bal site, CTCGAG 30 Ahol site, GTCGAC - Sall sitc. Using Arabidopsis thaliana 'Columbia' genomie DNA as a template and primers A and B a polymerase chain reaction was performed using high fidelity Pwo polymerase to amplify a 90 "right border" 703 bp fragment which was subsequently restricted with Xbal and XhoI ligated into pPROEX-1 restricted with the same endonucleases, to form pPROEX-trb. Using Arabidopsis thaliana 'Columbia' genomic DNA as a template and primers C and D a 5 polymerase chain reaction was performed using high fidelity Pwo polymerase to amplify a "left border" 2216 bp fragment which was subsequently rstricted with Xbal and SalI ligated into pPROEX-1 -rb restricted with the same endonucleases, to form pPRCYEX-AtTD. The 2864 bp SalI to XhoI fragment of pPROEX-AtTD was ligated to the 8004 bp SalI 10 backbone of the binary vector pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203 1207) to form pTC1. The orientation of the two fragments was detennined by restriction patterns and confirmed by DNA sequencing. The full sequence of pTCl is shown below and comprises a 2838 bp DNA fragment derived from Arabidpsis rhaliana (nucleotides 59735 62572 from AL138652) presented in italics. The right and left T-DNA borders are in bold 15 and the unique XaI site used for subsequent cloning is in bold and underlined. 1 UCGACGGAT CTTTTCCGCI GCATAACCCT GCTTCGGGGT CATTATAGCG ATTTTTTCGG 61 TATACCATC CTTTTTCGCA CGATATACAG GATTTTC-CCA AAGGGTTCGT GTAGACTTTC 121 CTTGGTGTAT CCAACGGCGT CAGCCGGGCA GGATAGGTGA AGTAGGCCCA CCCGCGAGCG 20 181 GGTGTTCCTT CTTCACTGTC CCTTATTCGC ACCTGGCGGT GCTCAACGGG AATCCTGCTC 241 TGCGAGGCTG GCCGGCTACC GCCGCCGTAA CAGATGAGGG CAAGCGGATG GCTGATGAAA 301 CCAAGCCAAC CAGGGTGAT GCTGCCAACT TACTGATTTA GTGTATGATG GTGTTTTTGA 361 GCTGCTCCAG TGCCTTCTGT TTCTATCAGC TGTCCCTCCT GTTCAGCTAC TGACGGGGTG 421 GTGCGTAACC GCAAAAGCAC CGCCGGACAT CACCGCTATC TCTGCTCTCA CTGCCGThAA 25 481 ACATGGCAAC TGCAGTTCAC TTACACCGCT TCTCAACCCG GTACGCACCA GAAAATCATT 541 GATATGGCCA 'TGAATCGCGT TGGATGCCGG GCARCAGCCC CCATTATGGG CGTTGGCCTC 601 AACACGATTT TACGTCACTT AAAAAACTCA GGCCGCAGTC GGTAACCTCG CGCATACAGC 661 CGGCAGTGA CGTCATCGTC TGCGCGGtAAA TGGACG-AACA GTGGGGCTAT GTCGGGGCTA 721 AATCGCGCCA CCGCTGGCTG TTTTACGCGT ATGACAGL'CT 2CGGAAGACG GTTGTTGCC 30 781 ACGTATTCGG TGAACGCACT ATGGCGACGC TGGCCCGTCT TATGAGCCTG C-TGTCACCCT 841 TTGACGTGCT GATATGGATG ACGGAIGGCT GGCCGCTGTA TGAATCCCGC CTGAAGGGAA 901 AGCTGCACGT AATCAGCAAG CGATAVACGC AGCGAATTGA GCGGCATAAC CTGAATCTGA 961 GGCAGCACCT GGCACGGCTG GGACGGAAGT CGCTGTCGTT CTCAAATCG GTGGAGCTGC 1021 ATGACAAAGT CATCGGGCAT TATCTGAACA TAAAACACrTA TCAATAAGTT GGAGTCATTA 35 1081 CCCAACCAGG AAGGGCAGCC CACCTATCAA GGTGTACTGC CTTCCAGACG AACC-AAGAGC 1141 GATTGAGGAA AAGGCGGCGG CGGCCGGCAT GAGCCTGTCG GCCTACCTGC TGGCCGPCGG 1201 CAC-GGCTAC AAAATCACG-G GCGTCGTGGA CTATGAGCAC GTCCGCGAGC TGGCCCGCAT 1261 CAATGGCGAC CTGGGCCGCC TGGGCGGCCT GCTGAAACTC TGGCTCAccG ACGACCCGCG 91 1321 CACGGCGGG TTCCGTCATG CCACGATCCT CGCCCTGCTG GCGAAGATCG AAGAGAAGCA 1381 GGACGAGCTT GGCAAGGTCA TGA:TGGGCGT GGTCCGCCCG AGGGCAC-AGC CATGACTTTT 1441 TTAGCCGCTA AAACGGCCGG GGGGTGCGCG TGATTGCCAA GCAGTCCCC ATGCGCTCCA 1501 TCAAGAGAG CGACTTCGCG GAGCTGGTAT TCGTGCAGGG CAAGATTCGG AATACCAAGT 5 1561 ACGAGAAGGA CGGCCAGACG GTCTACGGGA CCCACTTCAT TGCCGATAAG GTGG-ATTATC 1621 TGGACACCAA GGCACCA2GC GGGTCAAATC AGGAATAAGG GCACATTGCC CCGGCGTCAC 1681 TCGGGGCAAT CCCGCAAGGA GGGTGAATGA ATCGGACGTT TGACCGGAAG GCATACAGGC 1741 AAGAACTGAT CGACGCGGGG TTTTCCGCCG 1GGATGCCGA AACCATCGCA AGCCGCACCG 1801 TCATGCGTGC GCCCCGCGAA ACCTTCCAGT CCGTCGGCTC GATGGTCCAG CAAGCTACC 10 1861 CCAAGATCGA GCGCGACAGC GTGCAACTGG CTCCCCCTGC CCTGCCCGCG CCATCGGCCG 1921 CCGTGGAGCG TTCGCGTCG-T CTCGAACAGG AGGCGGCAGG TTTGCCGAAG TCGATGACCA 1981 TCGACACCCG AGGAACTATG ACGACCAAGA AGCGAAAA.AC CGCCGGCGAG GACCTGGCAA 2041 AACAGGTCAG CGAGGCCAAG CAGGCCGCGT TGCTGAAACA CACGAAGCAG CAGATCAAGG 2101 AAATGCAGCT TTCCTTGTTC GATATTGCGC CGTGGCCGGA CACGATGCGA GCGATGCCAA 15 2161 ACGACACGGC CCGCTCTGCC CTGTTCACCA CGCGCAACAA GAAAATCCCG CGCGAGGCGC 2221 TGCAAAACAA GGTCATTTTC CACGTCAACA AGGACGTGAA CATCACCTAC ACCGGCGTCG 2281 AGCTGCGGGC CGACGATGAC GAACTGGTGT GGCAGCAGGT GTTGGAGTAC GCGAAGCGCA 2341 CCCCTATCGG CGAGCCGATC ACCTTCACGT TCTACGAGCT TTGCCAGCAC CTGGGCTGGT 2401 CGATCAATGG CCGGTATTAC ACGAAGGCCG AGGAATGCCT GTCGCGCCTA CAGGGACGG 20 2461 CGATGGGCTT CACGTCCGAC CGCGTTGGGC ACCTGGAATC GGTGTCGCTG CTGCACCGCT 2521 TCCGCGTCCC GGACCCTGGC AAOAAAACGT CCCGTTGCCA GGTCCTGATC GACGAGGAAA 2581 TCGTCGTGCT GTTTGCTGGC GACCACTACA CGAAATTCAT ATGGGAGAAG TACCGCAAGC 2641 TGTCGCCGAC G&CCCGACGG ATGTTCGACT ATTTCAGCTC GCACCGGGAG CCGTACCCGC 2701 TCAAGCTGGA ACCTTCCGC CTOATG'GCG GATCGGATTC CACCCGCGTG AAGAAGTGGC 25 2761 GCGAGCAGGT CGGCGAAGCC TGCGAAGAGT TGCGAGGCAG CCGCCTGGTG GPACACGCCT 2821 CGCTCAATGA TGACCTGGTG CATTGCAAAC GCTAGGGCCT TGTGGGCTCA CTTCCGGCTG 2881 CGGGTTCAGC AGCCACCGCT TTACVGGCAT TTCAGGAACA AGCGGGCAC'l CCTCGACGCA 2941 CTTGCTTCGC TCAGTATCGC TCGGGACGCA CGGCGCGCTC TACGAACTGC CGATAAACAG 3001 AGGATT.AAAA TTGACAATTG TGATTAAGGG TCAGATTCGA CGGCTTGGAG CGGCCGACGT 30 3061 GCAGGATTTC CGCC-AGATCC GATTGTCGGC CCTGAAGAAA GCTCCAGAGA TGTTCGGGTC 3121 CGTTTACGAG CACCAGGAGA AAAAGCCCAT GGAGGCG'TTC (GCTG1ACGGT TGCGAGATGC 3181 CGTGGCATTC CGCGCCTACA TCCACGSCGA CATCATTGGG CTGTCGGTCT TCAAACAGGA 3241 GGACGGCCCC AAGGACGCTC ACAAGGCGCA TCTGTCCGGC GTTTTCGTCG AGCCCGAACA 3301 GCGAGGCCGA GGGGTCGCCG OTATGCTGCT GCGGGCGTTC CCGGCGGGTT TATTGCTCrGT 35 3361 GATGATCGTC CGACAGATTC CAACGGGAAT CTGGTGGATG CGCATCTTCA CCTCGGCGC 3421 ACTTAATATT TCGCTATTCT CGAGCTTCGTT GTTTATTTCG GTCTACCGCC TGCCGGGCGG 3481 GGTCGCGGCG ACGGTAGGCG CTGTGCAGCC GCTGATGGTC GTGTTCATCT CTGCCCCTCT 3541 GCTAGGTAGC CCGATACGAT TGATGGCGGT CCTGGGGGCT ATTTGCGGAA CTGCGGGCGT 3601 GGCGCTGTTG GTGTTGACAC CAAACGCAGC GCTAGATCCT GTCGGCCTCG CACCGGGCCT 40 3661 GGCGGGGGCG GTTTCCATGG CGTTCGGAAC CGTGCTGACC CGCAAGTGGC AACCTCCCGT 3721 GCCTCTGCTC ACCTTTACCG CCTGGCAACT GGCGGCCGGA GGACTTCTGC TCGTTCCAGT 92 3781 ACCTTTASTG TIISaTCCGC CAATCCCGAT GCCTACA1GGA ACCAATQTTG TCGGCCTGGC 3841 0 ECOCTCGCC CTGATCGGA.G CGGGTTTAAC CTACTTCC2T TCGTTCC-GGG GGATCICGCG 3%il ACT0C2CACCT ACAC--TTCTTT CCTT2CTGGG CTTCTCAGC CGOATGSOG CTAAG-D-AGCT 3961 ATTGCCGCCG ATCTTCA.TAT GCGGTGTGAA ATACCGCACA GAkTGCGTAAG GAGAAAAkTAC 5 4021 CGCA2cAGGC GCTCTICCGC TIOCTOOCTO ACTGACTCGC 1GCGCTCGGT CGTTCCGCTG 4081 CGSCGAcC TATCAGCTCA CTCAAACGCG GTAATACGGT TATCACAGA ATCAGGGO.AT 4141 A1\CGCAGGAA. AGAACATGTG AGCPAAA\AGGC CAGCAAAAGG CCAGGAACCG TAAJh-AACGCC 4201 GCGTTGCTGG Cc-TTTTTCCA TAGGOCCCOC CCCCCTGACG AGCATCRAAAICAC 4261 TC1ACTCAGA% GGTGGCGA\1\ OCOGACAGGAR CTATAA-AGAT ACCAGGCGTT TOCCCCTGGA 10 4321 A-GCTCCCTCG -CGCTCTCC TGTT2CCGACC CTGCCGCTTA CCG-GATACCT GTCCGCCTTT 4321 CTCCCTTCGG GAASCGTGGC CCTTTCTCAA? TGCTOA"CGCT GTAGGT:ATCT OACTTCGGTG 4441 TAGGTCGTTC GCTCCAAGCT GCGCTGTGTG CACGAACCCC CCGTTCAG(CC CGACCGOTGC 4501 GCCTTALTCCG GTAAC2ATCG TCTTGACTCC AACCCGGTAAK GACACGACTT A\TCGCCACTG 4561. OCACCAGOCA GTGGTAACAG GATTASCAGA GCGAG-GTATG TAGGCGGTGC TACAiGAGTTC 15 4621 TTGAAGTGGTf GGCCTAAC-TA CGGC-TACACT A GAALGCACAG TAkTTTGG7AT CTGCGC CTC 4681 CTG2AGCCAG TTACCTTCGG -AAAAGAGTT GGTAGCTCTT GATCCGGCAA AOAAACCACC 4741 GOTGCTACCO GTGCTTTTTT rc-TTTGCAAG CGGAGATTA CGCGOAGAAA AA2XAC GATCT 4901 CAAGAAGATC CTTTGATCTT TTCTACC-GGG TCTGACGCTC AGTGGAACGA AAACTCACGT 486 TAAGGCATTT TGCTCATGAIG kTTN2CAAAA AGGATCTTCA CCTAGATCCT TTTAAATTAA 