CN103937908B - The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application - Google Patents
The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application Download PDFInfo
- Publication number
- CN103937908B CN103937908B CN201410121827.8A CN201410121827A CN103937908B CN 103937908 B CN103937908 B CN 103937908B CN 201410121827 A CN201410121827 A CN 201410121827A CN 103937908 B CN103937908 B CN 103937908B
- Authority
- CN
- China
- Prior art keywords
- csv
- spcsv
- pcr
- sweet potato
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of sweet potato chlorotic stunt virus West Africa strain real-time fluorescence quantitative PCR detection method and application, the method arranges as template with the nucleotides sequence of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA, design amplification SPCSV-WA? the Auele Specific Primer of <i>cp</iGreatT.G reaT.GT gene and specific C SV probe, extract the total serum IgE of susceptible Sweet Potato Leaf; With CSV-DL2 primed reverse transcription synthesis cDNA first chain, then with CSV-CP-P2 primed reverse transcription synthesis cDNA second chain, CSV-CP-P1 and reverse primer CSV-CP-P2 is utilized to carry out pcr amplification reaction; With SPCSV-WA<i>? the recombinant plasmid of cp</i> gene is positive criteria plasmid drawing standard curve; by optimizing reaction system and reaction conditions, establish the real-time fluorescence quantitative PCR detection method of SPCSV-WA.Result shows, the method can only detect object virus, and the slope of typical curve and relation conefficient are respectively-3.239 and 1, and amplification efficiency is 103.568%; The minimum positive plasmid about 3.31 copy/μ L being detected, remolding sensitivity Standard PCR is high 1000 times.Real time fluorescence quantifying PCR method of the present invention can be used for the detection of field Sweet Potato Samples, for the early warning of SPCSV and epidemiology research provide technique means.
Description
Technical field
The present invention relates to the method for detecting virus in technical field of bioengineering, particularly relate to a kind of sweet potato chlorotic stunt virus West Africa strain real-time fluorescence quantitative PCR detection method and application.
Background technology
Sweet potato chlorotic stunt virus (Sweetpotatochloroticstuntvirus, SPCSV) being Closteroviridae (Closteroviridae) Ampelo-virus (Crinivirus) virus, is one of main virus infecting sweet potato.SPCSV genome is two-pack single stranded positive-sense RNA, about size 17kb.According to serological relation and nucleotide sequence, SPCSV can be divided into East Africa (EA) and West Africa (WA) 2 strains, infects the mainly West Africa strain of China sweet potato at present.SPCSV and Sweet Potato Feathery Mottle Virus (Sweetpotatofeatherymottlevirus, SPFMV) infect sweet potato jointly, can cause the generation of sweet potato viruses disease (Sweetpotatovirusdisease, SPVD).
On yield of sweet potato impact greatly, can cause the production loss of more than 90% time serious, even have no harvest, be the destructive disease on sweet potato to SPVD.At present, all there is the occurrence and harm of SPCSV and SPVD in the main sweet potato producing region such as Guangdong, Jiangsu, Sichuan, Anhui, and this virus has the trend spreading and spread in China sweet potato producing region.The common method detected for sweet potato viruses is at present Enzyme-linked Immunosorbent Assay (ELISA) technology and round pcr.There is the problems such as sensitivity is low, poor specificity in elisa technique, and common PCR method can not carry out quantitative analysis to virus.In addition, owing to being rich in the materials such as colloid, polyphenol and polysaccharide in sweet potato plant body, these materials can disturb the Detection results of NCM-ELISA and conventional RT-PCR, cause the erroneous judgement of result.In order to overcome these interference, need first by Sweet Potato Samples grafting to be detected on plant indicator Brazilian morning-glory, after Brazilian morning-glory morbidity, then Brazilian morning-glory to be detected, wastes time and energy.
Real-time fluorescence quantitative PCR (real-timefluorescentquantitativePCR) technology is that a kind of novel nucleic acids grown up in recent years is qualitative, quantitative technique, existing regular-PCR is sensitive, feature fast, again can Real-Time Monitoring, be applied to the detection of various plants virus.There is no the research report of SPCSV real-time fluorescence quantitative PCR detection method at present, how to utilize Real-Time Fluorescent Quantitative PCR Technique, set up the detection technique of SPCSV efficient and sensible, strengthen the early monitoring early warning to SPCSV, significant to the prevention and control of SPVD.
Summary of the invention
The technical problem to be solved in the present invention: the real-time fluorescence quantitative PCR detection method that a kind of easy, quick, sensitive sweet potato chlorotic stunt virus West Africa strain is provided;
Present invention also offers PCR detection method and detect the application in sweet potato chlorotic stunt virus.
technical scheme of the present invention:
A real-time fluorescence quantitative PCR detection method for sweet potato chlorotic stunt virus West Africa strain, comprises the following steps:
(1) arrange as template with the nucleotides sequence of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA, design amplification SPCSV-WA
cpauele Specific Primer CSV-CP-P1 and CSV-CP-P2 of gene, at SPCSV-WA
cpgene internal design Auele Specific Primer CSV-DL1, CSV-DL2 and specific C SV probe, primer and the probe sequence of design are respectively:
CSV-CP-P1：ATGGCTGATAGCACTAAAGTCGA；
CSV-CP-P2：TCAACAGTGAAGACCTGTTCCAG；
CSV-DL1：5′-GACTCAGATTTGGAAACTAA-3′；
CSV-DL2：5′-TGGAGAATTGGAATATACTTG-3′；
CSV probe: FAM-5 '-AACTACAGTCCGAGTATGCGTCTC-3 '-BHQ1;
(2) extraction of viral RNA and RT-PCR
With pillar total serum IgE extraction agent box, extract the total serum IgE of susceptible Sweet Potato Leaf; With CSV-DL2 primed reverse transcription synthesis cDNA first chain, detect for real-time fluorescence quantitative PCR;
Then with second chain of CSV-CP-P2 primed reverse transcription synthesis cDNA, forward primer CSV-CP-P1 and reverse primer CSV-CP-P2 is utilized to carry out pcr amplification reaction, to obtain the standard plasmid DNA of SPCSV-WA;
(3) foundation of real time fluorescence quantifying PCR method
With the standard plasmid DNA of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA for template, fluorescent quantitative PCR reaction system is 20 μ L, comprises standard plasmid DNA profiling 2 μ L, premix enzyme PremixEx
taq tM10 μ L, ROXReferenceDye II 0.4 μ L, forward primer CSV-DL1 and reverse primer CSV-DL2 is respectively 0.4 μ L, CSV probe 0.4 μ L, and wherein the concentration of forward primer, reverse primer and probe is 10 μm of ol/L, supplies 20 μ L with sterilizing DEPC water; Set up the blank test not adding template simultaneously;
Fluorescent quantitative PCR response procedures is: 95 DEG C of denaturation 30s, 95 DEG C of sex change 5s, and 55 DEG C of annealing 30s, 72 DEG C extend 30s and gather fluorescence, totally 40 circulations.
Described standard plasmid DNA profiling is prepared by following methods: utilize conventional RT-PCR method to amplify the coat protein CP gene order of SPCSV-WA, this gene order total length 774bp; By CP gene clone on pMD19-T, after sequence verification is correct, obtain SPCSV-WA
cpthe recombinant plasmid of gene; By concentration and the purity of spectrophotometric determination recombinant plasmid, the copy number calculating recombinant plasmid according to Avogadro constant is 3.31 × 10
10copy/μ L, carry out 10 times of continuous gradient dilutions to recombinant plasmid, obtain the plasmid of 10 times of concentration differences, namely plasmid concentration is 10 of original concentration
-1~ 10
-10, as the DNA profiling of standard plasmid.
Reverse transcription reaction system during described CSV-DL2 primed reverse transcription synthesis cDNA the first chain is 10 μ L: comprise 2 μ L5 × M-MLVBuffer, 1 μ L concentration is the MgCl of 25mmol/L
2, the 1 μ L concentration dNTP mixture that is 10mmol/L, the 0.5 μ L concentration reverse primer CSV-DL2 that is 10 μm of ol/L, the 0.25 μ L concentration inhibitor that is 40U/ μ L, 0.5 μ L concentration be 200U/ μ L ThermoScript II M-MLV, the total serum IgE of 4.75 μ L Sweet Potato Leafs;
Reverse transcription reaction condition: 42 DEG C of reverse transcription 40min, 95 DEG C of 5min, 5 DEG C of 5min.
Described pcr amplification reaction system when utilizing forward primer CSV-CP-P1 and reverse primer CSV-CP-P2 to carry out pcr amplification reaction is 50 μ L,
Comprise: 10 ×
exTaqdamping fluid 5 μ L, 2.5mol/LdNTP mixture 2 μ L, concentration are the Ex that the forward primer CSV-CP-P1 of 10 μm of ol/L and each 1 μ L of reverse primer CSV-CP-P2, concentration are 5U/ μ L
taqarchaeal dna polymerase 0.25 μ L, makes template with 5 μ L reverse transcription products, supplements ddH
2o to reaction system to 50 μ L;
Pcr amplification reaction condition: 94 DEG C of sex change 1min, 56 DEG C of annealing 30s, 72 DEG C extend 1min, 35 circulations, and last 72 DEG C extend 10min; Amplified production is observed through 1.0% agarose gel electrophoresis, UVP gel imaging system and takes a picture, and obtains the standard plasmid DNA of SPCSV-WA.
After described fluorescent quantitative PCR reaction, the typical curve of the quantitative fluorescent PCR obtained is: Y=-3.239X+40.193.
Described PCR detection method is detecting the application in sweet potato chlorotic stunt virus.
Positive beneficial effect of the present invention:
(1) the present invention is with the conservative region of SPCSV-WA coat protein (CP) gene design Auele Specific Primer and probe, establishes the real time fluorescence quantifying PCR method detecting SPCSV-WA.The susceptibility that the method detects is high, and the minimum positive plasmid about 3.31 copy/μ L being detected is higher than conventional PCR method 1000 times, and high specificity, reproducible.The SPCSV-WA recall rate of the method to field sample is significantly higher than NCM-ELISA and conventional RT-PCR method, compensate for the deficiency of ELISA and normal PCR detection method to a certain extent.
(2) the present invention establishes the typical curve of fluorescent quantitative PCR detection method, and the slope of typical curve and relation conefficient are respectively-3.239 and 1, and amplification efficiency is 103.568%; The method can only detect object virus, and the virus of the single copy number of energy detection by quantitative, can be used as the efficient tool of sweet potato viruses Coupling effects research, have higher practical value.
(3) PCR detection method of the present invention can be used for the detection of field Sweet Potato Samples, provides technique means to the early monitoring early warning and epidemiology research strengthening SPCSV, significant to the prevention and control of SPVD.
Accompanying drawing explanation
Fig. 1 SPCSV-WACP gene RT-PCR amplification;
In figure, M:DL2000 molecular weight marker; 1-2:SPCSV-WACP; 3: blank;
Fig. 2 SPCSV fluorescent quantitative PCR kinetic curve;
In figure, 1 ~ 6: template amount is followed successively by 3.31 × 10
8, 3.31 × 10
7, 3.31 × 10
6, 3.31 × 10
5, 3.31 × 10
4, 3.31 × 10
3copies μ L
-1; 7: blank;
The typical curve of Fig. 3 SPCSV quantitative fluorescent PCR;
The amplification curve of Fig. 4 quantitative fluorescent PCR susceptibility test;
In figure 1 ~ 10: template amount is followed successively by 3.31 × 10
9~ 3.31 × 10
0copies μ L
-1; 11: blank;
Fig. 5 Standard PCR sensitivity test;
M:DL2000 in figure; 1 ~ 10: template amount is followed successively by 3.31 × 10
9~ 3.31 × 10
0copies μ L
-1; 11: blank;
The amplification curve of Fig. 6 quantitative fluorescent PCR specific test;
In figure 1: standard substance (positive control); 2: containing the recombinant plasmid of SPFMVCP gene; 3: containing the recombinant plasmid of SPVGCP gene;
4: containing the recombinant plasmid of SPLVCP gene; 5: containing the recombinant plasmid of SPVMVCP gene; 6: blank.
Embodiment
Embodiment 1: the real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain
1 materials and methods
1.1 plasmids and sweet potato viruses material
Respectively containing Sweet Potato Feathery Mottle Virus (Sweetpotatofeatherymottlevirus, SPFMV), sweet potato cryptovirus (Sweetpotatolatentvirus, SPLV), sweet potato G virus (SweetpotatovirusG, SPVG), sweet potato vein mosaic virus (Sweetpotatoveinmosaicvirus, SPVMV) four kinds of recombinant plasmids of coat protein (CP) gene, for the specific assay of quantitative fluorescent PCR, these 4 kinds of recombinant plasmids build by this laboratory and preserve;
Respectively in Zhejiang, Sichuan, the ground collection such as Jiangsu have the Sweet potato stem of typical SPVD symptom, plant in insect protected greenhouse, for the comparison of nitrocellulose filter enzyme-linked immunosorbent assay (NCM-ELISA), conventional RT-PCR and real-time fluorescence quantitative PCR three kinds of method Detection results.
Main agents and instrument
SPCSV nitrocellulose filter enzyme-linked immunosorbent assay (NCM-ELISA) detection kit, purchased from International Potato Center (CIP); UNIQ-10 pillar total serum IgE extraction agent box is Shanghai Sheng Gong bio-engineering corporation product; RNase inhibitor, M-MLV ThermoScript II, Taq DNA polymerase, PremixExTaqTM premix enzyme, purchased from the precious biotech company in Dalian, other reagent is domestic analytical pure.
ABI7500 type quantitative real time PCR Instrument, NanoVuePLUS ultramicrospectrophotometer is U.S. GE Products; DNA sequencing is completed by Shanghai Sheng Gong bio-engineering corporation.
The design of primer and probe and synthesis
According to the SPCSV nucleotide sequence logged in GenBank (accession number: FJ807785), Auele Specific Primer CSV-CP-P1 and CSV-CP-P2 of design amplification SPCSV-WAcp gene.Design a pair Auele Specific Primer CSV-DL1, CSV-DL2 and a specific probe at SPCSV-WAcp gene internal, detect SPCSV for fluorescent quantitation, primer and probe are by the synthesis of the precious biotech company in Dalian, and its sequence is in table 1.
Table 1 primer and probe sequence
Wherein F: upstream primer; R: downstream primer.
The extraction of viral RNA and RT-PCR
With the UNIQ-10 pillar total serum IgE extraction agent box of Shanghai Sheng Gong bio-engineering corporation, extract the total serum IgE of susceptible Sweet Potato Leaf; With CSV-DL2 primed reverse transcription synthesis cDNA first chain, detect for real-time fluorescence quantitative PCR; Then with CSV-CP-P2 primed reverse transcription synthesis cDNA first chain, forward primer CSV-CP-P1 is utilized to carry out pcr amplification.
Reverse transcription reaction system is 10 μ L: comprise 2 μ L5 × M-MLVBuffer, 1 μ L concentration is the MgCl of 25mmol/L
2, 1 μ L concentration is respectively the ThermoScript II M-MLV that the dNTP mixture of 10mmol/L, the 0.5 μ L concentration reverse primer CSV-CP-P2 that is 10 μm of ol/L, the 0.25 μ L concentration inhibitor that is 40U/ μ L, 0.5 μ L concentration are 200U/ μ L, the total serum IgE of 4.75 μ L Sweet Potato Leafs;
Reverse transcription reaction condition: 42 DEG C of reverse transcription 40min, 95 DEG C of 5min, 5 DEG C of 5min.
Pcr amplification reaction system is 50 μ L, comprising: 10 × ExTaq damping fluid is (containing MgCl
2) 5 μ L, 2.5mol/LdNTP mixture 2 μ L, concentration is forward primer (CSV-CP-P1) and each 1 μ L, ExTaqDNA polysaccharase (5U/ μ L) of reverse primer (CSV-CP-P2) the 0.25 μ L of 10 μm of ol/L, make template with 5 μ L reverse transcription products, supplement ddH
2o to reaction system to 50 μ L.
PCR reaction conditions: 94 DEG C of sex change 1min, 56 DEG C of annealing 30s, 72 DEG C extend 1min, 35 circulations; Last 72 DEG C extend 10min; Amplified production is through 1.0% agarose gel electrophoresis, and UVP gel imaging system is observed and taken a picture, and obtains the standard plasmid DNA of SPCSV-WA.
The foundation of fluorescence quantifying PCR method
1.5.1 the preparation of standard plasmid utilizes RT-PCR method to amplify the cp gene of SPCSV-WA, the PCR primer after purifying is connected with pMD19-T carrier, transformation of E. coli TG1, extracts plasmid.The recombinant plasmid of SPCSV-WAcp gene is obtained after sequence verification is correct.By concentration and the purity of spectrophotometric determination recombinant plasmid, calculate the copy number of plasmid according to Avogadro constant.
The cp gene fragment of the SPCSV-WA that amplification obtains, size and expection identical (Fig. 1), its gene order is see SEQIDNo.1.By cp gene clone on pMD19-T, obtain recombinant plasmid, through sequential analysis checking, SPCSV-WAcp full length gene is 774bp.Measuring its concentration with spectrophotometric is 125.8ng/ μ L, and A260/A280 ratio is 1.86, and purity meets the requirement of quantitative fluorescent PCR standard substance, and being converted into copy number is 3.31 × 10
10copy/μ L.
The determination of reaction system and cycling condition with SPCSV-WAcp standard plasmid DNA for template, by primer concentration in the scope of 0.1 ~ 0.4 μm of ol/L with the increasing concen-trations of 0.1 μm of ol/L, concentration and probe concentration increases progressively with 0.1 μm of ol/L in the scope of 0.1 ~ 0.5 μm of ol/L, the optimum concn of screening primer and probe.After obtaining optimal reaction system, adopt three warm Recycle design, be optimized quantitative fluorescent PCR annealing temperature, annealing temperature is set to 49 DEG C, 52 DEG C, 55 DEG C, 58 DEG C and 61 DEG C of five gradient process respectively.
Result shows, with 3.31 × 10
6the dilution standard plasmid DNA of copies/ μ L is template, and upstream and downstream primer final concentration is 0.3 μm of ol/L, probe final concentration is 0.3 μm of ol/L, minimum Ct value and higher fluorescence intensity increased value (Δ Rn) can be detected.
Pcr amplification reaction system after optimization is always 20 μ L, comprises standard plasmid DNA profiling 2 μ L, premix enzyme PremixExTaq
tM(ProbeqPCR) 10 μ L, quantitative fluorescent PCR reference dye ROXDyeII (50 ×) 0.4 μ L, it is respectively 0.4 μ L that concentration is the forward primer CSV-DL1 of 10 μm of ol/L and reverse primer CSV-DL2, concentration is the probe 0.4 μ L of 10 μm of ol/L, supplies 20 μ L with sterilizing DEPC water;
Amplified reaction program is: 95 DEG C of denaturation 30s, 95 DEG C of sex change 5s, and 55 DEG C of annealing 30s, 72 DEG C extend 30s and gather fluorescence, totally 40 circulations.
The foundation of typical curve
Use the standard plasmid DNA (3.31 × 10 of 10 times of serial dilutions
3~ 3.31 × 10
8copies/ μ L) be template, carry out fluorescent quantitative PCR.After reaction terminates, system software automatic analysis obtains amplification curve and the typical curve of quantitative fluorescent PCR.Typical curve is: Y=-3.239X+40.193, and amplification efficiency is 103.568%, and relation conefficient is 1.Can find out, in standard substance curve, between Ct value and standard plasmid concentration, present good linear relationship (see Fig. 2, Fig. 3).
. result and analysis
The sensitivity of 2.1 quantitative fluorescent PCRs
With 10 gradient standard plasmid DNA (10
-1~ 0
-10) be template, carry out Standard PCR and fluorescence quantitative PCR detection, compare the sensitivity of two kinds of detection methods.
Respectively to the dilution standard plasmid DNA (3.31 × 10 of difference
9~ 3.31 × 10
0copy/μ L) increase, in fluorescence quantifying PCR method of the present invention, when standard plasmid concentration is 3.31 × 10
0still have fluorescence curve (Fig. 4) during copy/μ L, show that detection sensitivity can reach 3.31 × 10
0copies/ μ L; Conventional PCR method is minimum only can detect 3.31 × 10
3copy/μ L (Fig. 5), the remolding sensitivity conventional PCR method that the present invention detects SPCSV-WA is high 1000 times.
The specific test of fluorescence quantifying PCR method
For verifying the specificity of fluorescence quantifying PCR method of the present invention, with 3.31 × 10
3the plasmid of copy/μ L is template, simultaneously using the recombinant plasmid respectively containing SPFMV, SPVG, SPLV and SPVMVcp gene as detected object.Result shows that effective amplification fluorescent signal does not all appear in SPFMV, SPVG, SPLV, SPVMV in reaction process, SPCSV-WA then has the kinetic curve (Fig. 6) that well increases, and shows that fluorescence quantifying PCR method of the present invention has good specificity.
The replica test of fluorescence quantifying PCR method
With 3.31 × 10
3~ 3.31 × 10
8the dilution standard plasmid DNA of copies/ μ L carries out real-time fluorescence quantitative PCR reaction, and in same test, each dilution standard plasmid establishes 3 repetitions.In group, replica test result shows, the variation coefficient of 6 different extent of dilution standard plasmid Ct values is 0.18% ~ 1.62% (table 2); Again with identical standard plasmid for template carries out 3 independently revision tests.Result shows, between-group variation coefficient (table 3) between 0.08% ~ 0.99%, illustrate the repeatability of fluorescence quantifying PCR method of the present invention and stability better.
Replica test result in the group of table 2 real time quantitative PCR method detection SPCSV
Replica test result between the group of table 3 real time quantitative PCR method detection SPCSV
The qualification of 2.4 fluorescent quantitative PCR products
For verifying the object fragment nucleotide sequence that fluorescent quantitative PCR goes out further, the fluorescent quantitative PCR product of random selecting sample segment carries out cloning and sequencing, utilizes DNAMAN and BLAST to compare analysis to checked order row.Result shows, in the nucleotide sequence of the object fragment amplified and GenBank, SPCSV-WA nucleotide sequence identity reaches 97% ~ 99%, and the specific fragment of virus for the purpose of the fragment that amplifies all is described.
The Preliminary Applications of quantitative fluorescent PCR
Utilize NCM-ELISA, conventional RT-PCR and real time fluorescence quantifying PCR method of the present invention, the 9 parts of sweet potato Plant samples with typical SPVD symptom picking up from the ground such as China Sichuan, Jiangsu are detected.
Result shows, NCM-ELISA detects that two increment product are that SPCSV is positive, conventional RT-PCR detects that six increment product are that SPCSV is positive, the real time fluorescence quantifying PCR method detection increment product coldest days of the year end of the present invention, all in the SPCSV positive (table 4), illustrate that real time fluorescence quantifying PCR method detects the sensitivity of field sample apparently higher than NCM-ELISA and conventional RT-PCR method.
The comparison of table 4 three kinds of detection method results
Note: in table, "-" represents positive; "-" represents negative.
SEQUENCELISTING
<110> Inst. of Plant Protection, Henan Prov. Academy of Agricultural Sciences
The real-time fluorescence quantitative PCR detection method of <120> sweet potato chlorotic stunt virus West Africa strain and application
<130> Real-Time Fluorescent Quantitative PCR Technique
<160>6
<170>PatentInversion3.4
<210>1
<211>774
<212>DNA
<213> artificial sequence
<400>1
atggctgatagcactaaagtcgaagagaagaactttgattctgactcagatttggaaact60
aacccaaagaataaactacagtccgagtatgcgtctcgtcgtgacgtccagactgaagga120
acggctagtttgggaagacgagatatggagttaactagtggtattcttacctcagaccag180
ttagctcttgcaagattgggtaagatccaagtatattccaattctccagatattatgtca240
aagagtcaagaggatgagtttaagcgtcatatggagaacttcgcaaaagtcgtgactggt300
gaggctacaataacgccagaaatttttgcagcgttttatgcatcgttaattcaggcatgg360
gcaaatcagagtacgtccgaaaagaatgcttcgaacgtaaatcttgagaatatgtttatg420
gtcgacgggaaagagtatagttggaagactcacaacttcataaaccatattcaatctaac480
atgccagatgttaagaacgccataaggaagtgggcaagggctcatgcaaatgattacaag540
gtccttgttggtatgggtattgttaaacccgattaccatttgcaggcgaaacagggtgtc600
ttacctgaatattggcatttggccactgatttcatgagaggtaatgatttggcgacaacc660
gcagatgggctggctgcgactttgatgatgaaaaggaacgctctttgtaacaaggataat720
aagaattctgtctacaacgttactcagttgactggaacaggtcttcactgttga774
<210>2
<211>23
<212>DNA
<213> artificial sequence
<400>2
atggctgatagcactaaagtcga23
<210>3
<211>23
<212>DNA
<213> artificial sequence
<400>3
tcaacagtgaagacctgttccag23
<210>4
<211>20
<212>DNA
<213> artificial sequence
<400>4
gactcagatttggaaactaa20
<210>5
<211>21
<212>DNA
<213> artificial sequence
<400>5
tggagaattggaatatacttg21
<210>6
<211>24
<212>DNA
<213> artificial sequence
<400>6
aactacagtccgagtatgcgtctc24
Claims (6)
1. a real-time fluorescence quantitative PCR detection method for sweet potato chlorotic stunt virus West Africa strain, is characterized in that, the method comprises the following steps:
(1) arrange as template with the nucleotides sequence of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA, design amplification SPCSV-WA
cpauele Specific Primer CSV-CP-P1 and CSV-CP-P2 of gene, at SPCSV-WA
cpgene internal design Auele Specific Primer CSV-DL1, CSV-DL2 and specific C SV probe, primer and the probe sequence of design are respectively:
CSV-CP-P1：ATGGCTGATAGCACTAAAGTCGA；
CSV-CP-P2：TCAACAGTGAAGACCTGTTCCAG；
CSV-DL1：5′-GACTCAGATTTGGAAACTAA-3′；
CSV-DL2：5′-TGGAGAATTGGAATATACTTG-3′；
CSV probe: FAM-5 '-AACTACAGTCCGAGTATGCGTCTC-3 '-BHQ1;
(2) extraction of viral RNA and RT-PCR
With pillar total serum IgE extraction agent box, extract the total serum IgE of susceptible Sweet Potato Leaf; With CSV-DL2 primed reverse transcription synthesis cDNA first chain, detect for real-time fluorescence quantitative PCR;
Then with second chain of CSV-CP-P2 primed reverse transcription synthesis cDNA, forward primer CSV-CP-P1 and reverse primer CSV-CP-P2 is utilized to carry out pcr amplification reaction, to obtain the standard plasmid DNA of SPCSV-WA;
(3) foundation of real time fluorescence quantifying PCR method
With the standard plasmid DNA of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA for template, fluorescent quantitative PCR reaction system is 20 μ L, comprises standard plasmid DNA profiling 2 μ L, premix enzyme PremixEx
taq tM10 μ L, ROXReferenceDye II 0.4 μ L, forward primer CSV-DL1 and reverse primer CSV-DL2 is respectively 0.4 μ L, CSV probe 0.4 μ L, and wherein the concentration of forward primer, reverse primer and probe is 10 μm of ol/L, supplies 20 μ L with sterilizing DEPC water; Set up the blank test not adding template simultaneously;
Fluorescent quantitative PCR response procedures is: 95 DEG C of denaturation 30s, 95 DEG C of sex change 5s, and 55 DEG C of annealing 30s, 72 DEG C extend 30s and gather fluorescence, totally 40 circulations.
2. real-time fluorescence quantitative PCR detection method as claimed in claim 1, it is characterized in that: described standard plasmid DNA profiling is prepared by following methods: utilize conventional RT-PCR method to amplify the coat protein CP gene order of SPCSV-WA, this gene order total length 774bp; By CP gene clone on pMD19-T, after sequence verification is correct, obtain SPCSV-WA
cpthe recombinant plasmid of gene; By concentration and the purity of spectrophotometric determination recombinant plasmid, the copy number calculating recombinant plasmid according to Avogadro constant is 3.31 × 10
10copy/μ L, carry out 10 times of continuous gradient dilutions to recombinant plasmid, obtain the plasmid of 10 times of concentration differences, namely plasmid concentration is 10 of original concentration
-1~ 10
-10, as the DNA profiling of standard plasmid.
3. real-time fluorescence quantitative PCR detection method as claimed in claim 1, is characterized in that: reverse transcription reaction system during described CSV-DL2 primed reverse transcription synthesis cDNA the first chain is 10 μ L: comprise 2 μ L5 × M-MLVBuffer, 1 μ L concentration is the MgCl of 25mmol/L
2, the 1 μ L concentration dNTP mixture that is 10mmol/L, the 0.5 μ L concentration reverse primer CSV-DL2 that is 10 μm of ol/L, the 0.25 μ L concentration inhibitor that is 40U/ μ L, 0.5 μ L concentration be 200U/ μ L ThermoScript II M-MLV, the total serum IgE of 4.75 μ L Sweet Potato Leafs;
Reverse transcription reaction condition: 42 DEG C of reverse transcription 40min, 95 DEG C of 5min, 5 DEG C of 5min.
4. the real-time fluorescence quantitative PCR detection method as described in any one of claim 1-3, is characterized in that: described pcr amplification reaction system when utilizing forward primer CSV-CP-P1 and reverse primer CSV-CP-P2 to carry out pcr amplification reaction is 50 μ L, comprising: 10 ×
exTaqdamping fluid 5 μ L, 2.5mol/LdNTP mixture 2 μ L, concentration are the Ex that the forward primer CSV-CP-P1 of 10 μm of ol/L and each 1 μ L of reverse primer CSV-CP-P2, concentration are 5U/ μ L
taqarchaeal dna polymerase 0.25 μ L, makes template with 5 μ L reverse transcription products, supplements ddH
2o to reaction system to 50 μ L;
Pcr amplification reaction condition: 94 DEG C of sex change 1min, 56 DEG C of annealing 30s, 72 DEG C extend 1min, 35 circulations, and last 72 DEG C extend 10min; Amplified production is observed through 1.0% agarose gel electrophoresis, UVP gel imaging system and takes a picture, and obtains the standard plasmid DNA of SPCSV-WA.
5. PCR detection method as claimed in claim 4, is characterized in that: after described fluorescent quantitative PCR reaction, the typical curve of the quantitative fluorescent PCR obtained is: Y=-3.239X+40.193.
6. the PCR detection method described in any one of claim 1-5 is detecting the application in sweet potato chlorotic stunt virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410121827.8A CN103937908B (en) | 2014-03-28 | 2014-03-28 | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410121827.8A CN103937908B (en) | 2014-03-28 | 2014-03-28 | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103937908A CN103937908A (en) | 2014-07-23 |
| CN103937908B true CN103937908B (en) | 2016-04-06 |
Family
ID=51185773
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410121827.8A Active CN103937908B (en) | 2014-03-28 | 2014-03-28 | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937908B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755579B (en) * | 2016-12-28 | 2018-08-17 | 河南省农业科学院植物保护研究所 | The detection of the multiplex PCR of sweet potato chlorotic stunt virus and sweet potato geminivirus infection and method for early warning in a kind of sweet potato root tuber |
| CN107360906A (en) * | 2017-08-04 | 2017-11-21 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of method for mitigating sweet potato SPVD harm |
| CN107385117B (en) * | 2017-09-20 | 2021-08-10 | 湖南省作物研究所 | Detection method for composite virus disease (SPVD) pathogen of sweet potato seed |
| CN113897462A (en) * | 2021-11-18 | 2022-01-07 | 中国科学院昆明植物研究所 | Primer and method for quantitatively detecting turnip mosaic virus in myosotis sylvatica |
-
2014
- 2014-03-28 CN CN201410121827.8A patent/CN103937908B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Real-Time PCR Assays for Detection and Quantification of Sweetpotato Viruses;Kokkinos C D等;《Plant Disease》;20060630;第90卷(第6期);第783-788页 * |
| 甘薯羽状斑驳病毒实时荧光定量PCR检测方法的建立;王丽等;《沈阳农业大学学报》;20130430;第44卷(第2期);第129-135页 * |
| 甘薯褪绿矮化病毒西非株系RT-LAMP检测方法的建立;乔奇等;《中国农业科学》;20131231;第46卷(第18期);摘要、第3940页右栏第1.1.3节内容 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103937908A (en) | 2014-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103937908B (en) | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application | |
| CN102634593B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
| CN104120193A (en) | Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus | |
| CN102634591B (en) | Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof | |
| CN102634588B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof | |
| CN111363856B (en) | Method for simultaneously detecting four tomato viruses by multiple RT-PCR | |
| CN102559928A (en) | Specific primer group, kit comprising the primer group, use method and detection method | |
| CN101225435A (en) | Method for quickly detecting transgenic soybean | |
| CN107805675A (en) | A kind of Potato viruses detection kit | |
| CN101824411A (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
| CN103498010B (en) | Primer and kit for rapidly detecting tomato chlorosis virus (ToCV) and application thereof | |
| CN102796825B (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| CN102653798A (en) | Fluorescent PCR (polymerase chain reaction) detection method for identifying traditional strain and highly pathogenic strain of PRRSV (porcine reproductive and respiratory syndrome virus) | |
| CN106048095A (en) | Primer group and kit for synchronously detecting three RNA viruses infecting melons, and application of primer group and kit | |
| CN103789433B (en) | Specific molecular marker for detecting structural gene IPS1 of rice spikes and detection method thereof | |
| CN109943666A (en) | A kind of the multiple PCR primer group and its application of the main virus of detection tomato | |
| CN102559854A (en) | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular | |
| CN102286624B (en) | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite | |
| CN104404173A (en) | NASBA method for detecting tomato spotted wilt virus | |
| CN102690896B (en) | Kit for detecting narcissus mosaic virus and narcissus yellow stripe virus and detection method of kit | |
| CN104561313B (en) | The internal standard gene of a kind of applicable Semen Sesami copy number of foreign gene detection and construction method and application | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN102417934A (en) | Primers, TaqMan probe and kit used for detecting tomato yellow leaf curl virus | |
| CN102634592A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof | |
| CN112280906A (en) | DPO-PCR primer pair for detecting arabis mosaic virus and bean pod mottle virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |