JP2011505806A - How to make a marker-free transgenic plant - Google Patents

Abstract

The present invention relates to the field of plant transformation using Agrobacterium. An extremely high co-transformation method is provided.

Description

The present invention relates to the field of plant transformation, transgenic plant cells and methods for making plants, and methods for making marker free transgenic plants. Methods are provided for efficiently co-transforming plant cells using strains of Agrobacterium tumefaciens or Agrobacterium rhizogenes. Agrobacterium strains suitable for use in the method are also provided.

[Background technology]
Since the 1980s, not only resistance to pests, herbicides or harsh environmental conditions (so-called “input traits” beneficial to farmers during crop production), but also improved nutritional or health value ( For example, Golden Rice, low linolenic soy, etc.) (so-called “output traits” beneficial to the consumer and processing industries) "Genetic" plants have been developed. Although there has been controversy over safety, it is expected that new transgenic plants have been developed and that new valued traits will be on the market in the future.

  Using selectable marker genes is essential for the creation of genetically modified plants to select plant cells into which exogenous DNA has been introduced, but can be selected after the GM plant has been regenerated. Marker genes (generally antibiotic resistance genes or herbicide resistance genes) become obsolete. The continuous presence of selectable marker genes in GM plants is undesirable for several reasons. Guidelines (EU Directive 2001) stating that selectable marker genes for antibiotic resistance should preferably not exist for approval of GMOs as a result of public debate on the safety of genetically modified organisms (GMOs) / 18 EC) was formulated. Also, the expectation of a new genetic transformation with an additional desired gene (GOI) of an existing GMO is that there is no selectable marker gene [or an alternative that leads to gene stacking. Use of the marker gene], which allows a new round in selection with the same selectable marker in a new transformation cycle.

  The most direct approach to eliminate selectable markers is to use two separate T-DNAs (usually two Agrobacterium) to select the selectable marker used to select transformed plant cells and the desired gene (GOI). To a method called co-transformation, which is placed in a strain of Two T-DNAs are introduced into plant cells simultaneously, but integrate independently at different loci in the plant's nuclear genome. Upon crossing, both genes are subsequently segregated in the next generation and GM plants with GOI only can be selected. However, in this process, many plants only obtain selectable marker genes. This is because the desired gene is not selected during plant transformation and regeneration. The challenge in co-transformation is to obtain a high percentage of transformed plant cells that contain both genes (ie, the same plant cells that are co-transformed with both genes). With existing co-transformation methods, the percentage of plant cells containing both genes (ie, co-transformation efficiency) is low. This is because many cells receive only T-DNA having a marker gene and not T-DNA having GOI. Efficiency is 50% or less. See also Figure 4A.

  More detailed information on co-transformation can be found in the literature (De Block et al. (1991) Theoretical Applied Genetics 82: 257-263), Depicker et al. (1985) Molecular General Genetics 201: 477-484; Matthews et al. (2001) Mol. Breeding 7: 195-202; Daley et al (1998) PlantCell Rep. 17: 489-496; McKnight et al (1987) Plant Molecular Biol. 8: 439-445; and De Framond et al (1986 See also Mol. Gen. Genet. 202: 125-131].

  Several improvements in the co-transformation efficiency of Agrobacterium-mediated transformation are described. For example, Japan Tobacco has developed a unique approach to apply the principle of co-transformation using superbinary vectors, resulting in 47% co-transformed plants in tobacco and rice ( Komari et al., 1996, Plant J. 10-165-174; US 5,731,179). Researchers from Gent University (De Buck et al., 1998, Mol. Plant. Microbe Interact 11: 449-457) reported up to 50% co-transformation in Arabidopsis but frequently both at the same locus. Co-integration of T-DNAs was also found. In all these cases, co-transformation was performed by simultaneously applying two functional Agrobacterium strains (ie, when used alone, each strain converts T-DNA into plant cells. Transfer and facilitates transfer and integration of the nucleus into the plant genome). However, the overall efficiency is low or unpredictable, making it cumbersome and expensive. Therefore, other transformation methods are generally used in the art (eg, a selectable marker and GOI are physically linked to T-DNA and transferred to a plant cell on one fragment of T-DNA. Traditional method). Thus, all transformed cells that are selected to have a marker gene also contain GOI, but removal of the marker gene becomes more difficult. The marker gene is then removed (post-transformation) from the plant genome by subsequent excision using site-specific recombination (eg using the Cre-lox or FLP-frt system). Another alternative is, for example, the use of transposable elements or transformations that have no selection marker (EP1279737). See also De Vetten et al. [De Vetten et al. (2003) Nature Biotechnol. 21: 439-442].

  Thus, there is a need for a co-transformation method with high co-transformation efficiency (ideally close to 100%). Such an extremely high efficiency co-transformation method is provided in this application (as a suitable strain for use in the method).

  The Agrobacterium strain contains a Ti-plasmid containing an opine synthesis and opine catabolism region, a virulence region containing a gene encoding a Vir protein, and a T-DNA region. During Agrobacterium-mediated plant transformation, chemicals (eg, phenolic compounds and sugars) released from the wound are recognized by Agrobacterium's VirA transmembrane protein. VirA protein then phosphorylates VirG protein and activates transcription of other virulence genes in the vir region.

  VirD1 and VirD2 proteins cleave the border and VirD2 remains covalently bound to the light border (RB). VirB and VirD4 proteins form pili to transport the T-DNA / VirD2 complex to plant cells. The VirE1 protein binds to the VirE2 protein and is transported together with the T-complex to the cytoplasm of the plant where the VirE1 protein releases the VirE2 protein. The VirE2 protein then coats the single stranded (ss) T-DNA to protect the T-DNA from nucleases. The complete T-complex is transported to the nucleus, where VirE2 forms a channel in the nuclear membrane and adapts to the import of the T-complex into the nucleus. In the nucleus, VirD2 is involved in T-DNA integration in the plant genome. The above process is illustrated in FIG. 3 [Zhu et al, 2000, Journal of Bacteriology 182 (14): 3885-3895].

The definitions “Transformation” and “transformed” transfer DNA (generally the DNA containing the desired gene (GOI) of the chimera) to the nuclear genome of the plant cell, By “transgenic” is meant to create a plant cell and a plant containing the transgene. The creation of so-called “cis-genic” plants by so-called “cis-genesis” in which only the DNA sequence from the host plant itself is introduced should also be understood as “transformation”. . The introduced DNA is generally (although not necessarily) integrated into the host plant genome. Situations where DNA integration does not occur are, for example, the use of inverted repeat constructs that produce double-stranded RNA for gene silencing, or are temporarily administered to plant cells and become permanent (permanent The use of a DNA sequence encoding a zinc finger nuclease or other DNA modifying enzyme that produces a positive effect.

  “Transfection” and “transfect” are used to refer to T-DNA transfer into plant cells (a step preceding the transfer from the plant cytoplasm to the nucleus).

  In the description of the present application and the like, “co-transformation” means that two plant cells simultaneously contain two isolated T-DNAs containing GOI and the other containing selectable marker genes. Reference is made to transforming (simultaneous). According to the invention, the two T-DNAs are present in two separate Agrobacterium strains.

  “Co-transformation efficiency” refers to plants that contain both two T-DNAs that have been selected to regenerate, transform, and integrate into the nuclear genome using a marker gene. Refer to the percentage (%) of the (converter).

  “(Selectable) marker-free plant” or “marker-free transgenic plant” includes a nuclear genome in which the GOI of a cell is integrated in the present specification and the like, Reference is made to transgenic plants lacking a plant selectable (or scholable) marker gene that is sequestered in the offspring of the transformant. “Offspring” or “descendents” or “progeny” may be primary generations carrying chimeric genes (ie, GOI) or further generations obtained by inbreeding or mating.

  "T-DNA" (or "Transfer-DNA") or "Artificial or chimeric T-DNA" includes right border (RB) and left border (LB) sequences at either end. Means single or double stranded DNA (or at least the RB sequence in the case of artificial T-DNA used to transfer GOI). The “natural” endogenous T-DNA region found in the Agrobacterium Ti-plasmid is also referred to as T-DNA, but it contains genes for tumor induction between the right and left borders. Including. For plant transformation, "disarmed" Agrobacterium strains in which these tumor-inducing genes (tms and tmr regions) have been deleted, replaced, and rendered non-functional are used. The T-DNA that is then transferred to the plant cell is generally integrated into a plasmid or other vector, for example, into a binary vector that is not integrated into the Ti-plasmid, or into a (safe) Ti-plasmid by homologous recombination Into a strain that has been made safe in a co-integrate vector.

Agrobacterium strains and Ti-plasmids can be classified into different types based on the Opin gene of the Ti-plasmid. The Ti-plasmid may comprise an opine synthesis gene (in the T-DNA region) and / or an opine catabolism gene (in the Ti-plasmid backbone), for example the synthesis of octopine, nopaline or succinamopine and / or a catabolism gene. Thus, there are different “opine type” Ti-plasmids.

  The “virE2 helper plasmid” of the present invention can be introduced into Agrobacterium and contains at least one virE2 gene and / or at least one complete virE operon of Agrobacterium Ti-plasmid and is functional. Refer to the plasmid that produces the virE2 protein.

  “Gene of interest” refers to a chimeric gene that is integrated into the nuclear genome of a plant cell. The GOI may encode the desired protein or gene silencing construct.

  A “virE2 donor strain” refers to an Agrobacterium that is capable of producing a functional virE2 protein and into which a T-DNA containing GOI is or can be introduced.

  “VirE2 mutant strain” refers to an Agrobacterium into which T-DNA containing a selectable marker gene that is not capable of producing a functional virE2 protein is or can be introduced . The strain itself is non-pathogenic (cannot produce transformed plant cells) when used alone, but transformed plant cells when used with (pathogenic) virE2 donor strains Have the ability to make The endogenous virE2 gene in the Ti-plasmid is so modified and does not produce a functional virE2 protein.

  “Plasmids” and “vectors” are origins of replication (ori), one or more that are functional in the genus Agrobacterium and / or other bacteria used for DNA manipulation and replication (eg, E. coli) Are used interchangeably in this application to refer to DNA molecules that may contain specific functions, such as a desired gene, a marker gene for selection in bacterial or plant hosts. Commonly known plasmids for plant transformation include binary plasmids (including T-DNA not integrated into Ti-plasmids but transferred to plants), super-binary vectors, helper plasmids, Ti plasmids, Ti helper plasmids, etc. It is.

  “Ti plasmid” refers to A. tumefaciens or A. rhizogenes (in the latter they are referred to as Ri plasmids, but we simply use the Ti plasmid in this application etc. to identify both types of plasmids. A natural Ti plasmid found in or derived from Agrobacterium species (see below) and not tumorigenic (devoid of a functional tumor-inducing gene in T-DNA), but a Ti plasmid Refer to Ti plasmids commonly used for plant transformation, such as “safe” Ti plasmids containing the vir region. For a general review, see Hooykaas and Beijersbergen (Ann Rev Phytopathol 1994, 32: 157-179 or WO00 / 18939). As described above, the natural Ti plasmid is a large circular DNA molecule found in Agrobacterium strains, and the virulence (vir) region and T-DNA region [T-DNA region touches the RB and LB sequences. (Flanked), a tumor-inducing region having genes that lead to auxin and cytokinin production and tumor formation, including an opine synthesis region next to the tumor-inducing region), and further, an opine catabolism region, a replication origin, and a junctional metastasis region (Conjugative transfer region).

An Agrobacterium strain that has been cured with respect to its endogenous Ti-plasmid is a strain in which its Ti-plasmid has been removed and a different Ti-plasmid can be introduced.

  The “LB” or “left border” and “RB” or “right border” or “T-DNA border” sequences are short nucleotide sequences of approximately 25 bp adjacent to the T-DNA region of the Ti-plasmid. Defines the end points of DNA transferred from bacteria to plant cells. Border sequences are described in Gielen et al. [Gielen et al. (1984, EMBO J 3,835-845)]. RB and LB sequences can be attached to artificial T-DNAs containing marker genes or GOIs, for example, plasmids can be operably linked to RB-genes (e.g., marker genes or GOI) -LB (optional ) And can be inserted into plasmids and Agrobacterium for plant cell or plant transformation.

  The term “nucleic acid sequence” (or nucleic acid molecule) refers to a DNA or RNA molecule in single or double stranded form.

An “isolated nucleic acid sequence” refers to an isolated nucleic acid sequence that is no longer in its natural environment, such as a nucleic acid sequence in a bacterial host cell or plant nuclear genome.

“Protein” or “polypeptide” are used interchangeably and refer to a molecule consisting of a chain of amino acids, regardless of the particular mode of action, size, 3-dimensional structure or origin. Thus, a “fragment” or “portion” of a protein can still be referred to as a “protein”. An “isolated protein” is used to refer to a protein that is no longer in its natural environment, such as present in an in vitro or recombinant bacterial or plant host cell.

  A “gene” includes a region (transcribed region) that is operably linked to an appropriate transcriptional regulatory region (eg, promoter) and transcribed into an RNA molecule (eg, mRNA) in a cell. Means the DNA sequence that appears. Thus, the gene contains a promoter, a 5 'untranslated leader sequence that includes sequences involved in translation initiation, etc. (also referred to as a 5' UTR corresponding to the transcribed mRNA sequence upstream of the translation initiation codon), (protein ) 3 'untranslated sequences (also referred to as 3' untranslated regions, or 3 'UTRs) including translation regions (cDNA or genomic DNA) and transcription termination sites and polyadenylation sites (e.g., AAUAAA or variants thereof) A number of operably linked sequences such as

  A “chimeric gene” (recombinant gene) is any gene that is not naturally found in a species and is not naturally associated with each other in a particular gene in which one or more partial nucleic acid sequences are present Refer to For example, a promoter is not associated with part or all of a naturally transcribed region or with another regulatory region. The term “chimeric gene” refers to a sense sequence (eg, coding sequence) or antisense (reverse complement of the sense strand) or inverted repeat (sense sense) in which the promoter or transcriptional regulatory sequence is one or more. And antisense, which RNA transcripts are understood to include expression constructs operably linked to (on transcription, form double-stranded RNA).

  “Cis-genesis” and “cis-gene” are genes composed of genetic elements of transformed or closely related (sexually compatible) plant species. Reference is made to the production of transgenic plants or plant cells having. The cis-gene contains its introns and contacts the native promoter and terminator in the usual sense orientation. Cis-genic plants can harbor one or more ci-s genes, but they do not contain chimeric genes. In addition to using a chimeric gene or in addition to using a chimeric gene, the cis-gene can also be used throughout the specification of the present application, and this aspect is encompassed by the entire specification of the present application. it is obvious.

  “In trans” refers to the presence in a separate DNA molecule, and “in cis” refers to the presence in the same DNA molecule. For example, the Agrobacterium vir gene can be present in trans in an Agrobacterium strain in relation to the T-DNA being transferred, while the T-DNA border sequence is cis in relation to the desired gene being touched.

  “3 ′ UTR” or “3 ′ untranslated sequence” (often referred to as the 3 ′ untranslated region, or 3 ′ end) is the transcription termination point and (almost all but not all eukaryotic mRNAs). ) Refers to a nucleic acid sequence found downstream of the coding sequence of the gene, including polyadenylation signals [eg, AUAAAA or its variants] and the like. After transcription termination, the mRNA transcript can be cleaved downstream of the polyadenylation signal. A poly (A) tail may also be added, which is involved in the transport of mRNA into the cytoplasm (where translation occurs).

  “Gene expression” means that a DNA region operably linked to appropriate regulatory regions (especially a promoter) is biologically active [ie, biologically active protein or peptide (or active peptide fragment). ) Refers to a process that is transcribed into RNA that is capable of being translated or is itself active (eg, post-transcriptional gene silencing or RNAi). An active protein in a particular embodiment refers to a protein that has a dominant negative function due to the repressor domain present. The coding sequence is preferably in the sense orientation and encodes the desired, biologically active protein or peptide, or active peptide fragment (ie, a protein or peptide encoded by GOI). In a gene silencing approach, the DNA sequence is preferably antisense or short of the target gene in sense and antisense orientation (sense and antisense RNA can hybridize to each other to form dsRNA or stem-loop structures). It exists in the form of antisense DNA containing the sequence or inverted repeat DNA. “Ectopic expression” refers to expression in tissues where the gene is not normally expressed.

  A “transcription regulatory sequence” is defined in the present specification and the like as a nucleic acid sequence capable of controlling the rate of transcription of a nucleic acid sequence operably linked to a transcription regulatory sequence. Accordingly, the transcription control sequence defined in the present specification and the like includes all sequence elements (promoter elements) necessary for the initiation of transcription to maintain and control transcription, for example, attenuators or Enhancers and silencers are also included. Usually, reference is made to transcriptional regulatory sequences (5 ') upstream of the coding sequence, although regulatory sequences found (3') downstream of the coding sequence are also included in this definition.

  The term `` promoter '' in the present specification and the like means a nucleic acid fragment, which functions to control transcription of one or more genes and is (5 ′ to the direction of transcription of the transcription start site of the gene. ) Located upstream (transcription initiation is referred to as position +1 of the sequence, nucleotides upstream relative to it are referenced using negative numbers), binding site for DNA-dependent RNA polymerase, transcription initiation site And the presence of any other DNA domain (cis-acting sequence) structurally identified, transcription factor binding sites, repressor and activator protein binding sites, and amounts of transcription from promoters known to those skilled in the art. This includes, but is not limited to, any other sequence of nucleotides that act directly or indirectly to control. Examples of cis-acting sequences upstream of the eukaryotic transcription start (+1) include the TATA box (typically about -20 to -30 positions of the transcription start site), CAAT box (generally at the transcription start site). About -75 position), 5 'enhancer or silencer factor etc. are included. A “constitutive” promoter is a promoter that is active in most tissues (or organs) under most physiological and developmental conditions. More preferably, the constitutive promoter is active under essentially all physiological and developmental conditions in all major organs (eg at least leaves, stems, roots, seeds, fruits and flowers). is there. Most preferably, the promoter is active under most (preferably all) physiological and developmental conditions in all organs.

An “inducible” promoter is a promoter that is physiologically (eg, by external application of a particular compound) or developmentally regulated. A “tissue specific” promoter is only active in certain types of tissues or cells.

  As used herein, etc., the term “operably linked” refers to the association of polynucleotide factors in a functional relationship. A nucleic acid is “operably linked” when it is operably linked to another nucleic acid sequence. For example, a promoter or transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked produces a “chimeric protein” when the linked DNA sequences are typically in close proximity and need to link two proteins encoding regions. This means that they are close and within the reading frame. A “chimeric protein” or “hybrid protein” is not naturally found as such, but is linked to form a functional protein and functions of linked domains (eg, DNA It is a protein composed of various protein “domains” that exhibit a binding domain or a suppression of a functional domain that leads to a dominant negative function. The chimeric protein may also be a fusion protein of two or more proteins that occur in nature. As used herein, the term “domain” refers to a portion of a protein having a specific structure or function that can be transferred to another protein to provide a new hybrid protein having at least the functional characteristics of the domain. Or domain.

  The term “target peptide” refers to an amino acid sequence that targets protein to intracellular organelles (eg, plastids, preferably chloroplasts, mitochondria), or extracellular space (secretory signal peptide). Refer to The nucleic acid sequence encoding the target peptide may be fused (in frame) to the nucleic acid sequence encoding the amino terminal end (N-terminal end) of the protein.

  “Nucleic acid construct” or “vector” or “plasmid” refers to an artificial (usually circular), such as used herein to deliver exogenous DNA to a host cell, resulting from the use of recombinant DNA technology. It is understood to mean a nucleic acid molecule.

Vector backbones are known, for example, in the art and are described elsewhere herein, such as binary or super binary vectors (see, eg, US 5,591,616, US2002138879 and WO 95/06722). ), Co-integrated vectors (integrated into Ti-plasmids), or T-DNA vectors, in which the chimeric gene is integrated or the appropriate transcriptional regulatory sequences / promoter already exists Only the desired nucleic acid sequence (eg, coding sequence, antisense or inverted repeat) is integrated downstream of the transcriptional regulatory sequence / promoter.

Vectors typically contain additional genetic factors to facilitate their use in molecular cloning, such as selectable markers, multiple cloning sites (see description below).

  A “host cell” or “recombinant host cell” or “transformed cell” refers to a target gene / gene family, particularly during the desired protein or transcription. A new individual resulting from the introduction of at least one nucleic acid molecule containing a chimeric gene encoding a nucleic acid sequence that produces antisense RNA or inverted repeat RNA (or hairpin RNA) for silencing into the cell A term referring to a cell (or organism). The host cell is preferably a plant cell, but may be a bacterial cell (eg, an Agrobacterium strain), a fungal cell (including a yeast cell), and the like. The host cell may comprise a nucleic acid construct as an extra-chromosomally (episomal) replicating molecule, or a chimeric gene that is integrated into the nucleus of the host cell.

  The term "selectable marker" or "scorable marker" is a term familiar to those skilled in the art and is a cell that contains a selectable marker when expressed (a cell ) Or a genetic entity that can be used to select cells, such as used herein to describe a genetic entity, eg, “plant selectable marker gene” includes that gene. Can be used to select plant cells. Depending on the selectable marker gene product, for example, antibiotic resistance, or, more preferably, herbicide resistance or another selectable such as phenotypic trait (eg pigment change) or nutritional requirement A trait is given. The term “reporter” is used primarily to refer to visible markers, such as green fluorescent protein (GFP), eGFP, luciferase, GUS, and the like.

  The terms “homologous” and “heterologous” refer to the association between a nucleic acid or amino acid sequence and its host cell or organism, particularly a transgenic organism. Therefore, homologous sequences are found naturally in the host species (e.g., tomato plants transformed with tomato genes) and heterologous sequences are not found naturally in the host cells (e.g., from potato plants). Tomato plants transformed with the sequence).

  In this specification and in the claims, the verb “to include” and variations thereof are used in a non-limiting sense that includes matters following the word but does not exclude matters not specifically mentioned. The In addition, reference to a matter by the indefinite article "a" or "an" does not exclude the possibility that more than one matter exists unless there is a context that clearly requires that only one matter exists. Thus, the indefinite article “a” or “an” usually means “at least one”. When referring to “sequences” in the present specification and the like, it is further understood that reference is generally made to actual physical molecules (eg, nucleic acids or amino acids) having a particular sequence of subunits. The

  Whenever reference is made to a “plant” or “plants” (or plants) of the present invention, parts of the plant (cells, tissues or organs, seeds, cut or harvested) Part, leaf, seedling, flower, pollen, fruit, stalk, root, callus, protoplast, etc.), progeny of a plant or clone of a clone that retains distinguishing characteristics (eg the presence of a transgene) propagations), eg seeds obtained by crossing of self-propagating and / or hybrid seeds (obtained by crossing two inbred parental lines), hybrid plants and parts of plants derived therefrom are otherwise refused It is understood that it is included in the description of the present application unless otherwise specified.

  “Substantially identical”, “substantial identity” or “essentially similar” or “essential similarity” or “variant” The term "" means that two peptides or two nucleotide sequences share at least a certain percent sequence identity when optimally aligned with programs GAP or BESTFIT, etc. using default parameters. Means. GAP (Gap) uses the Needleman and Wunsch global alignment algorithm to align two sequences against the overall length, maximizing the number of matches and minimizing the number of gaps. In general, gap initialization parameters are used with a gap creation penalty = 50 (nucleotides) / 8 (protein) and a gap extension penalty = 3 (nucleotides) / 2 (protein). The default scoring matrix used for nucleotides is nwsgapdna, and the default scoring matrix for proteins is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). It is clear that thymine (T) in a DNA sequence is considered equal to uracil (U) in an RNA sequence if the RNA sequence is said to be essentially similar or have some sequence identity with the DNA sequence . Scores for sequence alignment and percentage sequence identity can be obtained using a computer program (eg, GCG Wisconsin Package, Version 10.3 available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA.) Alternatively, the program “needle” in EmbossWIN (version 2.10.0) can be used to determine using DNAFULL as a matrix using the same GAP parameters described above or using a gap opening penalty of 10.0 and a gap extension penalty of 0.5. To compare sequence identity between sequences of dissimilar length, it is preferred that a local alignment algorithm is used [eg, Smith Waterman algorithm (Smith TF, Waterman MS (1981) J. Mol. Biol 147 (1); 195-7), for example, “water” in the EmbossWIN program. The default parameters are a gap opening penalty of 10.0 and a gap extension penalty of 0.5, using Blosum62 for proteins and DNAFULL matrix for nucleic acids.

[Detailed Description of the Invention]
The present invention has a co-transformation efficiency greater than 50%, in particular equal to or greater than 60%, 70%, 80%, 90% and especially has a co-transformation efficiency of about 100% An extremely efficient co-transformation method is provided.

  The use of two Agrobacterium strains was found, one containing a gene for a functional virE2 protein (virE2 donor strain) and one capable of producing a functional virE2 protein (virE2 mutant strain) A very high co-transformation efficiency can be achieved using strains without. A virE2 mutant strain used alone can transport its own T-DNA strand with a selectable marker gene into a plant cell (ie, transfect the cell), but cannot further process the T-DNA, T-DNA cannot be integrated into the nuclear genome of plant cells (ie, plant cells and plants cannot be made with selectable marker genes).

  When a virE2 donor strain is used for co-inoculations with a virE2 mutant strain, the donor strain's virE2 protein and T-DNA (including GOI) are transferred to plant cells. The virE2 protein produced by the donor strain enters plant cells and interacts with both T-DNA containing GOI and T-DNA containing a selectable marker gene (introduced from the virE2 mutant strain). Acts and allows the integration of both T-DNAs into the nucleus of the same plant cell nucleus. Therefore, only plant cells co-seeded with both virE2 donor and virE2 mutant strains can integrate both T-DNAs into the nuclear genome. At least about 60% of selected transformants containing both the marker gene and GOI integrated into the nuclear genome of the transformant by phenotypic selection given by the selectable marker gene being expressed This produces more (up to 100%). Since separate T-DNAs integrate at random locations in the genome, they are inherited independently, and subsequent segregation of GOI and marker genes occurs in the offspring of the transformant, and marker genes are selected and separated from GOI (selected away) (marker-free plants are produced that contain only the desired gene and no selectable marker gene).

Accordingly, in one embodiment, a method of producing a (marker-free) transgenic plant containing a desired gene is provided, the method comprising the following steps:
a) providing two Agrobacterium strains, a virE2 donor strain containing a gene encoding a functional virE2 protein and a virE2 mutant strain not capable of producing a functional virE2 protein;
b) introducing T-DNA containing the desired gene into the virE2 donor strain,
c) introducing T-DNA containing a selectable marker gene into the virE2 mutant strain,
d) contacting plant cells with both strains (e.g. co-seeding or co-infection), and
e) selecting plant cells and / or regenerated plants (or seedlings) using the phenotype provided by the selectable marker gene product, and optionally,
f) crossing and / or selfing selected plants (or plants derived from selected plants or seedlings) to produce offspring, and optionally,
g) discarding offspring containing a selectable marker gene and retaining offspring containing the desired gene but lacking the selectable marker gene (ie, the marker gene is the desired gene) Producing a marker-free plant containing the desired gene).

  Plant hosts that can be transformed with Agrobacterium strains can be transformed according to the invention (ie monocotyledonous or dicotyledonous in combination with two Agrobacterium strains according to the invention using methods known in the art). seed). For example, with regard to Agrobacterium-mediated gene transfer, Fraley et al. (Fraley et al. 1983, Proc Natl Acad Sci USA 80: 4803; Comai et al. (Comai et al. 1994, Nature 317: 741), Shah et al. (1986, Science 233: 478) and others The use of Agrobacterium to transform plant cells and subsequently regenerate transformed plants from the transformed plant cells is, for example, EP 0 116 718, EP 0 270 822, PCT publication WO 84/02913 pamphlet and published European patent application EP 0 242 246 and Gould et al. (Gould et al. 1991, Plant Physiol. 95, 426-434) are used. The construction of T-DNA vectors for Agrobacterium-mediated plant transformation is well known in the art, T-DNA vectors may be binary vectors as described in EP 0 120 561 and EP 0 120 515 or A phase against the Agrobacterium Ti-plasmid described in EP 0 116 718 Any of simultaneous integration vectors that can be integrated by homologous recombination may be used.

Step (a) of the method is not capable of producing two Agrobacterium strains, a virE2 donor strain (virE2 + strain) containing a gene encoding a functional virE2 protein and a functional virE2 protein Involved in providing a virE2 mutant strain (virE20 strain). When plant cells are co-infected with both strains, the virE2 + strain can supplement the virE20 strain, and the virE2 protein supplied by one strain is added to both T-DNAs (from the first and second strains). Leads to integration of the T-DNA transfected from the strain) into the nucleus of the transfected plant cell nucleus. The fact that the virE2 protein can enter plant cells independently of the T-DNA strand has already been shown in complementation experiments in the art, and two Agrobacterium strains (one lacking T-DNA but functional) Co-infection with a specific virE2 and the other lacking virE2 but containing T-DNA) leads to plant cells containing genome-integrated T-DNA (Otten et al. al. 1984 Mol Gen Genet 175, 159-163; Dombek and Ream J of Bacteriol 1997, Vol. 79, 1165-1173). However, this finding has not been known that the would have to explore for significantly improving the co-transformation efficiency of plant cells to date, the T-DNA that contains no one plant selectable marker gene virE2 ⁰ T-DNA containing the strain and GOI was not introduced into the virE2 ⁺ strain, and both of these two strains were used for co-infection of plant cells and did not produce marker-free plants. In Dombek and Ream (1997, supra), the strain supplying the functional virE2 protein does not contain T-DNA and does not contain the desired gene. This is because the idea is to test whether virE2 protein functionally complements virE2 mutations in other null strains to study the role of virE2 in nature. Also, the mutant / null strain used is tumorigenic, unsafe and leads to tumor formation when functionally complemented. In the present invention, preferably a safe Ti-plasmid, a safe Agrobacterium strain is used.

  Furthermore, surprisingly, by the inventors of the present invention, the use of at least one additional virE2 gene in the donor strain interacts with two different T-DNAs and transfers them to the nuclear genome of the same plant cell Therefore, it was found that a sufficient amount of virE2 protein was provided. Thus, in a preferred embodiment of the invention, the virE2 donor strain comprises at least two virE2 genes, each encoding a functional virE2 protein. The virE2 gene may be integrated into the genomic DNA, Ti-plasmid and / or further plasmid in the strain and need not be present in the same genetic element.

  Optionally, the virE2 donor strain further comprises a virG gene encoding a functional virG protein. Thus, in one embodiment, the strain comprises at least two virE2 genes and at least two virG genes, all encoding functional proteins. Genes function in Agrobacterium from native promoters (ie native virE2 and virG promoters) or inducible promoters, constitutive promoters, promoters from virE2 or virG genes of other Agrobacterium strains, etc. May be transcribed from different promoters. Agrobacterium tumefaciens VirG nucleic acid and protein sequences from various strains are available in the art, eg, Schrammeijer (Journal of Experimental Botany, Vol. 51, No. 347, pp. 1167 -1169, June 2000) or GenBank accession number X62885 (SEQ ID NO: 4), NP_059810, AAA91602, etc. Therefore, the VirG protein is, for example, the protein of SEQ ID NO: 4 (X62885) or VHA of EHA105 (pTiBo542) (Chen, CY et al. Mol. Gen. Genet. 230 (1-2), 302-309 (1991) When aligned, for example, it contains at least 80%, 90%, 95%, 98%, 99% or more amino acid identities.

virE2 donor strains Suitable virE2 donor strains include Agrobacterium strains that are naturally capable of infecting plant cells (eg, Agrobacterium tumefaciens strains and Agrobacterium rhizogenes strains). Preferably, said strain comprises a (preferably safe) Ti-plasmid carrying the natural (wild type) virE operon and hence the natural virE2 gene. Agrobacterium strains commonly used in plant transformation methods are suitable as long as the strain is virulent. Preferably, the strain is safe (ie, the tmr and tms genes found in the natural T-DNA region of A. tumefaciens are removed or non-functional and the plant tumor is transferred to T-DNA Does not occur later). The entire native T-DNA region of the native Ti-plasmid may be removed to make the strain safe. The Ti-plasmid and / or Agrobacterium strain may be of any opine type, but in a preferred embodiment, a succinamopine Ti-plasmid is used, which contains the gene for succinamopine catabolism. Succinamopine Ti-plasmids are available in the art (eg, EHA105 strain). It is understood that the (safe) Ti-plasmid can be manipulated inside and outside Agrobacterium and can be introduced or transferred into any Agrobacterium strain, such as a strain in which the original Ti-plasmid has been corrected. Similarly, other plasmids may be introduced into Agrobacterium strains, which provide additional functions (eg, T-DNA introduced into plant cells, additional virE2 and / or virG genes, etc.) . In addition, genetic factors may be introduced into the genomic DNA of the strain. Thus, according to the present invention, genetic factors referred to in the present specification and the like may be introduced into one or more different parts of an Agrobacterium strain (for example, one or more Ti atoms). -Plasmid, one or more additional plasmids, genomic DNA, etc.). Even if this matter is not explicitly mentioned in the description, it is understood that it is included in the specification of the present application.

  Instead of or in addition to the virE2 gene found in the (preferably safe) Ti-plasmid, one or more additional virE2 genes are naturally found in the Agrobacterium strain Ti-plasmid and are It may be supplied in cis or trans to other required vir genes. Thus, in one embodiment, the Agrobacterium strain comprises one or more virE2 genes in a Ti-plasmid, genomic DNA and / or further plasmids.

  For example, one or more plasmids containing a virE2 gene encoding a functional virE2 protein operably linked to an appropriate transcriptional regulatory region that is active or inducible in the strain (e.g., a Ti-plasmid and / Or other plasmid) is introduced into the strain. The plasmid may also contain the entire virE operon found in the Agrobacterium Ti-plasmid. Preferably, there are genes in the strain encoding at least two functional virE2 proteins, although more (eg, 3, 4, 5 or more) may be present. Safed Agrobacterium strains containing a virE2 gene encoding a Ti-plasmid and at least one functional virE2 protein are widely available in the art.

  The additional virE2 gene operably links the coding sequence of the virE2 gene with a promoter active in Agrobacterium (eg, the native virE2 promoter), and the gene is linked to an appropriate plasmid and / or of the strain. It can be introduced using known methods such as by insertion into Ti-plasmids and / or into genomic DNA. An additional virE2 gene may be inserted, for example, in the vir-region of the Ti-plasmid or at another position in the Ti-plasmid. In one embodiment, at least two virE2 genes are present in trans in one genetic factor (eg, Ti-plasmid or another plasmid). In another embodiment, at least two virE2 genes are present in cis, such as in different genetic factors. For example, one virE2 gene is present in the Ti-plasmid and one virE2 gene is present in the helper plasmid.

  The virE2 gene that encodes a functional VirE2 protein.

In addition, the virE2 donor strain is used to transport the virE1 gene (virE2 protein to plant cells) encoding at least one (optionally at least 2, 3, 4 or more) functional virE1 protein ) Is also included. The virE1 gene is an Agrobacterium genome, Ti-plasmid (i.e., the Ti-plasmid may contain the original virE1 gene and promoter and / or one or more other virE1 genes and promoters are inserted. And / or may be present on another plasmid. Thus, the Ti-plasmid or other plasmid used to introduce the virE2 gene is preferably in one embodiment at least one virE1 gene operably linked to a promoter active in Agrobacterium, such as the virE operon promoter. May be included. The gene encoding the Agrobacterium virE protein is available in the art [see, eg, GenBank Accession AAZ50537 (SEQ ID NO: 5; virE1 of pTiBo152)]. “VirE1” includes variants such as virE2 protein that contain at least 80%, 90%, 95%, 98%, 99% or more amino acid sequence identity with SEQ ID NO: 5.

  Preferably, said strain is a single stranded T-DNA provided by a virE2 mutant strain (a marker gene-containing T-DNA) and a single stranded provided by a virE2 donor strain upon co-seeding with a virE2 mutant strain Capable of producing sufficient virE2 protein to interact with both T-DNA (GOI-containing T-DNA). Whether a “sufficient” virE2 protein has been generated can be determined by one skilled in the art using routine experimentation. For example, if the co-transformation efficiency is lower than 50%, the virE2 protein produced may be insufficient, adding one or more additional virE2 genes (e.g. on a helper plasmid), etc. Need to be increased.

  The virE2 gene can be cloned and introduced into any plasmid and / or Agrobacterium strain as desired. SEQ ID NO: 1 (cDNA) and SEQ ID NO: 2 (protein encoded by SEQ ID NO: 1) provide the virE2 gene / protein of Ti plasmid pTiBo542. The VirE2 gene and protein are also available in public databases [see AAZ50538 (virE2 from pTiBo542), NP_059819 and others].

  SEQ ID NO: 3 provides the virE2 gene with an insertion in the virE2 open reading frame. The insert was made by integrating (homologous recombination) a plasmid containing a portion of the virE2 open reading frame (ORF) into the original virE2 ORF. The insertion may occur at any position in the virE2 ORF, below in the following after nucleotide 203 of SEQ ID NO: 1. Thus, the virE2 mutant strain deposited herein as CBS121809 contains a Ti-plasmid having SEQ ID NO: 3 (which contains a disruption of SEQ ID NO: 1) and virE2 protein is no longer produced in vivo (see below). See).

  Clearly, other virE2 sequences encoding functional virE2 proteins can be generated or identified (eg, in silico) or isolated from Agrobacterium strains using methods known in the art. The virE2 gene according to the present invention has at least 70%, preferably at least 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity with SEQ ID NO: 2 (relative to the overall length). Using pair-wise alignments, for example, the nucleotide sequence encoding a protein containing, for example, the EmbossWIN program “needle” with a gap opening penalty of 10.0 and Blosum62 as a matrix with a gap extension penalty of 0.5) A gene encoding an amino acid sequence (also referred to as “variant”). Thus, a virE2 gene encoding a functional virE2 protein or variant thereof (eg, a homolog) can be isolated from other organisms (especially other Agrobacterium strains) and functional in virE2 donor strains. Used to produce virE2 protein. Other virE2 nucleic acid and / or amino acid sequences may also be identified in nucleic acid hybridization or PCR using in silico in DNA and / or protein databases or using the virE2 sequence or portion thereof as a probe or primer. The same applies further to the above virG and virE1 genes and proteins (and variants thereof).

  The functionality of the encoded virE2 protein and / or variant can be easily tested using, for example, the complementation assays described in the examples.

  Clearly, the virE2 nucleic acid sequence according to the present invention has at least 70%, preferably at least 80%, 85%, 90%, 95%, 98%, 99% or more nucleic acid sequence identity (overall) with SEQ ID NO: 1. Also included are variants such as nucleic acid sequences using pairwise alignments to lengths, eg, using the EmbossWIN program “needle” with a gap opening penalty of 10.0 and a DNA extension of 0.5 with a gap extension penalty of 0.5).

virE2 mutant strain The second strain used in the method is a virE2 mutant strain that is not capable of producing a functional virE2 protein. When referring to “non-functional virE2 is created”, this matter does not make any virE2 protein produced / created by the strain or can produce / create non-functional protein The possibility is included.

  Also, any Agrobacterium strain can be used as long as the endogenous virE2 gene found in the (preferably safe) Ti-plasmid has been modified so that it does not / cannot produce a functional protein (and Any Ti-plasmid). VirE2 mutant strains can be created in the same manner as described in the EHA105-dE2 (CBS121809) example, for example, by inserting the plasmid into virE2 ORF by homologous recombination. Obviously, many other methods are available in the art and the same result is achieved. The virE2 mutant strain contains the mutant virE2 gene or lacks the virE2 gene by insertion, deletion and / or substitution of all or part of the virE2 gene (eg, SEQ ID NO: 1 or variants thereof) in the Ti-plasmid Yields a Ti-plasmid. When referring to a “mutant” virE2 gene, any genetic modification that does not result in a substantially functional virE2 protein being created is included (ie, a virE2-protein encoding DNA) Mutation / genetic modification by insertion, substitution or deletion of all or part of Alternatively, mutant virE2 genes can be isolated or created using synthetic or molecular biology techniques. This can then be used to replace the functional virE2 gene in the Ti-plasmid used in the strain.

  Loss of virE2 activity can be determined as described in the examples. Alternatively, other known assays may be used.

  In one embodiment of the invention, the virE2 variant is a strain deposited with accession number CBS 121809 (or a derivative thereof), or an Agrobacterium strain comprising a Ti-plasmid contained therein, or The mutant virE2 gene included. A Ti-plasmid containing the virE2 mutant gene may be transferred to another strain, such as a strain that has been cured. Alternatively, the mutant gene may be isolated from the deposited strain and transferred to another strain and / or another Ti-plasmid.

  Also, several other VirE2 mutant Agrobacterium strains have already been described in the art, but these strains have not been used in co-transformation methods and only study the function of virE2. For example, the literature (Simone et al. 2001 (Mol Microbiol Vol 41: 1283-1293), Dombek and Ream (1997, J of Bacteriology Vol 179: 1165-1173), Binns et al. (1995, J of Bacteriol. Vol 177 : 4890-4899) and Stachel and Nester (1986; EMBO J Vol. 5: 1445-1454)] describe the production of virE2 mutants and virE2 mutant strains. However, the strains are not safe, they are not used for co-transformation, and the complementation assay utilizes a wild strain to provide functional virE2 (but does not include T-DNA with GOI) . In addition, all virE2 mutant strains are octopine-type strains.

  The virE2 mutant strains described above may also be used in the present invention, but preferably the strain is made safe before use. Said strains contain pTiA6NC with virE2 replaced with nptII A. tumefaciens strain WR5000 (Dombek and Ream, see above, see Fig. 1) or Ti-plasmid pTiA6NC (eg found in strain A348) Another virE2 variant derived by mutating the virE2 gene in A. tumefaciens strains listed in Table 1 of Binnes et al. (Above), for example, A348 :: virE2 where the plasmid is integrated into the ORF of virE2; Included are the Agrobacterium strain 358mx described in Stachel and Nester (supra) containing transposon insertions in the virE2 gene.

  Basically, any Agrobacterium strain can be modified to include a mutation in the virE2 gene or a lack in the virE2 gene. In one embodiment of the invention, a virE2 mutant strain and / or a virE2 mutant Ti-plasmid, wherein the mutant strain and / or Ti-plasmid is a strain containing a succinamopine Ti-plasmid and / or such a plasmid. Is provided. In one embodiment, the virE2 mutant strain of the present invention is preferably a succinamopine strain carrying a Ti plasmid (EHA101, EHA105) derived from pTiBo542. These strains have a broad host range, meaning that they are capable of transforming many different plant host species.

  The virE2 gene includes insertions, deletions or substitutions of all or part of the virE2 gene so that the virE2 protein is not generated and is non-functional (eg, truncated or not correctly folded). In one embodiment, the virE2 mutant strain is EHA105-dE2 deposited under accession number CBS 121809 and the Ti-plasmid is a plasmid present in this strain or any derivative thereof. Also, an isolated mutant virE2 DNA is provided as shown in SEQ ID NO: 3, which contains an insertion (knockout) in the virE2 cDNA of SEQ ID NO: 1. SEQ ID NO: 3 shows the entire VirE operon region of the mutant strain containing the plasmid inserted into the virE2 ORF that is destroyed during processing.

  Accordingly, in one embodiment of the invention, the virE2 mutant strain comprises one or more insertions, deletions and / or substitutions in the virE2 gene, wherein part or all of said virE2 gene has been deleted and / or replaced and / or Alternatively, DNA is inserted and the resulting change leads to the absence of virE2 protein or the creation of non-functional virE2 protein (eg, shortened, non-functional protein).

  In step (b) of the method, T-DNA containing the desired gene is introduced into the virE2 donor strain, and in step (c), T-DNA containing the selectable marker gene is introduced into the virE2 mutant strain. Is done. Thus, for example, suitable T-DNA is provided that includes operably linked factors such as RB and (optionally) LB, GOI or markers. T-DNA can be generated using standard molecular biology methods. Preferably, the T-DNA is present in a plasmid vector such as a binary vector or a cointegrated vector. Introduction of T-DNA or a vector containing T-DNA into an Agrobacterium strain can be performed by electroporation or the like.

  Accordingly, in one embodiment of the method, T-DNAs are introduced into a DNA vector or plasmid, and the T-DNAs comprises at least a light border sequence.

  The GOI may be any gene that encodes a protein or has a different function, eg, a biological gene (coding sequence such as cDNA or genomic DNA) and / or abiotic stress tolerance , Disease resistance, herbicide resistance, agronomic traits, output traits, etc. (but not limited to). The GOI may be a plant or a plant-derived gene, or may be a gene found in nature in bacteria, fungi, animals (including humans), and the like. In one embodiment, the gene is a cis-gene. Appropriate coding sequences for genomic DNA and cDNA are available in the art (eg, nucleic acid databases).

  Marker genes include plant selectable markers, such as resistance genes (eg, antibiotic resistance, herbicide resistance, etc.) or traits (eg, expression) that can be used to select transformants. Other genes that give (but not limited to) those that give type traits).

  The plant, plant part, plant cell or tissue transformed in step (d) is suitable for both strains (ie at least one virE2 donor strain and at least one virE2 mutant strain) and / or The ratio is contacted for a suitable period of time under suitable conditions as described, for example, in an established Agrobacterium transformation protocol or adapted therefrom. See Example 2 for an overview of tomato transformation literature and protocols. Co-seeding or co-infection refers to the fact that both are physically added to the cell / tissue (as a mixture or at the same time) or added to the strain continuously, such as in the present specification. Refer to either. In the case of continuous contact, it is preferred to add the strain containing GOI first. This is because GOI is not (usually) selected, followed by a strain that contains a selectable marker gene within a short time interval.

Plant cells or tissues may be cotyledons or other tissue explants known in the art such as, for example, root cultures, leaf discs, and the like. Alternatively, part or all of the plant may be contacted, such as by infiltration. Agrobacterium transformation protocols are known in the art and can be used in accordance with the present invention. The plant cell, tissue or plant may be any species that is amenable to Agrobacterium transformation. Thus, any plant is suitable, e.g. monocotyledonous or dicotyledonous, e.g. maize / corn (Zea species, e.g. Z. mays, Z. diploperennis (chapule), Zea luxurians (Guatemalan teosinte), Zea mays subsp. Huehuetenangensis (San Antonio Huista teosinte), Z. mays subsp. Mexicana (Mexican pig sorghum), Z. mays subsp. Parviglumis (Balsas teosinte), Z. perennis (perennial pig sorghum) and Z. ramosa, wheat Triticum species), barley (e.g. Hordeum vulgare), oats (e.g. Avena sativa), sorghum (Sorghum bicolor), rye (Secale cereale), soybean (Glycine spp, e.g. G. max), cotton (Gossypium species) , E.g., G. hirsutum, G. barbadense), Brassica spp (e.g., B. napus, B. juncea, B. oleracea, B. rapa, etc.), sunflower (Helianthus annus), tobacco (Nicotiana species), alfalfa ( Medicago sativa), rice (Oryza species, eg O. sativa indica) Varieties or japonica cultivars), forage grasses, pearl millet (Pennisetum species. Eg P. glaucum), tree species, vegetable species, eg Lycopersicon ssp (recently reclassified as belonging to the genus Solanum), for example tomato (L. esculentum, syn. Solanum lycopersicum), for example cherry tomato, var. cerasiforme or modern tomato, var. pimpinellifolium) or tomato (S betaceum, syn. Cyphomandra betaceae), potato (Solanum tuberosum) and other Solanum species, for example eggplant (Solanum melongena), pepino (S. muricatum), cocoa (S. sessiliflorum) and naranjilla (S. quitoense); pepper Genus (Capsicum annuum, Capsicum frutescens), peas (e.g. Pisum sativum), legumes (e.g. Phaseolus species), carrots (Daucus carota), Lactuca species (e.g. Lactuca sativa, Lactuca indica, Lactuca perennis), cucumber ( Cucumis sativus), melon (Cucumis melo), zucchini (Cucurbita pepo), pumpkin (Cucurbita maxima, Cucurbita pepo, Cucurbita mixta), pumpkin (Cucurbita pepo), watermelon (Citrullus lanatus syn. Citrullus vulgaris) , Peach, plum, strawberry, mango, melon), ornamental plant species (eg, Rose, Petunia, Chrysanthemum, Lily, Tulip, Gerbera species), woody trees (eg, species of Populus, Salix, Quercus, Eucalyptus),
Fiber species such as flax (Linum usitatissimum) and Asa (Cannabis sativa). In one embodiment, vegetable seeds, particularly Solanum seeds (including Lycopersicon seeds) are preferred.

  Thus, for example, species of the following genera can be transformed: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica , Raphanus, Sinapis, Atropa, Capsicum, Datura, Cucumis, Hyoscyamus, Lycopersicon, Solanum, Nicotiana, Malus, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Citrullus, Asparagus, Antirrhinum, Panterus, Neterocael , Pennisetum, Ranunculus, Senecio, Salpiglossis, Browaalia, Glycine, Pisum, Phaseolus, Gossypium, Glycine, Lolium, Festuca, Agrostis.

  In one embodiment, the ratio of virE2 mutant (containing a selectable marker gene) to virE2 donor strain (containing GOI) is about 1: 3. For other suitable ratios, preferably a higher donor strain (eg a ratio exceeding 1: 1, eg 1: 2, 1: 4, 1: 5, or other) is used for the virE2 mutant strain Including any ratio. However, for example, it has been found that a 1: 1 ratio for tobacco is more appropriate than a ratio exceeding 1: 1.

  The two strains are preferably freshly grown. The strain may be mixed prior to contact with the plant or plant tissue, or may be contacted with the cells in separate steps (eg, sequentially or simultaneously).

  The amount of each strain includes, for example, an OD at about 600 nm between about 0.100 and about 0.300 in liquid MS20 medium, or an equivalent amount.

  In step (e), plant cells, tissues, organs or plants (and seedlings) and / or regenerated plants or seedlings are subjected to a selection step based on the marker gene and its expression product. Thus, step (e) includes selecting plant cells and / or regenerated plants (or seedlings) using a phenotype provided by a selectable marker gene product. The purpose of this step is to select cotransformants.

  Standard methods can be used in this step. For example, roots and / or shoots may be regenerated and the regenerated tissue (part) is selected and selected based on the marker gene and / or its expression product or phenotype provided thereby. Also good. As already mentioned above, methods for regenerating whole plants from transformed plant cells are known in the art and applied to transformed and / or selected cells. it can. Depending on the type of marker gene used, the selection method may vary. If the marker gene is a herbicide resistance gene, plantlets or a portion of leaves may be contacted with the herbicide. Next, seedlings that are resistant to the herbicide are selected. The selected plant may be a primary transformant (T1 generation), but selection may be performed instead or in addition at a later stage (eg, a later generation obtained by selfing and / or crossing). Good. Thus, optionally, the plants may be further crossed and / or selfed to produce whole plants and progeny that contain the marker gene DNA in their genome.

  Due to the high efficiency of the co-transformation of the present invention, primary transformants containing a high percentage of marker genes also contain GOI. Thus, more than 50%, for example, at least 60%, 70%, 80%, 90% or more (95%, 99%, 100%) of selected transformants also contain GOI in addition to the marker gene . Non-selected plants may be discarded. Higher transformation efficiency is more preferable. This is because fewer transformants need to be analyzed for the presence of GOI using tedious molecular biology methods such as PCR for GOI or nucleic acid hybridization for GOI (e.g., Southern blot analysis). It is. In examples such as the specification of the present application, it was confirmed by PCR analysis that 100% of the selected plants contained both T-DNAs. Thus, a very small total number of transformants is required compared to traditional co-transformation.

  Optionally, the method further comprises f) crossing and / or selfing the selected plant (or a plant derived from the selected plant or seedling) to produce offspring, g) optionally Discarding progeny containing a selectable marker gene and retaining a progeny that contains the desired gene but lacks the selectable marker gene (ie, isolates the marker gene from the desired gene) Producing a marker-free plant containing the desired gene).

Since the marker gene and GOI can be isolated from each other, if necessary, plants or offspring containing these selectable marker genes may be discarded, including plants or offspring that contain GOI but lack a selectable marker gene May be retained for further use. Thus, a plant can be produced that contains only the GOI integrated into the genome, and the marker gene is segregated away from the plant. Such plant selection can be performed using known methods such as using PCR screening, hybridization-based methods and / or phenotypic selection.

Agrobacterium strains and Ti-plasmids according to the present invention provide Agrobacterium strains and Agrobacterium strain pairs (at least one virE2 donor strain and at least one virE2 mutant strain) for use in the above method Is also an aspect of the present invention.

  The virE2 donor strain preferably further comprises a T-DNA containing GOI in the cell (eg on a plasmid), whereas the virE mutant strain preferably further comprises a T-DNA containing a marker gene in the cell (eg on the plasmid). Contains DNA.

  In one embodiment, the virE2 mutant strain comprises a Ti-plasmid having a mutation (preferably a DNA insert) in the virE2 gene and does not result in a functional virE2 protein produced by the strain. In a preferred embodiment, the virE2 mutant strain is the strain deposited under accession number CBS 121809, or a derivative thereof carrying the Ti-plasmid found therein. In another embodiment, a strain comprising a CBS121809 Ti-plasmid, a strain comprising a mutated virE2 gene found in the CBS121809 Ti-plasmid is provided.

The use according to the invention is already evident from the above description in the description etc. of the present application. In one embodiment, the functional virE2 protein is encoded together with a first Agrobacterium strain that contains T-DNA that is not capable of producing a functional virE2 protein and contains a selectable marker gene. And a second Agrobacterium strain containing T-DNA containing the desired gene for the simultaneous transformation of the two T-DNAs with a plant, plant cell or plant tissue. Provided.

  The virE2 gene of the first Agrobacterium strain preferably contains an insertion, deletion or replacement of all or part of the virE2 gene.

A kit according to the invention also provides a co-transformation kit, which comprises first and second Agrobacterium strains, said first strain comprising all or the Ti-plasmid virE2 gene present in said strain The second strain contains a gene encoding a functional virE2 protein without the ability to produce a functional virE2 protein due to partial insertions, deletions or substitutions.

  Preferably, said second strain comprises at least two virE2 genes encoding functional virE2 proteins as described.

  The strain may be supplied in or as a viable culture frozen or freeze-dried, such as on a plate. The strains may also be provided separately or as a mixture, eg, in appropriate ratios and / or concentrations for use in co-transformation. Others may be provided in the kit, such as protocols, controls, virE2 DNA (eg, probes and / or primers), buffers, etc.

  Also included are transformed and / or regenerated transgenic plant cells and plants (and / or plant parts) produced using the methods described above.

SEQ ID NO: 1: virE2 cDNA
SEQ ID NO: 2: virE2 protein encoded by SEQ ID NO: 1.

SEQ ID NO: 3: Insertion (knockout) virE operon containing mutant virE2 cDNA SEQ ID NO: 4: virG protein (X62885)
SEQ ID NO: 5: virE1 protein (AA250537)

Map of plasmid pKG6305. Map of plasmid pKG6330. Overview of T-DNA transfer from Agrobacterium (bottom) to plant cells (top). Co-transformation with non-mutant strains. The co-transformation efficiency is less than 50% (black dots indicate virE2 protein). Method according to the invention leading to high co-transformation efficiency (black dots indicate virE2 protein).

  The following non-limiting examples describe co-transformation methods and strains according to the present invention. Unless otherwise stated in the examples, all recombinant DNA techniques are described in the literature [Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, and Sambrook and Russell (2001) Molecular Cloning. : A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA.Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by RDD Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK].

[Example]
Example 1: Construction and confirmation of EHA105-dE2 Agrobacterium tumefaciens strain EHA105-dE2 (disrupted with respect to the “d” strand) is not capable of replicating in Agrobacterium tumefaciens (disruption plasmid) (referred to as pKG6328) ) Was integrated by homologous recombination into the EHA105 VirE2 gene. The EHA105 Ti plasmid is a derivative of the Ti plasmid pTiBo542. The insertion of pKG6328 into the VirE2 open reading frame (ORF) was confirmed by amplifying the border portion of pKG6328 into Ti plasmid and sequencing them. (Dysfunction) To test for function, transformation experiments were performed. In this experiment, as a control, the ability to replicate in Agrobacterium tumefaciens was knocked out by adding a plasmid (plasmid pKG6330) expressing both the pTiBo542 VirE1 and VirE2 genes driven by the VirE operon promoter. Complementation is included.

  The EHA105-dE2 strain can be obtained by the applicant under the accession number CBS 121809 under “Centraalbureau voor Schimmelcultures” (CBS, PO Box 85167, 3508 AD Utrecht, The Netherlands) or “Fungal Biodiversity Center” (Utrecht, The Netherlands). As deposited on August 30, 2007.

Construction of destruction vector pKG6328
A portion of the pTiBo542 ORF was directly amplified with a VirE2 gene specific primer containing a specific portion with a stop codon in three reading frames in EHA105 bacteria.

(Fw: 5'-TGAATGAATGATGATGACACTGAC-3 'and
Rev: 5'-TTAGTCAATTAGTCGCCGGCAAACCTGT-3 ').

The following PCR profiles were used: 3 minutes 80 ° C-2 minutes 94 ° C-(30 seconds 94 ° C-1 minute 55 ° C-1 minute 72 ° C) 30 times-4 ° C long time. The resulting PCR product was ligated to the Invitrogen PCR cloning vector using the R6K origin of replication. The resulting plasmid was sequenced to confirm the incorporation of a stop codon on each side of the VirE2 ORF portion. This plasmid was called pKG6328.

Agrobacterium tumefaciens strain EHA105 VirE2 gene disruption plasmid pKG6328 was electroporated into competent cells generated from EHA105. This plasmid is not capable of replicating in Agrobacterium tumefaciens and requires the endogenous VirE2 gene to be destroyed in the process by homologous recombination using the VirE2 ORF moiety. Transformants were selected with kanamycin (a selectable marker present in the pKG6328 vector backbone). The disruption of the VirE2 gene was confirmed by amplifying the integration site and sequencing them (SEQ ID NO: 3). This new strain was named EHA105-dE2 and was deposited as CBS 121809.

Construction plasmid pBBR1MCS (GENBANK NR.U02374, Kovach et al. 1994, BioTechniques 16 (5), 800-802) is a backbone vector for both pKG6305 and pKG6330. The VirG gene was amplified using the following primers: Reverse: 5'-CTCGCGTCATTCTTTGCTGGAG-3 'and Forward: 5'-TCCGGGATCGATTTCAACAATAC-3'. A. 50 ng of total DNA from Tumefaciens strain EHA105 was used as a template for the following PCR profile: 2 min 94 ° C-(30 sec 94 ° C-1 min 58 ° C -2 min 68 ° C) x30 -10 min 72 ° C-4 ° C for a long time. Proofreading DNA polymerase was used to reduce the risk of PCR errors (rTth polymerase from Perkin Elmer). Using the Perkin Elmer AmpliTaq red, one unit of this polymerase was added to the PCR reaction, and an “A-overhang” was created by incubating at 72 ° C. for 10 minutes. This PCR product was ligated into the pCR2.1 PCR cloning vector from Invitrogen and sequenced.

  The VirG gene was obtained from this vector by cutting the plasmid with PstI and SacI and isolating a 1393 bps fragment containing the gene from the gel. This fragment was ligated into the corresponding site of pBBR1MCS. This new plasmid was provided with new multiple cloning sites (MSCs) for later cloning steps. This MCS consists of two oligos: 5'-TTCTAGAACTAGTGGGCCCCTGCAGGTTAACATGCA-3 'and 5'-TGTTAACCTGCAGGGGCCCACTAGTTCTAGAAGGCC-3'. If these two oligos form a double-stranded fragment of DNA after phosphorylation, they will have a single-stranded DNA overhang that matches the overhang created by ApaI and PstI. Using these two enzymes, adapters were ligated to these sites. This final product is pKG6305. Figure 1 shows the map of plasmid pKG6305.

Construction of pKG6330
The VirE operon promoter, VirE1 gene, and VirE2 gene are amplified from EHA105 with gene-specific primers and carry a pBBR origin of replication and a chloramphenicol resistance gene (for selection in bacteria) Cloned into the backbone. The following primers were used to amplify this VirE operon segment:
Fw: 5'- ACTAGT TGCCCGCGAAACAGCATTGACT -3 'and
Rv: 5'-G GGTACC ATGACGCGGCAGCAGGAAC-3 '.

The SpeI restriction enzyme site was incorporated with the forward primer and the KpnI site was incorporated with the reverse primer. The site is underlined in the primer sequence. A. 50 ng of total DNA from Tumefaciens strain EHA105 was used as a template for the following PCR profile: 2 min 94 ° C-(30 sec 94 ° C-1 min 58 ° C-3 min 68 ° C) x30 -10 min 72 ° C-4 ° C for a long time. Proofreading DNA polymerase was used to reduce the risk of PCR errors (rTth polymerase from Perkin Elmer). The PCR product was subsequently cut with SpeI and KpnI and ligated into the corresponding sites of pKG6305. This plasmid can replicate in both E. coli and Agrobacterium tumefaciens. After verifying the sequence, this plasmid was transferred to Agrobacterium by electroporation. Figure 2 shows the map of plasmid pKG6330.

With EHA105-dE2 supplemented with T-DNA for gusA expression for transformation of virulence and complementation test plants, the number of transformed cells produced is close to zero because of disruption of the VirE2 gene. Also, when an intact copy of the VirE operon is added to this strain, the phenotype is complemented and virulence returns to the level of a strain with non-destructive VirE2 (EHA105 without the disruption of the VirE2 gene). Tobacco (Nicotiana benthamiana) was transformed (both leaf disk transformation and Agrobacterium infiltration) and the virulence of EHA105-dE2 was evaluated. The following strain-plasmid combinations were used:
1. EHA105 and T-DNA (positive control);
2. EHA105-dE2 and T-DNA (should be close to zero);
3. EHA105-dE2 and T-DNA, and pKG6330 (complementary test).

For leaf disc transformation, 1 cm diameter leaf discs were cut from tobacco leaves. The protocol used for tobacco leaf disk transformation is described in Horsch et al. (Horsch et al, 1988, Plant molecular biology manual A5: 1-9). For each Agrobacterium treatment, 40 leaf discs were transformed. Ten days after the start of co-cultivation, leaf discs were used for GUS staining using Xgluc as a substrate (Jefferson et al. 1987 EMBO J. December 20; 6 (13): 3901-3907). For each leaf disc, the number of blue spots was counted. The results of leaf disk transformation are provided in Table 1 below.

  Table 1: Average number (AVG) of gus spots per leaf disc obtained using different strain-plasmid combinations after transformation. For each standard deviation (SD), the maximum number (MAX) and the minimum number (MIN) were counted as well.

  Both leaf disc transformation and Agrobacterium infiltration (data not shown) indicated that EHA105-dE2 was not capable of significantly transferring T-DNA to plant cells as a result of VirE disruption. However, insertion into VirE2 can be complemented by the addition of a separate plasmid expressing VirE2.

Example 2: Cotransformation with EHA105-dE2 In the following cotransformation experiments, the EHA105-dE2 strain confers resistance to the nptII gene (for selection of plant transformants; the nptII gene is EHA105 is used as a strain for delivering a T-DNA having a plant selectable marker gene), and EHA105 has a gusA gene, the gusA gene exemplifies a desired gene (GOI) according to the present invention. -Used to deliver DNA. To compare the performance of this couple, other combinations were used as well.

Plasmid used
The plasmid pKG6330 carrying the pTiBo542 VirE operon is described in Example 1 and FIG. Plasmid pKG6305 has the same vector backbone as pKG6330 but carries the pTiBo542 VirG gene promoter and VirG gene ORF (described in Example 1 and FIG. 1). In addition, two plasmids with T-DNA are used. One plasmid carries the nos promoter-nptII gene-nos terminator construct between the Agrobacterium RB and LB sequences, and the other contains the 35S promoter-gusA gene (potato LS1 intron) between the Agrobacterium RB and LB sequences. With the nos terminator construct (the gusA gene with the LS1 intron is described by Vancanneyt et al. (Vancanneyt et al 1990, MGG 220 (2): 245-250)). Strains with nptII T-DNA are referred to as “nptII donor” and strains with gusA T-DNA are referred to as “gusA donor”.

Strains used for co-transformation-plasmid combinations Table 2 below shows the strain-plasmid combinations tested. In addition to these combinations in each experiment, non-transformed controls were included in both the selection medium and the medium without selection as well.

  Table 2: Agrobacterium tumefaciens strains and plasmid combinations used for (co-) transformation experiments.

Transformation experiment of tomato cotyledon explant Tomato transformation protocol is described in Koornneef et al. (Koornneef et al. (Transformation of tomato; In: Tomato Biotechnology, Donald Nevins and Richard Jones, eds. Alan Liss Inc., New York, USA, pag. 169-178)) and Koornneef et al. (Koornneef et al. 1987, Theor. Appl. Genet. 74: 633-641). For co-transformation, diluted Agrobacterium cultures were mixed at a ratio of 1: 3 for the nptII donor strain and the gusA donor strain, respectively. The rest of the protocol described is unchanged.

When tomato shoots emerged, they were harvested and rooted in solid MS20 medium containing 1 mg / l IBA, 200 mg / l cefotaxime, 200 mg / l vancomycin, and 100 mg / l kanamycin .

Analysis of the seedling obtained
DNA was isolated from regenerated seedlings and analyzed using PCR for the presence of T-DNAs. For nptII, the PCR primers are as follows: Fw 5'-GTCCCGCTCAGAAGAACT -3 'and Rv 5'-GGCACAACAGACAATCGG -3'; The primer pair of gusA is as follows: Fw 5'- GGGCAGGCCAGCGTATCGT -3 'And Rv 5'- GTGTTCGGCGTGGTGTAGAGCAT -3'. For each reaction, 50 ng of plant DNA and 1 unit of AmpliTaq red (Perkin Elmer) were used. The PCR profile used is 3 min 94 ° C-(30 sec 94 ° C-30 sec 55 ° C-1 min 72 ° C) x 30-4 ° C long time. 10 μl of each reaction is analyzed by staining with ethidium bromide (EtBr) on a 1.5% agarose gel in 1 × TAE.

To evaluate the manner in which both T-DNAs were integrated into the genome (coupled or non-coupled), they were bred with the original transformants. Progeny were analyzed using PCR for the presence of both T-DNAs as described above.

result
Treatment with EHA105-dE2 (nptII donor) and EHA105 (gusA donor) (Table 2, test combination 1) regenerated five plants. Using PCR as described above, PCR products indicating the presence of both T-DNAs were obtained from all five plants (100% co-transformation efficiency).

Example 3: Tobacco Co-transformation A second co-transformation experiment was performed on tobacco (Nicotiana tabacum) cv.SR1 using Agrobacterium transformation and regeneration and GUS staining protocols well known in the art. The applied co-transformation treatment resulted in a 1: 3 ratio of VirE2-deficient strain carrying nptII T-DNA to wild strain carrying only gus T-DNA (or alternatively 1: 1 Ratio). For both treatments, control conditions were also applied and consisted of the same mixing ratio of only non-deficient (VirE2 wild type) strains. The results are summarized in Table 3. Under the highest conditions (1: 1 mixing ratio), a cotransformation efficiency of 82.5% was observed (treatment 3) compared to the cotransformation efficiency of 53.3% (treatment 4) of the control strain. This effect is significant at P <0.05 (chi-square = 25.82). When a 1: 3 mix ratio of the two strains was applied (Treatment 1), the co-transformation efficiency was 74.5% vs. 55.6% (in the control). This difference was equally significant at P <0.05 (chi-square = 6.81).

  Table 3: Average (AVG) number of GUS positive plants obtained after transformation of tobacco with VirE2-deficient strains. Treatment of co-transformants 1 is EHA105-dE2 with nptII T-DNA: 1: 3 mixture of Agrobacterium strain of EHA105 with gus T-DNA. Treatment of co-transformants 2 is EHA105 with nptII T-DNA: 1: 3 mixture of Agrobacterium strains of EHA105 with gus T-DNA. Treatment of co-transformants 3 is a 1: 1 mixture of EHA105-dE2 with ptII T-DNA: Agrobacterium strain of EHA105 with gus T-DNA. Treatment of co-transformants 4 is EHA105 with nptII T-DNA: a 1: 1 mixture of Agrobacterium strain of EHA105 with gus T-DNA.

Claims (14)

A method for producing a selectable marker-free transgenic plant containing a desired gene comprising the following steps:
a) providing two Agrobacterium strains, a virE2 donor strain containing a gene encoding a functional virE2 protein and a virE2 mutant strain not capable of producing a functional virE2 protein;
b) introducing T-DNA containing the desired gene into the virE2 donor strain,
c) introducing T-DNA containing a selectable marker gene into the virE2 mutant strain,
d) contacting plant cells with both strains; and
e) selecting plant cells or regenerated plants using the phenotype provided by the selectable marker gene product, and optionally,
f) crossing or selfing the selected plant to produce offspring, and optionally,
g) discarding offspring that contain the selectable marker gene and retaining offspring that contain the desired gene but lack the selectable marker gene.   2. The method of claim 1, wherein the virE2 donor strain comprises at least two virE2 genes, each encoding a functional virE2 protein.   The method according to claim 1 or 2, wherein the virE2 mutant strain contains an insertion in the virE2 gene and / or a part or all of the virE2 gene is deleted and / or replaced.   4. The method according to claim 3, wherein the virE2 mutant strain is a strain deposited under accession number CBS 121809, or a derivative thereof.   3. The method according to claim 2, wherein one virE2 gene is present in the Ti-plasmid and one virE2 gene is present in the helper plasmid.   The method according to any one of the preceding claims, wherein the T-DNAs are introduced into a DNA vector or plasmid, and the T-DNAs comprises at least a light border sequence.   The method according to any one of the preceding claims, wherein the ratio of the virE2 mutant strain to the virE2 donor strain is 1: 1, 1: 2, 1: 3, 1: 4, 1: 5. Or more.   A method according to any one of the preceding claims, wherein the cotransformation efficiency is at least 60%, preferably at least 80%, 90% or 100%.   An Agrobacterium strain that contains a DNA insertion in the virE2 gene and cannot produce a functional virE2 protein.   The strain according to claim 8, which is a strain deposited under accession number CBS 121809, or a derivative thereof.   Agrobacterium strains that contain T-DNA that does not have the ability to produce a functional virE2 protein and contains a selectable marker gene, together with the gene encoding the functional virE2 protein and the desired gene Use of an Agrobacterium strain containing T-DNA containing for co-transformation of plant cells and said two T-DNAs.   11. Use according to claim 10, wherein the endogenous virE2 gene comprises insertions, deletions and / or substitutions of all or part of the virE2 gene.   A co-transformation kit comprising a first and a second Agrobacterium strain, said first strain being functional virE2 due to insertion, deletion and / or substitution in the virE2 gene of said Ti-plasmid A kit that has no ability to produce a protein and wherein the second strain contains a gene encoding a functional virE2 protein.   13. The kit according to claim 12, wherein the second strain comprises at least two virE2 genes encoding a functional virE2 protein.

Images