20 4921 APLTTGAAG-TT TTAAATCAA.T CTAAAGTATA TATGAGTAAA CTTGGT1CGA CAC-TTACCAA 4981. TGCTTAATCA GTGAGGCACC TATOICAGOG ATfCTCTCTAT TTC-GTTCATC CAT AGTTGCC 5041 TGACTCCOCQ I'CGTP4/AGAT AACTACGATA CSGGAIGGGCT TACGAVICTfG' COCCACTGCT 5101 GCAATGATAC CGCCACACC ACCCTCACCG GCTCC.AGATT TATCAGGAAT AZ3ACCAGCCA 5161 GCCGGAACLCG CCGAGCCCAG AAGTGGTCCT GCAACTTTAT CCGCCTCCAT CCAGTCTATT 25 522.1 AA.C-AAGTGG CAGCA ACGGA TTCGCAA-ACC TGTOACGCCT TTTGTG-CCAA AAkGCCGCGCC 5281 ACGTTTCGA TCCCCGC CAGGCGTTAG- GCGTCATATG AA-GATTTCGG TGATCCC-TCA 5341 GCAGGTGGCG GLACATTGG' AWGCTGAI:AA CCATI'TCATT GTTCGTC2GAG TGTTCGATCT 5401 GCACCTATCC GACCAAGCCT TTGAACTATC TACCAGAAGT GTGAGCCCCT ACCGGAAGGA 5461 TTJW2A!PCTCG GATGATGACT CTGATG-AAGA CTCTGCTTGC TATGGCGCA-T TCATCGAkCcA 30 5.521 AGASCTTG-TC GGGA-AGAC-TG AAC'PCAaCTC AACATGGAAC GATCWAGCCT CTATCCAACA 5 581 CATTGTTGTG TCGCAGACOC ACCGGCAA AGGACTOCGOG CACAGTCTCA TCGAAITTGC 56541 CAAAAACTGG GCACTAACCA CGACAGCTCCT TGGCAT2XCGA TTAGAGAGAC AZA CCAACAA 5701. TGTACCTGCC TGCAATTTL2T ACCCAAkAATC TC-GCTTTACT CTCGCGCCA TTCACCTCTT 5761 CACGTATA4A ACTACACOTO AAGTCTCGAAk CGA2AACACCG ATCTACTGGT ACT-GGTTCTC 35 5821 GGGAf3CACAG GATGACGCCT ALAC2AATTCAT TCAAGCCGAC ACCGCTTrCGc GGCGCGGCTT 5881 AATTCAGGAC TTAAACA-TCA TGKGGGAAGC GGTGATCGCC R'llAGTAkTCGA. CI CAACTAXC 5941 JAGAGGTAGTT GGCGTCATCG ALGCC-CCATCT CCAAGCGAGG TTCCTGGCCG TAGATWTTGT 6001 CGGCTCCG3CA GTGGA PCGCG GCC2CAAGCC' ACACACsTGAT ATTC-ATTTGC TCGTTAkCCCT 6061 GACCGTAAGG CTTGATGAAA CA-ACGCGGCG ACCTTTGATC AACGACCTTT TGGAAACTTC 40 6121 GGCTTCCCCT GACCACCOG AGATTCTCCC CGCTGTA-GAA GTCACGATTG; TT7GTGCACGA 6181 CGACATCATT CCGTGGCGTT ATCCAGCTAA GCGCGAACTG CA-ATTTGGAG AATCCACCC 93 6241 CAAT:GACATT CTTGCACGTA TCT'TCGAGCC PAGCGACGATC GACATIGMOC TOOCTATOTI 6301 CCTGACA A GCAAQAGAAC ATACCCTTcC CTTGCVAGC2T CCAGCGCCGG AGGZAACTCTT 63G1 TCA TCCQCTT CCTGAACACC ATCTATTTGA GCGCCTAAAT GAAACCTTAA. CGCTATGGAA 6421 CTCCCCGCCC GACTGGCCTC CCATQAGCG AAATGTAGTG CTTACGTTGT CCCGICATTTG 5 6481 G'-ACAGCGCA C-TAACCGSGCA A2 3 ATZCGCGcC G;A-GATCTC GCTGCCGACT GGGCAATGGA 6511 GCGCCTGCCG CGCCCACTATC ACCCCCTCAkT ACTTGAAkGC AGGCAGGCTT ATCTTGC-ACk, 6601 AGAAGATCGC TTGGCCTCCC GCCCACATCA CTTCGAAGAA TTTCTTCACT ACGTGAA-ACG 6661 CGACATCACC 74ACCTZGTCC CCAAATg-ArCG TCTATACAIT CGTTCAAC-CC OCCCCGCTT 6721 CGCCGCGC CTTAACTCAA CCCTTAGASA SCTGGGAPAG ACTAkTCCGCG ATCTGTTC~A 10 6781 GGTGGWTC A ACCCTCGTAC TTGCGATG(4C ATCGGGGCAG GGACTTGCTG ACCTGCOAAT 6841 TCTTTTACTG CATGPAGCTC G2CTTCCCTT TCACTACTCC CCATCCAACT ACGACATTTC 6901 T CCAPAGCTAAC TACGACAhCT CCP-APAGCAA TTACGACAA T AGTCCATCAA A!-TCGACAAL 6961 CT02GAG AGC JACTAC-GATA ATAQTTCATC CAATTACGAC AATAGTCGCA ACGCAAATCG 7021 TAGGOTTATA TATAGCG-CAAk ATGGGTCTCG GACTTTCGCC CGC2A.CTACG WCATTGCCAA 15 '7081 C-AATGCGACA ACGAAC2TCT TTTC-CACA.TC TGGCAAIAAGG ATCTTCTACA CCCCAAM~GG 7141 C-GGGCC-CGGC GTCTATGGCG CCAAAGATGC GAGCTTCTCC CGGGCATTGG TCGTCATAAA 7201 TGGCCAATTT TCGCT'V:GCCC TCACAGATA A CGGCC7CG-A ATCATGTATC 2ACCAAhCTA 7261 GCCTGCTCTC TAATAATG TTAGGAGCTT GGGTGCCATT TTTGGGGTGA OCCGTTCGC 7221 CGCCGAGGGG CGCAGCCCCT GGGGGGAT GC GAG-GCCGCC TTAGCGGGCC GGGAGCSTTC 20 7331 GAGALAGGCGG GGOACCCCCC TTCGGCGTGC GCGGTCACGC GCCAGOrCGC AGCCCTGC;TT 7!41 A.AAAAAG '2TTAVAAA-TA 'ITGGiTI AAA AG-CAGGTi'AA A-AGACAGGTT AGCGGTGSCC 7501 GAAAAACCCGC CGGAAUACCCT TCCAAATGCT G0APTTTC=C CCTGTGGACA GCCCCTCAAA 7561 TCGTCAAGG TCCCCCCTC ATCTCTCAGC ACTCTCCCCC TCAAGTGTCA ACG2ATCGCGC 7621 CCCTCATCTG T7CAGTAGTCG CGCCCCrCA±zA GTCTCAATfAC CGCAGGGGAC TTATCCCCAC 25 7681 GCTTGm cCAC kTCATCTGTG OSAAACTCCGC GTAA'AATC~kC GCGTTTTGGC CCATTTCCCA 7741 GCC!G-GCCAG-C CTCCACGTC3 COGGCCGAAA TCGAkGCCTUC CCCTCATCTS TCA CCCCC 7801 CCCGGGTGA-G TCGGCCCCTC AAGTGTC&AC GTCCGCCCCT CATCTGTCAG TGAGCCCCAA 7861 GTTTTCCGCG ACGTATCCAC AACGCCGGCC GCCGGCCGCG GTGTCTCGCA CACGGCTTCG 7921 ACGGCGTTTC TGGC-GCGTTT CbGCACGGCCAT AGvACGGCCGC CAGCCCAGCG (3CGACC-CCAA 30 7981 CGAGCCCGGT GAGCGTCGGA AMGG-TCGAG r-TTTACCrC CAATATATCC WTCTAC- 2MTT 2041 TCACATGAAC ACGTGAATCT T'CTTCAACA-C GCCCACCT-AA CCGCTCCTTT G-OAGATAATC 2102 GA CGGCGTCG AGTTGA2'GTG TGATCAAUAT TACC'AGAATT CGTTQ'CATUA GCTG AGTA'C 21612 C7GAA TT GT TC ICTGCTTATT CCTCCATCCA CTCCATACTT CCCTAGCVTG TC-TCTGTAJ' 0221 OATATG-GTAC WTCATGTTC-A COL-GTWT TAG TATCTGC GCTTGTGAkTAA GACATTCTTG 35 8282 ATTGCTTAGC ATCCCTGTAG TTGTAATCAT AAGGCAWATT CTCATG-:CAT- AcUcTcAC'TT& 6341 COTTGTCTCT AAGACGATAA TCATGTCTTG TACGGAAA AT PGAATC''TC GAATGATAAA 8401 CCTCTTGTCT ACCATCTTGA TATCTCATAT TGGGATAAAC TTTAACATCA CCACCATfTAC 8461 GTCGTTGCAA ACGC2'CATCA XCCAAGTAGA CTIGATCTCC3 GTCATC-AAA AGATATCTCC 8521 TCCCTCGAAO AGCTTGCTCA 2CTTGCTTGC CAGCTGALTGA TGTACTGAGA TCAGGATGC.A 40 258. TOACCOCATA CGAATCAATT TCATGATCTC TTACGAGTTG CTGGCTTTCA TAGGGGAkAAT 8642 AGGCT-TCCT TCCGCGATTC. GACGACATTC CTTTAICGCTEC TAOACCT9.A CGACCTCCTC 94 8701 >CCACAAV CTCTGCT7TG CTUACACCAG GATACATCCT CTC.ATCAATG CCAGAGTCGT 0761 AGTACTTCI& TWGTTCTTTA TI'GTAATGCT GATAAACATC CT1'GCTTTCA TTAVTCCAA.AT 8,521 ACCCTTCATT TCTATCAAT2'0 AGCT, CT'C TGCTAAGCTC TAGCG3CCT2TC, GVA TCTCCA? 881 GGTCTAC7'AT AATA-zTCTGAkC GAGTTGACAT CAO3ATATAT CCTG-TCATCA ATCGCCATACT 6 941 CATGATCTTT CTTAAGTWGT TGGCTTTCGT AAWCCAOGATA TGCA2CCCCC CTTflLTAAR. 9001 CCATGTATCA TTCCTCTCCA TCATCCAAPCG ATCCTCr1'CT ACCC2'CAAGA GCTCTGCTT 9061 CTTCCCCGTT TACAAG-AATPA TCTCATTTAT TGACACTOCOG ATGCA27CA TG CCAAAAGAGT 9121 TACTTTC-ATC ATCTTTTACG ACTrCCTCV TTTCACI'TTG AAAATATCCT TCCTTTCGA1T 9281 CATTTAAGCA TAICICCTCTA TA-CTTAG-AC- CTCTTCCATC TTC.ATGGTCT ACTAGAAA' 10 9241 CTGATCTGTT GA CA TCA GCA G.CATC-ATGA CATAAC-AGTC A3;TITCATMA TCCTTTACGA 9302l OTTCCTGCTT TTCACATTGC AAGTATOCGT CCTQTTTATC ATTCAAGCAC ACTCCTCCAT 9361 ACCTCCGACC TCTGGCATCT TCATCGTCTA CCAGPAATC TGATTTGTTG ACATCGGGAT 9421 GCCTCATGAC GTAACAGCTCA GTTTCATGAT CGTJJTAGGAG TC-GCTGCC'T TCACAT20A 9481 AGTATGCTTC CTTTTTATVA TTGAACGAAA CTCCTCTATA CCTCCGACCT CTGCCAIJCTT 15 9541 CATOOTOCTAC CAGAGTATCT G-ATTTGTTGA CATSGCGCATC CAkTCATGCCA TAGGAGTTAZG 9601 TTTCATAATC ATTTAGGAGT CTCTGTCTTT CACATTGCAT GTATGCTTCC TTTTIATCL'gr 966:1 TCAAGgACCC TCCTCTAT-AC CTTAGA.zCCTT TCCAATCTTC CC-GG-TCTTCC ACACTATCTC 9721 ATTTGTPGAC ATCOGCAT&C ATTAT&CCAT AGGAG2TAGT TTCA'.tAATCA T'TTAGGAG ' 9782 GCTCCGCTTTC ACATTOCAA& TAAV-CTTCCC TTCTATCATT TAAGGACCCT CCTCTATACC 20 9841 TTAGACCTCT C-GAL,'TITWOC CGTTCCCAG-T C TGC TAG 1AT ATCTAAT'CTG TTCACAT&1S'T 9902 CAGGA2'UAA CTTAGCATC.A G.AGCCAC-ACT CATAATCTTT CTCCAGTTCT TGG-ATTTTGT ,9561 A-ATTCAATA AA-CATCCTTC CTTTCATTAT CCAAGTATG-C TGCC7TTCCT TTGTTTAAGC 10021 ATVG&TCGTTG AAGCTGCACT CCT'CTTCCAT CCTGATCTA7C CACAATA TCT GCA TCTA 10081 CATCA4GAA;TG TATCCTACCA TC'ATTGCCAG GGTGATACTC GTTTCTCAGT TCCTCTCTTT 25 .7074,7 TATCA-ZTCTGA AAAAACAGCA TTTCVCTr7AT TATCGAAATA TGCTTCCCTT TCTPTATTTA 10202 AiGCArACGTGT TZiTCCTCTGT OAACGCTTTAT CATC-TCCATC TACTAZCA-GCA' TATCTTCjAC 10261 TGAAATCAAG ATTCTTCTTA CTGTCAACAC CATOATATAG ATAATCCTTT CTCAGTACTT 10322 G-AVATTTGTT-ATCCAAATAA ACAACCTTTC TTTCTTCGTT ACGGAAGTTC CTQTAGrGA2' 10381 CATOTCTC ATOCACCACT CITOATOCCA ACTCCACAAA AGATAATCT TCCTTCACAC 30 10441 ACTCATAA1'G GTCAGCCATC CTCTCTTTCC TOCTAAACTU AAGATGGGTA. TOGOCCOCAT 1 0502 CACATCACC WATATTTGAAP CCACAGAT CCCATTTTCA TAAAGATCCT CTCCTCTGGA 1 0562 TAAAAAGATC AITTCTCTCTP GCCACATTAT TGAV CTCVTG CCTA-AC.ACTC CGCAAACTCTC 10621 TCATTC!'AT ATCAGACGCCT AZ'ATOATAAT 2-AT CCAGC 2'TCATCOACT ATCTCTTTGA -10682 CACACCTGCT CACAACTGGT GAATCATGGT CTCCACCACT TAAATCTCTAP ACTTGTTGAT 35 10741 CCC2WGG2YJA GTTTCTACCA ACATAATCAT rJU-ACACGTCI' ACTACTACA ACCTGTGGTA 10801 CACAA4GAJT CCCATCATAA TCATGTCTTVC TTCTCTCATC Gt3AATCATTC ACAC-AACCGA 10861 AAG-ATCTA (SEQ rD NO:54) 95 A mutant form of the Arabidopsis thaliana acetohydroxyacid synthase gene conferring resistance to sulfonylurea herbicides such as chlorsulfuron was inserted into the T-DNA of pTC1. The 5.8 kb XbaI fragment from pGHI (Haughn et al. 1988, Molecular and General Genetics 211:266-271) was ligated into the unique Xbal site between the left and right T 5 DNA borders of pTCl to produce pTCAHAS. The orientation of the two fragments was determined by restriction patterns and confumed by DNA sequencing. 96 Example 7 Transformation of Arabidopsis thaliana with an intragenic vector The pTCAHAS binary vector was transformed into the disarmed Agrobacterium tumefaciens strain EIA05 (Hood et al 1993, Transgenic Research, 2:208-218), using the freeze-thaw 5 method (HWfgen & Wilhmitzer 1988, Nucleic Acids Research, 16: 9877). Agrobacterium was cultured overnight in LB broth supplemented with 300 mg/L spectinomycin and used to transform A rabidopsis thaliana 'Columbia' using the floral dip method (Clough and Bent, Plant Journal 16: 735-743, 1998). 10 The resulting self pollinated seed was screened in vitro on half-strength MS salts (Murashige and Skoog 1962, Physiologia Plantarum, 15: 473-497) supplemented with 10 gg/L chlorsulfuron. Seeds were also sown on a standard potting mix in a, greenhouse and the germinated seedlings at the 3-4 true leaf stage were sprayed with a standard application of Glean (active ingredient chloisulfuron) at a rate equivalent to 20 g/ha. 15 Genomic DNA from Lhe recovered chlorsulfuron-resistant seedlings were confirmed as being transfonied with the intragenic vector pTCAHAS by polymerase chain reactions across the junctions of the two XbaI sites adjoining the original T-DNA of pTCl and the inserted 5.8 kb Xbal fragment to form pTCAHAS. The following primers were used; 20 Primer El: 5'CATCCACTGCATAGTTCCC3' (SEQ ID NO:55) Primer F: 5'GATGCGTTGATCTCTCATCA3' (SEQ ID NO:56) Primer G: 5'TCAACATCAATCCGAGTACO3' (SEQ ID NO:57) Primer H: 5'AGAGATTGTGGACCGAGGAG3' (SEQ ID NO:58) 25 As illustrated in Figure 3, the expected 643 bp DNA fragment was PCR amplified from fi binary vector pTCAFIAS and three A. thaliana lines transformed with pTCAHAS using primers E+F designed to flank the XbaI site inside the right T-.DNA border. Similarly, the expected 149 bp DNA fragment was PCR amplified from the same DNA sources using 30 primers G+H designed to flank the Xbal site inside the left T-DNA border. 97 Example 8 Construction of additional intragenic vectors In assembling the intragenic vector all plasmid constructions were performed using standard molecular biology techniques of plasmid isolation, restriction, ligation and transformation into 5 Escherichia coli strain DI-5a (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). A binary veetor with a T-DNA composed of potato DNA The 1268 bp sequence illustrated in Example 2 as a T-DNA-like region of a potato (Solanum 10 ruberoswn) intragenic vector was synthesised by Genscript Corporation (Piscatawa, NJ, www.genscriptcom) and supplied cloned into pUC57 (pUC57POTINV). The Sall fragment encompassing the T-DNA composed of potato DNA from pUC57POTINV was isolated by restriction, then ligated to the 8004 bp Sall backbone of the binary vector 15 pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) to form the binary vector pPOTINV, The orientation of the two fragments was determined by PCR analysis across the junctions of the two Sall sites and DNA sequencing. The pPOTINV binary vector was transformed into the Agrobacterium strain A4T, also known 20 as C58C1 (pArA4b) (Petit et al 1983, Molecular and General Genetics, 190:204-214), using the freeze-thaw method (H1fgen & Willmitzer 1988, Nucleic Acids Research, 16: 9877). The Agrobacteriwn was cultured overnight in LB broth supplemented with 300 mg/L spectinomycin for co-cultivation with leaves from in vitro cultured potato plants. 25 Virus-free potato plants of cultivar Iwa were multiplied in vitro on MS salts and vitamins (Murashige and Skoog, 1962, Physiologia Plantarum, 15: 473--497), plus 30g F sucrose, 40 mg Y' ascorbic acid, 500 rmg 1' casein hydrolysate and 7 g P 1 agar, adjusted to pH 5.8 with 0.1 M KOH. Plants were routinely subcultured as 2-3 node segmsenis every three to four weeks and incubated at 26 "C under cool white fluorescent lamps (80-100 pmnol m sec-1; 16 h 30 photoporiod). Leaves were excised from the in vitro plants, cut in half, dipped for about 30 sec in the liquid culture of Agrobacterium strain A4T harbouring pPOTINV, then blotted dry on sterile filter paper. These leaf segments were then cultured on potato median defined above and incubated under reduced light intensity (5-10 pnol m2 see'). Two days later, the 98 leaf segments were transferred to the same medium supplemented with 200 mg 1-1 Titentin to prevent Agrobacterium overgrowth. Hairy roots were selected on MS medium without growth regulators. Genomic DNA isolated 5 from these hairy roots was screened via PCR to identify those derived from co-transfonnation with pArA4b and pPOTINV. The following primers were used: Primer I: 5'GCTCACCTTGrCAGCT.TCACT3' (SEQ ID NO:59) Primer J: 5-CAGAGCTGGATTTGCATCAG3' (SEQ ID NO:60) to amplify an expected 570 bp DNA fragment from the T-DNA-like region of pPOTINV, and 10 Primer K: 5'GATGGCAGAAGGCGAAGATA3' (SEQ ID NO:61) Primer L: 5'GAGCTGGTCTTTGAAGTCTCG3' (SEQ ID NO:62) as an internal control to amplify an expected 1069 bp fragment from the endogenous potato actin gene. The expected 1069 bp fragment was amplified using primers K and L from all hairy root lines, including control hairy root line transformed with Agrobacterium strain A4T 15 without the binary vector pPOTINV. The expected 570 bp DNA fragment was PCR amplified from the binary vector pPOTINV and from two of 80 hairy root lines tested using primers I and J (Figure 4). The DNA samples from the two hairy root lines positive for the T DNA from pPOTINV and thC control hairy root lines were also used for PCR using primers designed for the Agrobacterium virG gene: 20 Primer M: 5'GCGGTAGCCGACAG3' (SEQ ID N0:63) Primer N: 5'GCGTCAAAGAAATA3' (SEQ ID NO:64) The DNA samples from all hairy root lines failed to amplify PCR products using primers M and N (Figure 5). Furthermore, cultures of these hairy roots failed to grow bacteria when incubated in LB medium. These results establish the absence of associated Agrobacterium 25 with the hairy roots. The 2.5% co-transformation frequency (2 of 80) of T-DNAs from pArA4b and pPOTINV was achieved despite selection for only hairy roots. This demonstrates that the pFOTINV binary vector is effective in transforming potatoes. A binary vector with a T-DNA composed of petunia DNA 30 The 1507 bp sequence illustrated in Example 2 as a T-DNA-like region of a petunia (Petunia hybrida) intragenic vector was synthesised by Genscript Corporation (Piscatawa, NJ, www.genscriptcom) and supplied cloned into pUC57 (pUC57PETINV). 99 The Sall fragment encompassing the T-DNA composed of petunia DNA from pUC57PETINV was isolated by restriction, then ligated to the 8004 bp Sall backbone of the binary vector pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) to form the binary vector pPETINV. The orientation of the two fragments was determined by PCR 5 analysis across the junctions of the two Sall sites and DNA sequencing. The pPETINV binary vector was transformed into The Agrobacterium strain A4T, also known as C58CI (pArA4b) (Petit et al 1983, Molecular and General Genetics, 190:204-214), using the freeze-thaw method (H6fgcn & Willmitzer 1988, Nucleic Acids Research, 16: 9877). The 10 Agrobacterium was cultured overnight in LB broth supplemented with 300 mg/L spectinomycin for co-cultivation with leaves from in vitro cultured potato plants. Virus-free potato plants of cultivar Iwa were multiplied in vitro on MS salts and vitamins (Murashige aid Skoog, 1962, Physiologia Plantarumn, 15: 473-497), plus 30g 1-1 sucrose, 40 15 mg 1 - ascorbic acid, 500 mug 1- casein hydrolysate and 7 g F' agar, adjusted to pH 5.8 with 0.1 MY1 KOI. Plants wore routinely subcultured as 2-3 node segments every three to four weeks and incubated at 26 'C under cool white fluorescent lamps (80-100 itmol m 2 see-; 16 h photoperiod). Leaves were excised from the in vitro plants, cut in half, dipped for about 30 see in the liquid culture of Agrohacterium strain A4T harbouring pPETINV, then blotted dry 20 on sterile filter paper. These leaf segments were then cultured on potato medium defined above and incubated under reduced light intensity (5- 10 pimol tn" 2 sec-'). Two days later, the leaf segments were transferred to the same medium supplemented with 200 mg 1 - Timentin to prevent Agrobacterium overgrowth. 25 Hairy roots were selected on MS medium without growth regulators. Genomic DNA isolated from these hairy roots was screened via PCR to identify those derived from co-transformation with pArA4b and pPETINV. The following primers weie used: Primer 0: 5'GAGATAAACAAATAGTCCGGATCG3' (SEQ ID NO:65) Primer P: 5'GGGAGCATTTGGTGGAAATAG3' (SEQ ID NO:66) 3C to amplify an expected 447 bp DNA fragment from the T-DNA-Iike region of pPETINV. The same DNA samples were also used in a PCR using primers K and L designed to amplify an expected 1069 bp fragment from the endogenous potato actin gene as an internal control. The expected 1069 bp fragment was amplified using primers K and L from all hairy root lines. including control hairy root line transformed with Agrobacteriun strain A4T without the 100 binary vector pPETINV. The expected 447 bp DNA fragment from the T-DNA-like region of pPETINV was PCR amplified from the binary vector pPETINV and from one of 85 hairy root lines tested using primers 0 and P (Figure 6). The DNA sample from the hairy root line positive for the T-DNA from pPETINV failed to amplify a PCR product using primers M and 5 N designed for the Agrobacterium virG gene (Figure 7). Furthermore, a culture of this hairy root line failed to grow bacteria when incubated in LB medium. These results establish the absence of associated Agrobacterium with the hairy root line positive for the T-DNA from pPETINV. The 1-2% co-transformation frequency (1 from 85) of T-DNAs from pArA4b and pPETINV was achieved despite selection for only hairy roots. Overall, these results 10 demonstrates that the pPETINV binary vector is effective in transforming plants. A binary vector with a T-DNA composed of onion DNA The 1075 bp sequence illustrated in Example 2 as a T-DNA-Iike region of an onion (Allium 15 cepa) intragenic vector was synthesised by Genscript Corporation (Piscatawa, NJ, www.gensoript.com) and supplied cloned into pUC57 (pUC57ALLrNV), The Sall fragment encompassing the T-DNA composed of onion DNA from pUC57ALLINV was isolated by restriction, then ligated to the 8004 bp Sal backbone of the binary vector 20 pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) to form the binary vector pALLINV. The orientation of the two fragments was determined by PCR analysis across the junctions of the two SalI sites and DNA sequencing. 101 Example 9 Design, Construction and Verification of Plant Derived Recombination Sites: loxP-like sites for recombination with Cre recombinase BLAST searches were conducted of publicly available plant DNA sequences from NCBJ, $ SGN and TIGR databases. 1) Potato DNA fragment containing ajoxP-like sequence - POTLOXIP A fragment containing a loxP-like sequence was designed from two EST sequences from 10 potato (Solanum iuberosun) (NCBI accessions BQl 11407 and BQ045786). This fragment, named POTLOXP, is illustrated below. Restriction enzyme sites used for DNA cloning into the potato intragenic T-DNA described in Example 8 are shown in bold and the loxP-Iike sequence shown in bold and light grey. 15 gat ] 202 25 (SEQ ID NO:67) Nucleotides 1-3 part of EcoRV restriction enzyme site (fiom the potato intragenic vector pPOTINV) Nucleotides 4-402 nucleotides 17-415 of NCB1 accession BQ 111407 30 Nucleotides 403-653 nucleotides 298-548 of NCBI accession BQ045786 Nuclcotides 654-655 part of EcoRV restriction enzyme site (from the potato intragenic T-DNA) The designed potato loxP-like sequence has 6 nucleotido mismatches from the native IoxP sequence as illustrated in bold below. 102 loxP sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO:68) Potato loxP-like CGAAT AGNATACATTAT 4 G CA P (SEQ ID 5 NO:69) The 655 bp POTLOXP sequence illustrated above was synthesised by Genscript Corporation (Piscatawa, NJ, Yrw.enscript.com) and supplied cloned into pUC57. All plasmid constructions were performed using standard molecular biology techniques of plasmid 10 isolation, restriction, ligation and transformation into Escherichia coli strain DH15a (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). Initially the 1286 bp SalI fragment encompassing the T-DNA composed of potato DNA from 15 pJC57POTINV (described in Example 8) was subcloned into pGEMT to form pCEMTPGTTNV. POTLOXP was then cloned into pGEMTPOTINV twice, firstly as a Xbal to ClaI fragment, then subsequently as a EcoRV to EcoRV fragment. Conf imation of the POTLOXP inserts was verified using restriction enzyme analysis and DNA sequencing, The resulting plasmid was named pPOTL JOXP2. 20 The DNA sequence of the 2316 bp SailI fragment comprising the potato derived T-DNA region in pPOTLOXP2 is illustrated below. Only the nucleotides in italics are not part of potato genome sequences. The POTLOXP regions are shaded. The T-DNA borders are shown in bold, with the left border positioned at 314-337 and the right border positioned at 25 2005-2028. Restriction sites illustrated in bold represent those used in cloning the POTLOXP regions into pGEMTPOTNV. Unique restriction sites in pPOTLOXP2 for cloning between POTLOXP sites are: AfII C/ITAAG AgeI A/CCGGT 30 BamHI G/GATCC BstD102I GAG/CGG CspI CG/GWCCG PinAI A/CCGOT 103 G;TCACAGTA AGTTGCACCTGGA~jAGTTTAT TTCCGGAGc9 IITCCT TTCTAGCAGGTC TTGAACGCTTAGATTGA,CAGATGTAGGCCC7:UT7.AGAGA TCTTGACTTGTT TCAGCAGCAT1CAGAT GAAGCTTCTGAGAGTTGACCTGAT CCATGATCTGT 5 AGCAGTTGCTTCTACTTCTTCCACTGCTAACGCC'TCGTCAAGCT TTAATTTAGGTCGTMAATGCA~CC TCTAAT-GGGGSACATTTATAATGTGAC ACAGGCAGGATATATTTTGGGG.TAA~-GATCTMGATTCCAGG ,GGC GGTGCTTTCAGCT ACCTTGCAGCTAGTT -- TTAA
CAAC"-ACTW.
10 15 ____ ~ AGl
......
CGG..AGA...T.....GITCAGGTTT CTGAGGATGGCACTATC 20 AAAGCCACCGACTTA2GXk GATA-CACG CGAGATAAA GGTCTTA-CCTTTAT GA TCAGCTATC-kCCTCAT GCACAGPT-CTATAGTGGTGATCC 25 _ ftAC~G~TAGTJXQCGAATTCGTATPCG ~*---~ G 2 ~~TLm J)ACTC 3T £MC~TI _____TTCTCT 300 GGCACTGCT CAATATATGAGGTGGGCCCGAGAAGCAGGTACCAATCTGTCCTCATCAAGAGA TGCATTCTT TACCAATCCAACCGTCAAAGCATACTACAAGTCTTTTGTCAAGGCTATTGTGA CAAGAAAA AACTC TATAAGTGGAGTTAAATAT TCAGAAGAGCCCGCCATATTTGCGTGGGAA CTCATAAAT AGCCTCGTTGTGAATCCAGTTCATCAGCTGC TGCTCTCCAGGCGTGGATAGC 5 AGAGATGGCTGGATTTGTCGAC (SEQ ID NO:70) The ability of this construct to undergo recombination between the POTLOXP sites was tested in vivo using Cre recombinase expressing Escherichia coli strain 294-Cre (Buchholz et 10 al., 1996, Nucleic Acids Research 24 (15) 3118-3119). The binary vector pPOTLOXP2 was transformed into K coli strain 294-Cre and maintained by selection with 100 mg/l ampillicin and incubation at 23 *C. Raising the temperature to 37 'C induces expression of Cre recombinase in E. coli strain 294-Cre, which effected recombination between the two POTLOXP sites in pPOTLOX2. This was evident by a reduction in the size of pPOTLOXP2 15 from 5316 bp to 4480 pb. Plasmid isolated from colonies of . coli strain 294-Cre transformed with pPOTLOXP2 and cultured at 37 'C, was restricted with Sall All colonies tested produced the fragments of 3.0 kb and 1.5 kb expected when recombination between the POTLOXP sites has occurred (Figure 8). 20 Recombination between the POTLOXP sites was further verified by DNA sequencing. Plasmid was isolated from colonies of E. coli strain 294-Cre transformed with pPOTLOXP2 and cultured at 37 *C, then DNA sequenced across the SalI region inserted into pGEMT, The resulting sequence from two independent cultures is illustrated below and confirms that recombination is base pair faithful through the remaining POTLOXP site in plasmid 25 preparations. Only the nucleotides in italics are not part of the potato genome sequences. The remaining POTLOXP region is shaded. The T-DNA borders are show in bld, with the left border positioned at 314-337 aid the right border positioned at 1169-1192. Restriction sites illustrated in bold represent those remaining from cloning the POTLOXP regions into pPOTINV. 30 GTCGACAGTAAAA-GTTGCACCTGGAATAAGGTTTT CATTCTTCACAGGAGGCATCT CACTCT TTCTAGCAGGTCTTGAACGCTTAGATT GAACAGAT GTAGGACTCACAT CTGATATGGAGGAT TCTTCACTT GTTTCAGCAGCATCAGAT GAAGCTTCTGAGACTTCACCTGATCCAT CATCT GT AGCAG TTGCTT CTACTTCTTCCACTGCTACATCAGTCT CAGTTGCTGATACTATAAGACCTC 105 T TAATT TAGGTCGTAAAATGCAACCAACTCTAAAATGGGGAAACAATTTAATAGATCTTGAC AGAGGCAGGATATATTTTCGGGTAAACGGGAATTCTTCAGCAGTTGCTCGAGGGAGATTGG C GGTGCTTTCAGCTCACCTTGCAGCTTCACTCAACGTCTCCGATTTAACAACCTT CAAACTTR 10 ATCATACAGTCAATGCCCCATGATCCTCATCCAA TGGGGGTTCTTGTCAGT 15 GCAATGAGTGCTCTTTCCGTTTTTCATCCTGATGCAZATCCAGCTCTGAGAGGACAGGATAT ATACAAGTGTAAACAATTTAAAAGCATATGGT GC CACTCCTCATATAT ATGAGGTGGGCGCGA GAAG CAGGTACCA ATGTGT CCT CATCAAGAGATGCAT T CT TTACCAAT CCAACGGTCAAAGC ATACTACAACTCTTTTGT CAAGGCTATT GTGACAAGAALAAACTCTATAAGTG GAGTTT-AAAT ATTCAGAAGAGCCCGCCATAT TTGCGT CGCA ACTCATAAATGAGC CTC GTTGTGAATCCAGT 20 TCATCAGCTGCTGCTCTCCAGGCGTGGATG-CACAGCATGGCTGGATTTGTCGAC (SEQ ID NO:71) 2) LoxP-like sequences from other species 25 Medicago trunculata (barrel medic) loxP-iike sequence designed from 2 ESTs LoxP ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO:68) Barrel medic IoxP-like ATGACTTCGTATAATGTATGCTATACGAAGTGTG (SEQ ID NO;72) 30 Nucleotides 1-19 Nucleotides 109-127 of NCBI accession CA919120 Nucleotides 20-34 Nucleotides 14-28 of NCBI accession CA989265 The barrel medic loxP-like site has 4 nucleotide mismatches from the native loxP sequence (illustrated above in bold). 106 Picea (spruce) IoxP-Iike sequence designed from 2 ESTs LoxP ATAACTTCGTATAATGTATOCTATACGAAGTTAT (SEQ ID NO:68) 5 Spruce loxP-likc ATACCTTCGTATAATGTATGCTATACAAAGAAAT (SEQ ID NO:73) Nucleotides 1-15 Nucleotides 226-240 of NCBI accession C0215992 Nucleotides 16-34 Nucleotides 148-166 of NCBI accession C0255617 10 The spruce loxP-like site has 4 nucleotide mismatches from the native ioxP sequence (illustrated above in bold) Zea mays (maize) loxP-like sequence designed from 2 ESTs LoxP ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ 15 ID NO:68) Maize loxP-like GCCACTCCGTATAAIGTArJTCTATACGAAATGAT (SEQ ID NO:74) Nucleotides 1-20 Nucleotides 326-345 of NCBI accession CB278114 20 Nucleotides 21-34 Nucleotides 11-27 ofNCBI accession CDO01443 The maize ioxP-like site has 6 nucleotide mismatches from the native loxP sequence (illustrated above in bold) 107 Example 10 Design, Construction and Verification of Plant Derived Recombination Sites:fr-like sites for recombination with FLP recombinase BLAST searches were conducted of publicly available plant DNA sequences from NCBI, 5 SGN and TIGR databases. 1) Potato-DNA fragment containing afrt-like sequence -POTFRT A fragment containing afrt-like sequence was designed from two EST sequences from potato (Solanum tuberosum) (NCBI accessions BQ513657 and BG098563). This fragment, named 10 POTFRT, is illustrated below. Restriction enzyme sites used for DNA cloning into the potato intragenic T-DNA described in Example 8 are shown in bold and thefir-like sequence shown in bold and light grey. (SEQ ID NO:75) Nucleotides 1-3 part of BfrI restriction enzyme site (from the potato intragenic 20 vector pPOTINV) Nucleotides 4-45 nucleotides 454 to 495 of NCBI accession BQ513657 Nucleotides 46-185 nucleutides 40 to 179 of NCBI accession B0098563 The designed potatofrt-like sequence has 5 nucleotide mismatches from the nativefrt 25 sequence as illustrated in bold below. ft sequence GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC (SEQID NO:76) Potatofrt-like sequence NCTGTC TTAICT I OTN T . (SEQ ID 30 NO:77) The 185 bp POTFRT sequence ilustrated above was synthesised by Genscript Corporation (Piscatawa, NI, www.enscriptoom) and supplied cloned into pUC57. All plasmid constructions were performed using standard molecular biology techniques of plasmid 108 isolation, restriction, ligation and transformation into Evcherichia co/i strain DH5a (Sambrook er al., Mulecular Cloning: A Laboratory Manual,. 2nd Ed. Cold Spring Harbor Press, 1987). 5 POTFRT was cloned into the T-DNA composed of potato DNA residing in the plasmid pGEMTPOTINV (described in Example 9) twice, firstly as a EcoRT to hvrll fragment, then subsequently as a fI to BanI fragment. Confirmation of the POTFRT inserts was verified using restriction eizyne analysis and DNA sequencing. The resulting plasmid was named pPOTFRT2. 10 The DNA sequence of the 1432 bp Sall fragment comprising the potato derived T-DNA region in the resulting pPOTFRT2 is illustrated below. Only the nucleotides in italics are not palt of potato genome sequences. The POTFRT regions are shaded. The T-DNA borders are 15 shown in bold, with the left border positioned at 314-337 and the right border positioned at 1121-1144. Restriction sites illustrated in bold represent those used to clone the POTFRT regions into pGEMTPOTlNV. Unique restriction sites in pPOTFRT2 for cloning between POTFRT sites are: Agel A/CCGGT 20 BstD1021 GAG/CGG Clal AT/CGAT CvpI CG/GWCCG PinAl A/CCGGT 25 GTCGACAGTAAAAGTTGCACC TGCGAATAACGTTTTCATTCTTCACAGGAGGCATCTCACTCT TTCTAGCAGGTCTTGAACGCTTAGATTGAACAGATGTAGGAC TCACATCTGATATGGAGGAT TCTTSACTTGTTTCAGCAGCATCAGATGAAGCTTCTGAGACTTCACCTGATCCATCATCTGT AGCAGTTGCTTCTACTTCTTCCACTGCTACATCAGTCTCAGTTGCTGATACTATAAGACCTC 30 TTAATTTAGGTCGTAAATGCAACCAACTCTAAAATGGGGAAACAATTTAATAGATGTTGAC AGAGGCAGGATATATTTTGGGGTAAACGGGAATTC __ GTTdQTAcT CI
AGAAACTTCCGGTGTATCCGCCGTTTCCGGCGTTGCACCTCCGCCGAATCTAAAPAGGTGCGT
109 TGACGATCATCGATGAGCCGGACCGGTAAGAAGTATCCGGTTCAGGTTTCTGAGGATGGCACT ATCAAAGCCACGACTTAAAGAAGATAACAATCAGGACAGAATGATA-AAGGTCTT , i 5 MM V MATCCTTAC-ATATCGAG GCTACCCTATTGAAGAGCTGGCCGAGGGAACTTCCTTCTTGGAAtGTGCCATATCTTTTGTTG TATGGTAATT TACCATCT GAGAACCAGTTAGCAGACTGGGAGTTCACAGTTTCACAGCATTC AGCGTTCCACAAGCACTCTTGGATATCATACAGTCAATGCCCCATGATGCTCATCCAATGG GGTTCTTGTCAGTCCAATGAGTGCTCTTTCCGTTTTTCATCCTGATGCAAATCCAGCTCTG 10 AGAGGACAGGATATATACAAGTGTAAACAATTTAAAAGCTATGGTGG CACTGCTC2ATATA TGAGGTGGGCGCGAGAAGCAGGTACCAATGTGTCCTCATCAAGAGATGCATTCTTTACCAAT CCAACGGTCAAAGCATACTACAAGTCTTTTGTCAAGGCTATTGTGACAAGAAAAAACTCTAT AAGTGGAGTTAAATATTCAGAAGAGCCCGCCATATTTGCGTCGGAACTCATAAATGAGCCTC GTTGTGAATCCAGTTCATCAGCTGCTGCTCTCCAGGCGTGGATAGCAGAGATGGCTGGATTT 15 GTCGAC (SEQ ID NO:78) The ability of this construct to undergo recombination between the POTFRT sies was tested in vivo using FLP recombinase expressing Escherichia coli strain 294-FLP (Buchholz et al., 20 1996, Nucleic Acids Research 24 (15) 3118-3119). The binary vector pPOTFRT2 was transfonned into -E cali strain 294-FLP and maintained by selection with 100 mg/I ampillicin and incubation at 23 *C. Raising the temperature to 37 *C induces expression of FLP recombinase in .coli strain 294-FLP, which effected recombination between the two POTFRT sites in pPOTFRT2. This was evident by a reduction in the size of pPOTFRT2 25 from 4432 bp to 4086 pb. Plasmid isolated from colonies of E coli strain 294-FLP transformed with pPOTFRT2 and cultured at 37 "C, was restricted with Sall. All colonies tested produced the fragments of 3.0 kb, 1.4 kb, and 1.1 kb. Thesc three fragments represent the pGEMT backbone, the unrccombined POTFRT2 fiagmont, and the expected fragment from recombination between the POTLOXP sites, respectively (Figure 9). 30 Recombination between the POTFRT sites was further verified by DNA sequencing. The 1 .1 kb fragment from lane 3 of Figure 9 was gel purified and direct DNA sequenced. The resulting sequence is illustrated below and confirm that recombination is base pair faithful through the remaining POTFRT site. The remaining POTFRT region is shaded. The left T 110 DNA border is illustrated in bold and positioned at 253-276. Restriction sites illustrated in bold represent those remaining from cloning the POTFRT regions into pGFMTPOTINV. TTTCTAGCAAGTCTTGTACGCTTAGATTGAACAGATGTAGGACTCACATCTGATATGGAGGA S TTCTTGACTTGTTTCAGCAGCATCAGATGAAGCTTCTGAGACTTCACCTGAiCCATCA'CTG TAGCAGTTGCTTCTACTTCTTCCACTGCTACATCAGTCTCAGTTGCTGATACTATAAGACCT _CTTAATTTAGGTCGTAAAATGCAA.CCAA CTCT IAAATGzGGGAAACAATTTAATAGATGTTGA CAGAGGCAGGATATATATTTGGGGTAAACGGGAATNN md 4 ,ETTAGATATCGAG-GCTACCCT AT TGAAGAGCTGGCCGAGGGAAGTTCC TT CTTGGAAGTGGCATATCT T TTGTTGTATGGTAAT T TACCATCTGAGPACCAGTTAGCAGA CT GGGAGTTCACAGTTTCACAGCATT CAGCGGTT CCACAAGGACTCTTGGATATCATACAGT CAATGCCCCATGATGCTCATCCAATGGGGGTACTTGTCAGTGCAATGAGTGCTCTTTCCGTT 15 TTT (SEQ ID NO:79) 2) Onion (Alium cepa) FRT-like fragment - ALLFRT 20 A fragment containing afrt-like sequence was designed from two EST sequences from onion (NCBI accessions CF434781 and CF445353). This fragment, named ALLFRT, is illustrated below. Restriction enzyme sites to allow cloning into the onion intragenic binary vector described in Example 8 are shown in bold and the frt-like sequence is illustrated in bold and light grey. 25 (GR#NG'_AOlfin - .~l AGCAAGTA~l-.CAT±.TA.I ..- T GGZ~~~r-ag T1 1 30__ -TCCATA CTC ACilq W !moiW kE M ; (SEQ ID NO:80) Nucleotides 1-450 nucleotides 28-477 of NCBI accession CF434718 10 Nucleotides 451-875 nucleotides 105-529 of NCBI accession CF445383 The designed onionft-like sequence has 7 nucleotide mismatches from the nativefrt sequence as illustrated in bold below. 15 Fr sequence GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC (SEQ ID NO:76) Onionfrt-like sequence 5 6C (SEQ ID NO:81) 20 The 875 bp ALLFRT sequence can be cloned into pALLNV twice, once via flanking VspI sites into TdeI site of pALL1NV and subsequently via Nhel and Xbal site into the XbaI site of pALLINV. The correct orientation and confination of the ALLFRT insert can be verified by restriction enzyme analysis and DNA sequencing. 25 The DNA sequence of the 2896 bp SalI fragment comprising the onion derived T-DNA region in the resulting pALLFRT2 is illustrated below. Only the nucleotides in italics are not part of onion genome sequences. The ALLFRT regions are shaded. The T-DNA borders are shown in bold, with the left border positioned at 520-543 and the right border positioned at 30 2490-2513. Restriction sites illustrated in bold represent those used to clone the ALLFRT regions into the onion T-DNA like sequence. GTCGACTTCCCTTTCCTCTACTCCACTTGTT TCTCGCTTTCTCTACTTCCTTTTTCTCTCTT TTCTTTATATTTATTGCTCAGCTGGC-ATTAATTACTGTCATTTAT TCCTCATATCTATTTTA 112 TTGAATTAAAACGGTTATTTAGCTCGAGGCCTTCTCTCTTATTCTTTGCTTCCAAGGAGAGA GAATATGGCGAGTGGTAGCAATCATCAGCATGGTGGAGGAGGAAC-AAGAAGAGGCGGAATcT TAGTCGCTGCGACCTTGCTTATTCTTCCTGCCATTTTCCCCAATTTGTTTGTTCCTCTTCCC TTTGCTTTTGGTAGTTCTGGCAGCGGTGCATCTCCTTCTCTCTTCTCCGAATGGAATGCTCC 5 TAAACCTAGGCATCTCTCTCTTCTGAAAGCAGCCATTGAGCGTGAGATTTCTGACG AACAAA AATCAGAGCTGTGGTCTCCCTTGCCTCCACAGGGATGGAAACCCTGCCTTGAGACTCAATAT AGTAGCGGGCTACCCAGTAGATCGACAGGATATATTCAAGTGTAAAACAAGATGCTGAATCG ATTAGCAATGGTTCGCTCTT G 15 SME. nr EmsMr-mum .3CTAGACTTGCTTCTCGGATAATCAATCCTCAGTTTTTGATTCCTTCTCGAAGCTTCCTTG ATCTCCATAAGATGGTAAACAAGGAGGCGATAAAAAAAGMAAGGGCTAGACTTGCTGATGAG 20 ATGAGCAGAGGATATTTTGCGGATATGGCAGAGATTCGTiATACATGGTGGCKGATTGCTAT CGCAAATCAAATTCTTATTCCATCAGGGGAACCAATCAAATTTCCTGATTTGACAGTAAAAT TCTCTGATGATAGCAGTTTGCATTTACCAATTGTATCTACACAAAGTGCTACAAATAACAAT GCTAAATCCACTCCTGCTGCCTCATTGTTGTGCCTTTCCTTCAGAGCAAGTTCACAGACAAT CCTTGAATCATGGACTGTTCCTTTTTTGGACACTTTTAACTCTTCAGAAGTACAAGCAM 25 _ 7 ___ '% wp RE Al ON .. 30 Jp IMMNA TACTCTCTGGAGAATAGGAAC TTATCT - TG 113 TATGAGGTATCATTTTTGGATTCTTGGTT TTTCTCATTCGGACCAATCAAGAGAATGTTICTTAACATGACGAAGAMACCCACTGCTACTC AGCGGAAGATTGGTTATTTCATTTGGTGATCACTATGATTTTAGGAAGCAGCTTCAAATTGT 5 AAATCTTTTGAC-AGGATATATATTACTGTAAAAAGTGAAGAGAGA-AATGTGATATATGCTGA TGTTTCCATGGAGA-GGGGTGCATTTCTTGTTCAACAAGCTATGAGGCCTTTCCATGGAAAGA ATATAGAAAGCGCAAAATCPAAGGCTTAGTCTTTGCCAGGAGGATATTCGTGGGCAGTTAGAG ATGACAGATAACAAACCAGACTTATATTCACAGCTTGGTGCTGTCCTTGGAATGCTAGGAGA CTGCTGTCGAGGAATGGGTGATACTAATGGTGCGATTCCATATTATGAAGAGCAGTGTGGAAT 10 TCCTCTTAAAAATGCCTGCAAAAGATCCCGAGGTTGTACATACACTATCAGTTTCCTTGAAT AAAATTGGAGACCTGAAATACTACGAAGGAGATCTGCAGTCGAC (SEQ D NO:82) Restriction enzyme sites available for cloning between ALLFRT sequences include: 15 ApaBi GCANNNNN/TGC Bsil C/TCGTG BspMI ACCTGCNNNN/ DraIII CACNNN/GTG HindIII A/AGCTT 20 AfeJ C/AATTG NheI GICTAGC PflMI CCANNNN/NTGG ScaI AGT/ACT Sph[ GCATG/C 25 Xbal T/CTAGA 3) Frt-like sequences from other species 30 Brassica napus (rape)frt-ike sequence designed from 2 ESTs Frt sequence GAAGTTCCTATACTT TCTAGAGAATAGGAACTTC (SEQ ID NO:76) 114 Rapefri-like sequence ACAGTTCCTATACTTTCTGGAGAATAGGAAGGTG (SEQID NO:83) Nucleotides 1-14 Nucleotides 397-410 of NCBI accession CD824140 5 Nucleotides 15-34 Nucleotides 128-147 of NCBI accession CD825268 The rapefrt-ike sequence has 6 nucleotide mismatches from the nativefit sequence (illustrated above in bold). 10 Glycine max (soybean)frt-like sequence designed from 2 ESTs Fri sequence GAAGTTCCTATACTTTCTAGAC-AATAGGAACTTC (SEQ ID NO:76) Soybeanfrt-like sequence ACAGTTCCTATACI'TTCTCACA ATAG GAACTTC (SEQ ID 15 NO:84) Nucleotides 1-19 Nucleotides 84-102 of NCBI accession BE057270 Nucleotides 20-34 Nucleotides 243-257 of NCBI accession B1970552 20 The soybeanfrt-like sequence has 3 nucleotide mismatches from the nativefrt sequence (illustrated above in bold). Triticum aestivun (wheat)frt-like sequence designed from 2 ESTs 25 Frt sequence GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC (SEQ ID NO:76) Wheatfrt-like sequence AGAGTTCCTATACTTTCTAGAAATAGGAACCCC (SEQ ID NO:85) 30 Nuclcotides 1-18 Nucleotides 446-463 of NCBI accession CD877128 Nucleotides 19-34 Nucleotides 1805-1820 of NCBI accession BT009538 115 The wheatfrt-like sequence has 4 nucleotide mismatches from the nativefrt sequence (illustrated above in bold). Pinus tueda (Joblolly pine)frt-like sequence designed from 2 ESTs 5 Frt sequence GAAGTTCCTATACT TTC TAGAGAATAGGAACTTC (SEQ ID NO:76) Loblolly pinefrt-like sequence AAAGT T CCT ATACTTTCTGGAGAATAGGAAAACA (SEQ ID NO:86) 10 Nucleotides 1-16 Nucleotides 14-29 of NCBI accession AA556441 Nucleotidos 17-34 Nucleotides 764-781 ofNCBI accession AF101785 The loblolly pine frt-like sequence has 6 nucleotide mismatches from the native frt sequence 15 (illustrated above in bold). The above examples illustrate practice of the invention, It will be well understood by those with ordinary skill in the art that such DNA sequences can be assembled together to construct a complete vector composed entirely of plant DNA of the same or related species. It will also 20 be appreciated by those skilled in the art that numerous variations and modifications may be made without departing from the spirit and scope of the invention. 116
Claims (65)
- 2. A plant transformation vector comprising: a) a T-DNA-like sequence including at least one T-DNA border-like sequence, and 10 b) at least 20 bp of additional polynucleotide sequence on one or both sides of the T DNA-like sequence in which all of said sequences are derived from plant species.
- 3. The plant transformation vector of claim 1 or 2 in which the T-DNA-likc sequence 15 includes two T-DNA border-like polynucleotide sequences, one at each end of the T-DNA like sequence, both T-DNA border-like polynucleotide sequences being derived from plant species.
- 4. The plant transformation vector of any preceding claim in which the T-DNA-like sequence 20 father comprises additional base polynacleotide sequence, the additional base polynueleotide sequence being derived from plant species.
- 5. The plant transformation vector of any preceding claim in which T-DNA-like sequence includes first and second recombinase recognition sequences, wherein the recombinase 25 recognition sequences are derived from plant species.
- 6. The plant transformation vector of claim 5 in which the first recombiriase recognition site and the second recombinase recognition sequence are loxP-like sequences derived from a plant species. 30
- 7. The plant transformation vector of claim 5 in which the first recombinase recognition sequence and the second recombinase recognition sequences arefrt-like sequences derived from plant species, 117
- 8. The plant transfonnation vector of any one of claims 5 to 7 which comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences. 5 9. The plant transformation vector of claim 8 in which the selectable marker sequence is derived from plants.
- 10. The plant transformation vector of any preceding claim in which the polynucleotide encompassing the T-DNA border-like sequencess, any base polynucleotide sequence, any 10 recombinase recognition site sequences and any plant polynucleotide sequence additional to the T-DNA-like sequence are constructed from fewer than 10 polynucleotide sequence fragments derived from plant species.
- 11. The plant transformation vector of any preceding claim which further comprises an origin 15 of replication polynucleotide sequence derived from plant-species.
- 12. The plant transformation vector of any preceding claim in which the T-DNA-like sequence comprises a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the T-DNA-like sequence, wherein the selectable 20 marker sequence is derived from plant species.
- 13. The plant transformation vector of any preceding claim which comprises a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harboring the vector, wherein the selectable marker sequence is derived from plant species. 25
- 14. The plant transformation vector of claim 12 in which the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the T-DNA like sequence is also capable of functioning in selection of a bacterium harbouring the vector. 30 15. The plant transformation vector of any preceding claim in which the T-DNA-like sequence fmuther comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plants. 118
- 16. The plant transformation vector of any preceding claim in which the polynucleotide sequence of the entire vector is derived from plant species.
- 17. The plant transformation vector of any preceding claim in which the polynucleotide 5 sequence of the entire vector is derived from plant species which are interfertile.
- 18. The plant transformation vector of any preceding claim in which the polynucleotide sequence of the entire vector is derived from the same plant species. 10 19. A plant transfonnation vector including a T-DNA like sequence, the T-DNA like sequence comprising: a) a polynucleotide sequence of at least about 20 bp in length derived from a plant species, comprising, the nucleotide sequence 5'-GR-3' (wherein R = G or A); and b) a chimeric T-DNA-bcrdcr-like sequence comprising at its 5' end, the nucleotide 15 sequence 5'-GR-3' from a) wherein the chimeric border is capable of functioning as a T-DNA border sequence ini integration of a polynucleotide sequence into the genome of a plant.
- 20. A plant transfonnation vector including a T-DNA like sequence, the T-DNA like 20 sequence comprising: a) a polynucleotide sequence of at least about 20 bp in length derived from a plant species, comprising, the nucleotide sequence 5' -GRC-3' (wherein R - G or A); and b) a chimeric T-DNA-border-like sequence comprising at its 5' end, the nucleotide sequence 5'-GRC-3' from a) 25 wherein the chimeric border is capable of functioning as a T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant.
- 21. A plant transformation vector including a T-DNA like sequence, the T-DNA like sequence cormpnsag: 30 a) a polynucleotide sequence of at least about 20 bp in length derived frorn a plant species, comprising, the nucleotide sequence 5'-GRCA-3' (wherein R = G or A); and b) a chimeric T-DNA-border-lUke sequence comprising at its 5' end, the nucleotide sequence 5-GRCA-3 from a) 119 wherein the chimeric border is capable of functioning as a T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant.
- 22. The plant transformation vector of any one of claims 19 to 21 in which T-DNA-like 5 sequence includes, 5' to the chimeric T-DNA border-like sequence, first and second reconbinase recognition sequences, wherein tc recombinase recognition sequences are derived fioni plant species.
- 23. The plant transformation vector of claim 22 in which the first recombinase recognition 10 site and the second recombinase recognition sequence are loxP-like sequences derived from a plant species.
- 24. The plant transformation vector of claim 22 in which the first recombinase recognition sequence and the second recombinase recognition sequences arefrt-like sequences derived 15 from plant species.
- 25. The plant transformation vector of any one of claims 22 to 24 which comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences. 20
- 26. The plant transformation vector of claim 25 in which the selectable marker sequence is derived from plants.
- 27. The plant transformation vector of any one of claims 19 to 26 in which the polynucleotide 25 of at least 20 bp in length and any recombinase recognition site sequences are constructed from fewer than 10 fragments of a polynuclcotide sequence derived from plant species.
- 28. The plant transformation vector of any one of claims 19 to 27 which further comprises an origin of replication polynucleotide sequence derived from plant species. 30
- 29. The plant transformation vector of any one of claims 19 to 28 in which the T-DNA-like sequence includes, 5' to the chimeric T-DNA border-like sequence, a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring 120 the T-DNA-like sequence, wherein the selectable marker sequence is derived from plant species,
- 30. The plant transformation vector of any one of claims 19 to 29 which comprises a 5 selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the delectable marker sequence is derived from a plant.
- 31. The plant transformation vector of claim 27 in which the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the T-DNA 10 like sequence is also capable of functioning in selection of a bacterium harbouring the vector.
- 32. The plant transformation vector of any one of claims 19 to 31 in which the T-DNA-like sequence further comprises a genetic construct as herein defined, wherein all polynucleotide sequences ofthe genetic construct are derived fi-om plant species. 15
- 33. The plant transformation vector of any one of claims 19 to 32 in which all of the polynucleotide sequence of the vector, except for the chimeric T-DNA border-like sequence, is derived from plant species. 20 34. The plant transformation vector of any one of claims 19 to 32 in which all of the polynucleotide sequence of the vector, except for the chimeric T-DNA border-like sequence, is derived from plant species which are interfertile.
- 35. The plant transformation vector of any one of claims 19 to 32 in which all of the 25 polynucleotide sequence of the vector, except for the chimeric T-DNA border-like sequence, is derived from the same plant species.
- 36. A plant transformation vector including a chimeric sequence, the chimeric sequence comprising: 30 a) at the 5' end a plant-derived sequence of at least 20 nucleotides including the nucleotide sequence 5'-GR-3' (wherein R = G3 or A); and b) at the 3' end a border sequence capable of performing the function of a T-DNA border sequence in integration of a polynueeotide sequence into the genome of a plant, 121 wherein the nucleotide sequence 5'-GR-3' from a) forms the 5' end of the border sequence.
- 37. A plant transformation vector including a chimeric sequence, the chimeric sequence comprising: 5 a) at the 5' end a plant-derived sequence of at least 20 nucleotides including the nucleotide sequence 5'-GRC-3' (wherein R = G or A) and b) at the 3' end a border sequence capable of perfonning the fumction of a T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant, 10 wherein the nucleotide sequence 5 -GRC-3' from a) forms the 5' end of the border sequence.
- 38. A plant transformation vector including a chimeric sequence, the chimeric sequence comprising: a) at the 5' end a plant-derived sequence of at least 20 nucleotides including the 15 nucleotide sequence 5'-GRCA-3' (wherein R= G or A); and b) at the 3 end a border sequence capable performing the function of a T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant, wherein the nucleotide sequence 5-GRCA-3' from a) forms the 5' end of the border sequence. 20
- 39. The plant transformation vector of any one of claims 36 to 38 which includes, 5' to the border, first and second recombinase recognition sequences derived from plant species.
- 40. The plant transformation vector of claim 39 in which the first recorabinase recognition 25 site and the second recombinase recognition sequence are loxP-like sequences derived from a plant species.
- 41. The plant transformation vector of claim 39 in which the first recombinase recognition sequence and the second recombinase recognition sequences arefrt-like sequences derived 30 from plant species.
- 42. The plant transformation vector of any one of claims 39 to 41 which comprises a selectable marker sequence flanked by the first and second recorbinase recognition sequences. 122
- 43. The plant transformation vector of claim 42 in which the selectable marker sequence is derived from plants. 5 44. The plant transformation vector of any one of claims 36 to 43 in which the polynucleotide of at least 20 bp in length and any recombinase recognition site sequences are constructed from fewer than 1O.fragments of a polynucleotide sequence derived from plant species,
- 45. The plant transformation vector of any one of claims 36 to 43 which further comprises an 10 origin of replication polynucleotide sequence derived from plant species.
- 46. The plant transfonnation vector of any one of claims 33 to 45 which includes, 5' to the border sequence, a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the selectable marker polynucleotide sequence, 15 wherein the selectable marker sequence is derived from plant species.
- 47. The plant transformation vector of any one of claims 33 to 46 which comprises a delectable marker polyhucleotide sequence capable of functioning In selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived from a plant. 20
- 48. The plant transformation vector of claim 46 in which the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the selectable marker polynucleotide sequence is also capable of functioning in selection of a bacterium harbouring the vector. 25
- 49. The plant transformation vector of any one of claims 36 to 48 in which further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plant species. 30 50. The plan transfornmation vector of any one of claims 36 to 49 in which all of the polynucleotide sequence of the vector, except for the border sequence, is derived from plant species, 123
- 51. The plant transformation vector of any one of claims 36 to 49 in which all of the polynuclectide sequence of the vector, except for the border sequence, is derived from plant species which are interfertile. 5 52. The plant transformation vector of any one of claims 36 to 49 in which all of the polynuclcotide sequence of the vector, except for the border sequence, is derived from the same plant species.
- 53. A plant transformation vector comprising a selectable marker polynucleotide sequence 10 capable of functioning in selection of a plant cell or plant hatbouring the selectable marker polynucleotide, wherein the selectable marker sequence is derived from plant species.
- 54. A plant transformation vector comprising first and second recombinase recognition sequences, wherein the recombinase recognition sequences are derived from plant species. 15
- 55. The plant transformation vector of clain 54 in which the first recoibinase recognition sequence and the second recombinase recognition sequence are loxP-like sequences derived from a plant species. 20 56. The plant transformation vector of claim 54 in which the first recombinase recognition sequence and the second recombinase recognition sequences arefrt-like sequences derived from plant species.
- 57. The plant transformation vector of any one of claims 54 to 56 which comprises a 25 sclectable marker sequence flanked by the first and second recombinase recognition sequences.
- 58. The plant transformation vector of claim 57 if which the selectable marker sequence is derived from plants. 30
- 59. The plant transformation vector of any one of claims 53 to 58 which further comprises an origin of replication-like polynucleotide sequence derived from plant species. 124
- 60. The plant transformation vector of any one of claims 53 to 59 which further comprises a delectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived from plant species. 5 61, The plant transformation vector of claim 60 in wbich the selectable marker polynucleotide sequence capable of functioning in selection of a bacterium barbouring the vector is also capable of functioning in selection of a plant cell or plant harboring the selectable marker polynucleotide. 10 62. A plant transformation vector comprising: a) an origin of replication polynucleotide sequence, and b) a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector in which all of said sequences are derived from plant species. 15
- 63. The plant transformation vector of any one of claims 53 to 62 which further comprises additional base polynucleotide sequence, the additional base polynucleotide sequence being derived from plant species, 20 64. The plant transformation vector of any one of claims 53 to 63 constructed from fewer than 10 polynucleotide sequence fragments derived from plant species.
- 65. The plant transformation vector of any one of claims 53 to 64 which further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic 25 construct are derived from plants.
- 66. The plant transformation vector of any one of claims 53 to 65 in which all of the polynucleotide sequence of the entire vector is derived from plant species. 30 67. The plant transformation vector of any one of claims 53 to 65 in which all of the polynucleotide sequence of the entire vector is derived from plant species which are interfertile. 125
- 68. The plant transformation vector of any one of claims 53 to 65 in which all of the polynucleotide sequence of the entire vector is derived from the same plant species,
- 69. A method of producing a transformed plant ecIt or plant, the method comprising the step 5 of transformation of the plant cell or plant using the vector of any one of claims I to 68.
- 70. A method of producing a transformed plant cell or plart in which any polynucleotide stably integrated into the plant cell or plant is derived from a plant, the method comprising transformation of the plant with the vector of any one of claims 1 to 68. 10
- 71. A method of producing a transformed plant cell or plant in which any polynucleotide stably integrated into the plant cell or plant is derived from a plant interfertile with the plant-or plant cell to be transformed, the method comprising transformation of the plant with the vector of any one of claims l to 68. 15
- 72. A method of producing a transformed plant cell or plant in which any polynucleotide stably integrated into the plant cell or plant is derived from a plant of the same species as the plant or plant cell to be transformed, the method comprising transformation of the plant with the vector of any one of claims 1 to 68. 20
- 73. A method of modifying a trait in a plant cell or plant comprising: (a) transforming of a plant cell or plant with a vector of any one of claims 1 to 68, the vector comprising a genetic construct capable of altering expression of a gene which influences the trait; and 25 (b) obtaining a stably transfonued plant cell or plant modified for the trait,
- 74. The method of any one of claims 69 to 73 in which transfornation is vir gene-mediated
- 75. The method of any one of claims 69 to 73 in which transformation is Agrcbacteriun 30 mediated.
- 76. The method of any one of claims 69 to 73 in which transformation involves direct DNA uptake. 126
- 77. A plant cell or plant produced by a method of any one of claims 69 to 76.
- 78. A plant tissue, organ, propagule or progeny of the plant cell or plant of claim 77. 127
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2010257316A AU2010257316B2 (en) | 2004-06-08 | 2010-12-21 | Transformation Vectors |
Applications Claiming Priority (11)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
NZ533371A NZ533371A (en) | 2004-06-08 | 2004-06-08 | Vectors for plant transformation contaning mostly or exclusively genetic material from plants useful with Agrobacterium transformation system |
NZ533372 | 2004-06-08 | ||
NZ53337204 | 2004-06-08 | ||
NZ533371 | 2004-06-08 | ||
NZ53833005 | 2005-02-18 | ||
NZ538331 | 2005-02-18 | ||
NZ538330 | 2005-02-18 | ||
NZ53833105 | 2005-02-18 | ||
PCT/NZ2005/000117 WO2005121346A1 (en) | 2004-06-08 | 2005-06-08 | Transformation vectors |
AU2005252598A AU2005252598B8 (en) | 2004-06-08 | 2005-06-08 | Transformation vectors |
AU2010257316A AU2010257316B2 (en) | 2004-06-08 | 2010-12-21 | Transformation Vectors |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2005252598A Division AU2005252598B8 (en) | 2004-06-08 | 2005-06-08 | Transformation vectors |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2010257316A1 true AU2010257316A1 (en) | 2011-01-27 |
AU2010257316B2 AU2010257316B2 (en) | 2013-03-21 |
Family
ID=35503070
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2005252598A Ceased AU2005252598B8 (en) | 2004-06-08 | 2005-06-08 | Transformation vectors |
AU2010257316A Ceased AU2010257316B2 (en) | 2004-06-08 | 2010-12-21 | Transformation Vectors |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2005252598A Ceased AU2005252598B8 (en) | 2004-06-08 | 2005-06-08 | Transformation vectors |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1766029A4 (en) |
AU (2) | AU2005252598B8 (en) |
WO (1) | WO2005121346A1 (en) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8137961B2 (en) | 2004-09-08 | 2012-03-20 | J.R. Simplot Company | Plant-specific genetic elements and transfer cassettes for plant transformation |
US7601536B2 (en) | 2004-09-08 | 2009-10-13 | J. R. Simplot Company | Plant-specific genetic elements and transfer cassettes for plant transformation |
US20070250948A1 (en) * | 2006-03-07 | 2007-10-25 | J.R. Simplot Company | Plant-specific genetic-elements and transfer cassettes for plant transformation |
JP5684473B2 (en) | 2006-07-19 | 2015-03-11 | モンサント テクノロジー エルエルシー | Use of multiple transformation enhancer sequences to improve plant transformation efficiency |
AU2010211450B2 (en) * | 2009-01-15 | 2015-05-14 | The New Zealand Institute For Plant And Food Research Limited | Plant transformation using DNA minicircles |
AU2018253628B2 (en) * | 2016-04-27 | 2019-07-25 | Nexgen Plants Pty Ltd | Construct and vector for intragenic plant transformation |
BR112018072154A2 (en) * | 2016-04-27 | 2019-03-19 | Nexgen Plants Pty Ltd | recombinant genetic constructs, methods for producing a recombinant genetic construct and for genetically enhancing a plant, vector, host cell and plants |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1261725A2 (en) * | 2000-02-08 | 2002-12-04 | Sakata Seed Corporation | Methods and constructs for agrobacterium-mediated plant transformation |
AU7752001A (en) * | 2000-06-28 | 2002-01-08 | Sungene Gmbh And Co Kgaa | Binary vectors for improved transformation of plant systems |
WO2002081711A1 (en) * | 2001-04-06 | 2002-10-17 | Cropdesign N.V. | The use of double and opposite recombination sites for the single step cloning of two dna segments |
US7534934B2 (en) * | 2002-02-20 | 2009-05-19 | J.R. Simplot Company | Precise breeding |
WO2003069980A2 (en) * | 2002-02-20 | 2003-08-28 | J.R. Simplot Company | Precise breeding |
-
2005
- 2005-06-08 EP EP05757541A patent/EP1766029A4/en not_active Ceased
- 2005-06-08 WO PCT/NZ2005/000117 patent/WO2005121346A1/en active Application Filing
- 2005-06-08 AU AU2005252598A patent/AU2005252598B8/en not_active Ceased
-
2010
- 2010-12-21 AU AU2010257316A patent/AU2010257316B2/en not_active Ceased
Also Published As
Publication number | Publication date |
---|---|
EP1766029A1 (en) | 2007-03-28 |
WO2005121346A1 (en) | 2005-12-22 |
AU2005252598B2 (en) | 2010-10-28 |
AU2010257316B2 (en) | 2013-03-21 |
AU2005252598B8 (en) | 2011-05-12 |
AU2005252598A1 (en) | 2005-12-22 |
EP1766029A4 (en) | 2008-07-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6530887B2 (en) | Agrobacterium strain modified to increase plant transformation rate | |
AU2010257316B2 (en) | Transformation Vectors | |
WO2001006844A1 (en) | Method for superrapid transformation of monocotyledon | |
WO1995006722A1 (en) | Method of transforming monocotyledon by using scutellum of immature embryo | |
OA10607A (en) | Vector and methods for introducing at least two genes into a plant | |
CN111630174A (en) | Regeneration of genetically modified plants | |
CN116249780A (en) | Rapid transformation of monocot leaf explants | |
AU2010211450B2 (en) | Plant transformation using DNA minicircles | |
WO2019103034A1 (en) | Genome-edited plant production method | |
US20210348177A1 (en) | Generation of heritably gene-edited plants without tissue culture | |
CN112080513A (en) | Rice artificial genome editing system with expanded editing range and application thereof | |
US20050048652A1 (en) | Retroelement vector system for amplification and delivery of nucleotide sequences in plants | |
KR101040579B1 (en) | Plant transformation vector and marker free transgenic plants using stress inducible site-specific recombination | |
JP4543161B2 (en) | Gene disruption method using retrotransposon of tobacco | |
JP4595631B2 (en) | Method for producing transgenic cell, tissue or plant in which influence of selection marker gene is excluded | |
JP3605633B2 (en) | Novel plant gene, plant modification method using the gene, and plant obtained by the method | |
NZ553676A (en) | Vectors for transformation | |
US20100257632A1 (en) | Methods for generating marker-free transgenic plants | |
NZ579038A (en) | Vectors for transformation | |
JP5114161B2 (en) | Novel site-specific recombinase recognition sequences and vectors | |
JP2011505806A (en) | How to make a marker-free transgenic plant | |
WO2022055751A1 (en) | Plastid transformation by complementation of nuclear mutations | |
JP2013085484A (en) | Method for producing transgenic maize, expression vector usable in the production method and transgenic maize | |
NZ574191A (en) | Plant transformation using DNA minicircles | |
JP2005006599A (en) | cis-ACTING ELEMENT CONFERRING IRON-DEFICIENT INDUCIBLE AND/OR ROOT-SPECIFIC EXPRESSION TO PLANT |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
TH | Corrigenda |
Free format text: IN VOL 25, NO 2, PAGE(S) 123 UNDER THE HEADING COMPLETE APPLICATIONS FILED - NAME INDEX UNDER THE NAME THE NEW ZEALAND INSTITUTE OF PLANT AND FOOD RESEARCH LIMITED, APPLICATION NO. 2010257316, UNDER INID (71) CORRECT THE APPLICANT NAME TO READ THE NEW ZEALAND INSTITUTE FOR PLANT AND FOOD RESEARCH LIMITED |
|
FGA | Letters patent sealed or granted (standard patent) | ||
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |