CN103937908A - Real-time fluorescence quantitative PCR detection method of West African strain of sweet potato chlorotic stunt virus and application - Google Patents
Real-time fluorescence quantitative PCR detection method of West African strain of sweet potato chlorotic stunt virus and application Download PDFInfo
- Publication number
- CN103937908A CN103937908A CN201410121827.8A CN201410121827A CN103937908A CN 103937908 A CN103937908 A CN 103937908A CN 201410121827 A CN201410121827 A CN 201410121827A CN 103937908 A CN103937908 A CN 103937908A
- Authority
- CN
- China
- Prior art keywords
- csv
- spcsv
- sweet potato
- primer
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a real-time fluorescence quantitative PCR detection method of a West African strain of sweet potato chlorotic stunt virus (SPCSV) and an application. The method comprises the following steps: taking a nucleotide sequence of the West African strain SPCSV-WA of the sweet potato chlorotic stunt virus as a template, designing specific primers and a specific CSV probe for amplifying SPCSV-WA cp genes, and extracting total RNA from leaves of a sweet potato infected by the virus; performing reverse transcription with the CSV-DL2 primer to synthesize a cDNA first chain, then performing reverse transcription with the CSV-CP-P2 primer to synthesize the cDNA first chain, and performing PCR amplification reaction with the CSV-CP-P1; establishing the real-time fluorescence quantitative PCR detection method of the SPCSV-WA by optimizing reaction conditions. The results show that at least about 3.31 copies/mu L of positive plasmids can be detected by the method, and the sensitivity is high. The method provided by the invention can be used for detecting sweet potato samples in fields and thus provides a technical means for early warning and epidemiological research of the SPCSV.
Description
Technical field
The present invention relates to the method for detecting virus in technical field of bioengineering, particularly relate to a kind of sweet potato chlorotic stunt virus West Africa strain real-time fluorescence quantitative PCR detection method and application.
Background technology
Sweet potato chlorotic stunt virus (Sweet potato chlorotic stunt virus, SPCSV) being Closteroviridae (Closteroviridae) Ampelo-virus (Crinivirus) virus, is one of main virus infecting sweet potato.SPCSV genome is two-pack strand justice RNA, big or small 17kb left and right.According to serological relation and nucleotide sequence, SPCSV can be divided into East Africa (EA) and West Africa (WA) 2 strains, and what infect at present China sweet potato is mainly West Africa strain.SPCSV and Sweet Potato Feathery Mottle Virus (Sweetpotato featherymottle virus, SPFMV) infect sweet potato jointly, can cause the generation of sweet potato viruses disease (Sweet potato virus disease, SPVD).
SPVD on yield of sweet potato impact greatly, can cause more than 90% production loss when serious, and even total crop failure, is the destructive disease on sweet potato.At present, all there are the occurrence and harm of SPCSV and SPVD, this virus has diffusion to spread trend in China sweet potato producing region in the main sweet potato producing region such as Guangdong, Jiangsu, Sichuan, Anhui.The common method detecting for sweet potato viruses is at present Enzyme-linked Immunosorbent Assay (ELISA) technology and round pcr.There is the problems such as sensitivity is low, poor specificity in elisa technique, and common PCR method can not be carried out quantitative analysis to virus.In addition, owing to being rich in the materials such as colloid, polyphenol and polysaccharide in sweet potato plant body, these materials can disturb the detection effect of NCM-ELISA and conventional RT-PCR, cause the erroneous judgement of result.Disturb in order to overcome these, need first Sweet Potato Samples grafting to be detected, to plant indicator Brazilian morning-glory, after Brazilian morning-glory morbidity, then Brazilian morning-glory to be detected, waste time and energy.
Real-time fluorescence quantitative PCR (real-time fluorescent quantitative PCR) technology is that a kind of novel nucleic acids growing up is in recent years qualitative, quantitative technique, existing regular-PCR is sensitive, feature fast, again can Real-Time Monitoring, be applied to the detection of various plants virus.How the research report that there is no at present SPCSV real-time fluorescence quantitative PCR detection method, utilize Real-Time Fluorescent Quantitative PCR Technique, sets up the detection technique of SPCSV efficient and sensible, strengthens the early monitoring early warning to SPCSV, significant to the prevention and control of SPVD.
Summary of the invention
The technical problem to be solved in the present invention: the real-time fluorescence quantitative PCR detection method that a kind of easy, quick, sensitive sweet potato chlorotic stunt virus West Africa strain is provided;
The present invention also provides PCR detection method in the application detecting in sweet potato chlorotic stunt virus.
Technical scheme of the present invention:
A real-time fluorescence quantitative PCR detection method for sweet potato chlorotic stunt virus West Africa strain, comprises the following steps:
(1) classify template as with the nucleotides sequence of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA, Auele Specific Primer CSV-CP-P1 and the CSV-CP-P2 of design amplification SPCSV-WA cp gene, at SPCSV-WA cp gene indoor design Auele Specific Primer CSV-DL1, CSV-DL2 and specific C SV probe, primer and the probe sequence of design are respectively:
CSV-CP-P1：ATGGCTGATAGCACTAAAGTCGA；
CSV-CP-P2：TCAACAGTGAAGACCTGTTCCAG；
C SV-DL1：5′-GACTCAGATTTGGAAACTAA-3′：
CSV-DL2：5′-TGGAGAATTGGAATATACTTG-3′：
CSV probe: FAM-5 '-AACTACAGTCCGAGTATGCGTCTC-3 '-BHQ1;
(2) extraction of viral RNA and RT-PCR
With the total RNA extraction agent of pillar box, extract total RNA of susceptible Sweet Potato Leaf; With synthetic cDNA the first chain of CSV-DL2 primer reverse transcription, detect for real-time fluorescence quantitative PCR;
Then with synthetic cDNA the first chain of CSV-CP-P2 primer reverse transcription, utilize forward primer CSV-CP-P1 to carry out pcr amplification reaction, to obtain the standard plasmid DNA of SPCSV-WA;
(3) foundation of real time fluorescence quantifying PCR method
Taking the standard plasmid DNA of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA as template, fluorescent quantitative PCR reaction system is 20 μ L, comprises standard plasmid DNA profiling 2 μ L, premix enzyme Premix Ex Taq
tM10 μ L, ROX Reference Dye II0.4 μ L, forward primer CSV-DL1 and reverse primer CSV-DL2 are respectively 0.4 μ L, CSV probe 0.4 μ L, wherein the concentration of forward primer, reverse primer and probe is 10 μ mol/L, supplies 20 μ L with sterilizing DEPC water; Set up the blank test that does not add template simultaneously;
Fluorescent quantitative PCR response procedures is: 95 DEG C of denaturation 30s, and 95 DEG C of sex change 5s, 55 DEG C of annealing 30s, 72 DEG C are extended 30s and gather fluorescence, totally 40 circulations.
Described standard plasmid DNA profiling is prepared by following methods: utilize conventional RT-PCR method to amplify the coat protein CP gene order of SPCSV-WA, this gene order total length 774bp; By CP gene clone to pMD19-T above, after sequence verification is correct, obtain the recombinant plasmid of SPCSV-WAcp gene; By concentration and the purity of spectrophotometric determination recombinant plasmid, the copy number that calculates recombinant plasmid according to Avogadro constant is 3.31 × 10
10copy/μ L, carries out 10 times of continuous gradient dilutions to recombinant plasmid, obtains the plasmid of 10 times of concentration differences, and plasmid concentration is 10
-1～10
-10, as the DNA profiling of standard plasmid.
Described reverse transcription reaction system during with synthetic cDNA the first chain of CSV-DL2 primer reverse transcription is 10 μ L: comprise the MgCl that 2 μ L5 × M-MLV Buffer, 1 μ L concentration are 25mmol/L
2, the dNTP mixture that 1 μ L concentration is 10mmol/L, the reverse primer CSV-DL2 that 0.5 μ L concentration is 10 μ mol/L, inhibitor, the 0.5 μ L concentration that 0.25 μ L concentration is 40U/ μ L be the ThermoScript II M-MLV of 200U/ μ L, total RNA of 4.75 μ L Sweet Potato Leafs;
Reverse transcription reaction condition: 42 DEG C of reverse transcription 40min, 95 DEG C of 5min, 5 DEG C of 5min.
Described pcr amplification reaction system while utilizing forward primer CSV-CP-P1 to carry out pcr amplification reaction is 50 μ L, comprise: forward primer CSV-CP-P1 and the each 1 μ L of reverse primer CSV-CP-P2, concentration that 10 × ExTaq damping fluid, 5 μ L, 2.5mol/L dNTP mixture 2 μ L, concentration are 10 μ mol/L are the ExTaqDNA polysaccharase 0.25 μ L of 5U/ μ L, make template with 5 μ L reverse transcription products, supplement ddH
2o is to reaction system to 50 μ L;
Pcr amplification reaction condition: 94 DEG C of sex change 1min, 56 DEG C of annealing 30s, 72 DEG C are extended 1min, 35 circulations, last 72 DEG C are extended 10min; Amplified production is observed and takes a picture through 1.0% agarose gel electrophoresis, UVP gel imaging system, obtains the standard plasmid DNA of SPCSV-WA.
After described fluorescent quantitative PCR reaction, the typical curve of the quantitative fluorescent PCR obtaining is: Y=-3.239X+40.193.
Described PCR detection method is in the application detecting in sweet potato chlorotic stunt virus.
Positive beneficial effect of the present invention:
(1) the present invention, with conservative region design Auele Specific Primer and the probe of SPCSV-WA coat protein (CP) gene, has set up the real time fluorescence quantifying PCR method that detects SPCSV-WA.The susceptibility that the method detects is high, and the minimum positive plasmid that approximately 3.31 copy/μ L detected is higher 1000 times than conventional PCR method, and high specificity, reproducible.The method is significantly higher than NCM-ELISA and conventional RT-PCR method to the SPCSV-WA recall rate of field sample, has made up to a certain extent the deficiency of ELISA and normal PCR detection method.
(2) the present invention has set up the typical curve of fluorescent quantitative PCR detection method, and slope and the relation conefficient of typical curve are respectively-3.239 and 1, and amplification efficiency is 103.568%; The method can only detect object virus, can detection by quantitative the virus of single copy number, can be used as sweet potato viruses and do mutually the efficient tool of Mechanism Study, there is higher practical value.
(3) PCR detection method of the present invention can be used for the detection of field Sweet Potato Samples, provides technique means to early monitoring early warning and the epidemiology research of strengthening SPCSV, significant to the prevention and control of SPVD.
Brief description of the drawings
Fig. 1 SPCSV-WA CP gene RT-PCR amplification;
In figure, M:DL2000 molecular weight marker; 1-2:SPCSV-WA CP; 3: blank;
Fig. 2 SPCSV fluorescent quantitative PCR kinetic curve;
In figure, 1～6: template amount is followed successively by 3.31 × 10
8, 3.31 × 10
7, 3.31 × 10
6, 3.31 × 10
5, 3.31 × 10
4, 3.31 × 10
3copies μ L
-1; 7: blank;
The typical curve of Fig. 3 SPCSV quantitative fluorescent PCR;
The amplification curve of Fig. 4 quantitative fluorescent PCR susceptibility test;
In figure 1～10: template amount is followed successively by 3.31 × 10
9～3.31 × 10
0copies μ L
-1; 11: blank;
The conventional PCR sensitivity test of Fig. 5;
M:DL2000 in figure; 1～10: template amount is followed successively by 3.31 × 10
9～3.31 × 10
0copies μ L
-1; 11: blank;
The amplification curve of Fig. 6 quantitative fluorescent PCR specific test;
In figure 1: standard substance (positive control); 2: containing the recombinant plasmid of SPFMV CP gene; 3: containing the recombinant plasmid of SPVG CP gene;
4: containing the recombinant plasmid of SPLV CP gene; 5: containing the recombinant plasmid of SPVMV CP gene; 6: blank.
Embodiment
Embodiment 1: the real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain
1 materials and methods
1.1 plasmids and sweet potato viruses material
Contain respectively Sweet Potato Feathery Mottle Virus (Sweet potato feathery mottle virus, SPFMV), sweet potato cryptovirus (Sweet potato latent virus, SPLV), sweet potato G virus (Sweet potato virus G, SPVG), sweet potato vein mosaic virus (Sweetpotato vein mosaic virus, SPVMV) four kinds of recombinant plasmids of coat protein (CP) gene, for the specificity inspection of quantitative fluorescent PCR, these 4 kinds of recombinant plasmids build and preserve by this laboratory;
Respectively in Zhejiang, that the ground collection such as Sichuan, Jiangsu has the Sweet Potato of typical SPVD symptom is climing, plant in insect protected greenhouse, detect the comparison of effect for nitrocellulose filter enzyme-linked immunosorbent assay (NCM-ELISA), conventional RT-PCR and three kinds of methods of real-time fluorescence quantitative PCR.
Main agents and instrument
SPCSV nitrocellulose filter enzyme-linked immunosorbent assay (NCM-ELISA) detection kit, purchased from International Potato Center (CIP); The total RNA extraction agent of UNIQ-10 pillar box is Shanghai Sheng Gong bio-engineering corporation product; RNase inhibitor, M-MLV ThermoScript II, TaqDNA polysaccharase, Premix Ex TaqTM premix enzyme, purchased from the precious biotech company in Dalian, other reagent is domestic analytical pure.
ABI7500 type quantitative real time PCR Instrument, NanoVue PLUS ultramicrospectrophotometer, is GE company of U.S. product; DNA sequencing is completed by Shanghai Sheng Gong bio-engineering corporation.
The design of primer and probe and synthetic
According to the SPCSV nucleotide sequence of logining in GenBank (accession number: FJ807785), Auele Specific Primer CSV-CP-P1 and the CSV-CP-P2 of design amplification SPCSV-WA cp gene.At a pair of Auele Specific Primer CSV-DL1 of SPCSV-WA cp gene indoor design, CSV-DL2 and a specific probe, detect SPCSV for fluorescent quantitation, primer and probe are synthetic by the precious biotech company in Dalian, and its sequence is in table 1.
Table 1 primer and probe sequence
Wherein F: upstream primer; R: downstream primer.
The extraction of viral RNA and RT-PCR
With the total RNA extraction agent of the UNIQ-10 pillar box of Shanghai Sheng Gong bio-engineering corporation, extract total RNA of susceptible Sweet Potato Leaf; With synthetic cDNA the first chain of CSV-DL2 primer reverse transcription, detect for real-time fluorescence quantitative PCR; Then with synthetic cDNA the first chain of CSV-CP-P2 primer reverse transcription, utilize forward primer CSV-CP-P1 to carry out pcr amplification.
Reverse transcription reaction system is 10 μ L: comprise the MgCl that 2 μ L5 × M-MLV Buffer, 1 μ L concentration are 25mmol/L
2, 1 μ L concentration is respectively the ThermoScript II M-MLV of 200U/ μ L for the dNTP mixture of 10mmol/L, the reverse primer CSV-CP-P2 that 0.5 μ L concentration is 10 μ mol/L, inhibitor, the 0.5 μ L concentration that 0.25 μ L concentration is 40U/ μ L, total RNA of 4.75 μ L Sweet Potato Leafs;
Reverse transcription reaction condition: 42 DEG C of reverse transcription 40min, 95 DEG C of 5min, 5 DEG C of 5min.
Pcr amplification reaction system is 50 μ L, comprising: 10 × ExTaq damping fluid is (containing MgCl
2) 5 μ L, 2.5mol/LdNTP mixture 2 μ L, concentration is forward primer (CSV-CP-P1) and the each 1 μ L of reverse primer (CSV-CP-P2), ExTaqDNA polysaccharase (5U/ μ L) the 0.25 μ L of 10 μ mol/L, make template with 5 μ L reverse transcription products, supplement ddH
2o is to reaction system to 50 μ L.
PCR reaction conditions: 94 DEG C of sex change 1min, 56 DEG C of annealing 30s, 72 DEG C are extended 1min, 35 circulations; Last 72 DEG C are extended 10min; Amplified production is through 1.0% agarose gel electrophoresis, and UVP gel imaging system is observed and taken a picture, and obtains the standard plasmid DNA of SPCSV-WA.
The foundation of fluorescence quantifying PCR method
1.5.1 the preparation of standard plasmid utilizes RT-PCR method to amplify the cp gene of SPCSV-WA, and the PCR product after purifying is connected with pMD19-T carrier, transforms e. coli tg1, extracts plasmid.After sequence verification is correct, obtain the recombinant plasmid of SPCSV-WA cp gene.By concentration and the purity of spectrophotometric determination recombinant plasmid, calculate the copy number of plasmid according to Avogadro constant.
The cp gene fragment of the SPCSV-WA that amplification obtains, size and expection identical (Fig. 1), its gene order is referring to SEQ ID No.1.Cp gene clone is upper to pMD19-T, obtain recombinant plasmid, through sequential analysis checking, SPCSV-WA cp full length gene is 774bp.With its concentration of spectrophotometric instrumentation be 125.8ng/ μ L, A260/A280 ratio is 1.86, purity meets the requirement of quantitative fluorescent PCR standard substance, being converted into copy number is 3.31 × 10
10copy/μ L.
Determining taking SPCSV-WA cp standard plasmid DNA as template of reaction system and cycling condition, primer concentration is increased progressively with the concentration of 0.1 μ mol/L in the scope of 0.1～0.4 μ mol/L, concentration and probe concentration increases progressively with 0.1 μ mol/L in the scope of 0.1～0.5 μ mol/L, the optimum concn of screening primer and probe.Obtain after optimum response system, adopt three warm Recycle design, quantitative fluorescent PCR annealing temperature is optimized, annealing temperature is made as respectively 49 DEG C, 52 DEG C, 55 DEG C, 58 DEG C and 61 DEG C of five gradient processing.
Result shows, with 3.31 × 10
6the dilution standard plasmid DNA of copies/ μ L is template, and upstream and downstream primer final concentration is 0.3 μ mol/L, probe final concentration is 0.3 μ mol/L, minimum Ct value and higher fluorescence intensity increased value (Δ Rn) can be detected.
Pcr amplification reaction system after optimization is always 20 μ L, comprises standard plasmid DNA profiling 2 μ L, premix enzyme Premix Ex Taq
tM(Probe qPCR) 10 μ L, quantitative fluorescent PCR reference dyestuff ROX Dye II (50 ×) 0.4 μ L, forward primer CSV-DL1 and reverse primer CSV-DL2 that concentration is 10 μ mol/L are respectively 0.4 μ L, concentration is the probe 0.4 μ L of 10 μ mol/L, supplies 20 μ L with sterilizing DEPC water;
Amplified reaction program is: 95 DEG C of denaturation 30s, and 95 DEG C of sex change 5s, 55 DEG C of annealing 30s, 72 DEG C are extended 30s and gather fluorescence, totally 40 circulations.
The foundation of typical curve
Use the standard plasmid DNA (3.31 × 10 of 10 times of serial dilutions
3～3.31 × 10
8copies/ μ L) be template, carry out fluorescent quantitative PCR.After reaction finishes, system software automatic analysis obtains amplification curve and the typical curve of quantitative fluorescent PCR.Typical curve is: Y=-3.239X+40.193, and amplification efficiency is 103.568%, relation conefficient is 1.Can find out, in standard substance curve, between Ct value and standard plasmid concentration, present good linear relationship (referring to Fig. 2, Fig. 3).
. result and analysis
The sensitivity of 2.1 quantitative fluorescent PCRs
With 10 gradient standard plasmid DNA (10
-1～0
-10) be template, carry out conventional PCR and fluorescence quantitative PCR detection, relatively the sensitivity of two kinds of detection methods.
Respectively to the dilution standard plasmid DNA (3.31 × 10 of difference
9～3.31 × 10
0copy/μ L) increase, in fluorescence quantifying PCR method of the present invention, when standard plasmid concentration is 3.31 × 10
0when copy/μ L, still have fluorescence curve (Fig. 4), show that detection sensitivity can reach 3.31 × 10
0copies/ μ L; It is conventional that PCR method is minimum only can detect 3.31 × 10
3copy/μ L (Fig. 5), the conventional PCR method of remolding sensitivity that the present invention detects SPCSV-WA is high 1000 times.
The specific test of fluorescence quantifying PCR method
For verifying the specificity of fluorescence quantifying PCR method of the present invention, with 3.31 × 10
3the plasmid of copy/μ L is template, simultaneously using the recombinant plasmid that contains respectively SPFMV, SPVG, SPLV and SPVMV cp gene as detected object.Result shows that effective amplification fluorescent signal does not all appear in SPFMV, SPVG, SPLV, SPVMV in reaction process, SPCSV-WA has good amplification kinetic curve (Fig. 6), shows that fluorescence quantifying PCR method of the present invention has good specificity.
The replica test of fluorescence quantifying PCR method
With 3.31 × 10
3～3.31 × 10
8the dilution standard plasmid DNA of copies/ μ L carries out real-time fluorescence quantitative PCR reaction, and in same test, each dilution standard plasmid is established 3 repetitions.In group, replica test result shows, the variation coefficient of 6 different extent of dilution standard plasmid Ct values is 0.18%～1.62% (table 2); Carry out 3 times more independently revision test taking identical standard plasmid as template.Result shows that between-group variation coefficient (table 3) between 0.08%～0.99% illustrates that the repeatability of fluorescence quantifying PCR method of the present invention and stability are better.
Table 2 real time quantitative PCR method detects the interior replica test result of group of SPCSV
Replica test result between the group of table 3 real time quantitative PCR method detection SPCSV
The qualification of 2.4 fluorescent quantitative PCR products
For the object fragment nucleotide sequence that further checking fluorescent quantitative PCR goes out, the fluorescent quantitative PCR product of random selected part sample is cloned and sequencing, utilizes DNAMAN and BLAST to be compared analysis to check order row.Result shows, in the nucleotide sequence of the object fragment amplifying and GenBank, SPCSV-WA nucleotide sequence consistence reaches 97%～99%, illustrates that the fragment amplifying is the specific fragment of object virus.
The Preliminary Applications of quantitative fluorescent PCR
Utilize NCM-ELISA, conventional RT-PCR and real time fluorescence quantifying PCR method of the present invention, 9 parts of sweet potato Plant samples with typical SPVD symptom that pick up from the ground such as China Sichuan, Jiangsu are detected.
Result shows, NCM-ELISA detects two duplicate samples and is the SPCSV positive, conventional RT-PCR detects six duplicate samples and is the SPCSV positive, the real time fluorescence quantifying PCR method detection duplicate samples coldest days of the year end of the present invention is all the SPCSV positive (table 4), illustrates that the sensitivity of real time fluorescence quantifying PCR method detection field sample is apparently higher than NCM-ELISA and conventional RT-PCR method.
The comparison of three kinds of detection method results of table 4
Note: in table, "-" represents positive; "-" represents negative.
SEQUENCE LISTING
<110> Inst. of Plant Protection, Henan Prov. Academy of Agricultural Sciences
Real-time fluorescence quantitative PCR detection method and the application of <120> sweet potato chlorotic stunt virus West Africa strain
<130> Real-Time Fluorescent Quantitative PCR Technique
<160> 6
<170> PatentIn version 3.4
<210> 1
<211> 774
<212> DNA
<213> artificial sequence
<400> 1
atggctgata gcactaaagt cgaagagaag aactttgatt ctgactcaga tttggaaact 60
aacccaaaga ataaactaca gtccgagtat gcgtctcgtc gtgacgtcca gactgaagga 120
acggctagtt tgggaagacg agatatggag ttaactagtg gtattcttac ctcagaccag 180
ttagctcttg caagattggg taagatccaa gtatattcca attctccaga tattatgtca 240
aagagtcaag aggatgagtt taagcgtcat atggagaact tcgcaaaagt cgtgactggt 300
gaggctacaa taacgccaga aatttttgca gcgttttatg catcgttaat tcaggcatgg 360
gcaaatcaga gtacgtccga aaagaatgct tcgaacgtaa atcttgagaa tatgtttatg 420
gtcgacggga aagagtatag ttggaagact cacaacttca taaaccatat tcaatctaac 480
atgccagatg ttaagaacgc cataaggaag tgggcaaggg ctcatgcaaa tgattacaag 540
gtccttgttg gtatgggtat tgttaaaccc gattaccatt tgcaggcgaa acagggtgtc 600
ttacctgaat attggcattt ggccactgat ttcatgagag gtaatgattt ggcgacaacc 660
gcagatgggc tggctgcgac tttgatgatg aaaaggaacg ctctttgtaa caaggataat 720
aagaattctg tctacaacgt tactcagttg actggaacag gtcttcactg ttga 774
<210> 2
<211> 23
<212> DNA
<213> artificial sequence
<400> 2
atggctgata gcactaaagt cga 23
<210> 3
<211> 23
<212> DNA
<213> artificial sequence
<400> 3
tcaacagtga agacctgttc cag 23
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<400> 4
gactcagatt tggaaactaa 20
<210> 5
<211> 21
<212> DNA
<213> artificial sequence
<400> 5
tggagaattg gaatatactt g 21
<210> 6
<211> 24
<212> DNA
<213> artificial sequence
<400> 6
aactacagtc cgagtatgcg tctc 24
Claims (6)
1. a real-time fluorescence quantitative PCR detection method for sweet potato chlorotic stunt virus West Africa strain, is characterized in that, the method comprises the following steps:
(1) classify template as with the nucleotides sequence of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA, design amplification SPCSV-WA
cpauele Specific Primer CSV-CP-P1 and the CSV-CP-P2 of gene, at SPCSV-WA
cpgene indoor design Auele Specific Primer CSV-DL1, CSV-DL2 and specific C SV probe, primer and the probe sequence of design are respectively:
CSV-CP-P1：ATGGCTGATAGCACTAAAGTCGA；
CSV-CP-P2：TCAACAGTGAAGACCTGTTCCAG；
CSV-DL1：5′-GACTCAGATTTGGAAACTAA-3′；
CSV-DL2：5′-TGGAGAATTGGAATATACTTG-3′；
CSV probe: FAM-5 '-AACTACAGTCCGAGTATGCGTCTC-3 '-BHQ1;
(2) extraction of viral RNA and RT-PCR
With the total RNA extraction agent of pillar box, extract total RNA of susceptible Sweet Potato Leaf; With synthetic cDNA the first chain of CSV-DL2 primer reverse transcription, detect for real-time fluorescence quantitative PCR;
Then with synthetic cDNA the first chain of CSV-CP-P2 primer reverse transcription, utilize forward primer CSV-CP-P1 to carry out pcr amplification reaction, to obtain the standard plasmid DNA of SPCSV-WA;
(3) foundation of real time fluorescence quantifying PCR method
Taking the standard plasmid DNA of sweet potato chlorotic stunt virus West Africa strain SPCSV-WA as template, fluorescent quantitative PCR reaction system is 20 μ L, comprises standard plasmid DNA profiling 2 μ L, premix enzyme Premix Ex
taq tM10 μ L, ROX Reference Dye II 0.4 μ L, forward primer CSV-DL1 and reverse primer CSV-DL2 are respectively 0.4 μ L, CSV probe 0.4 μ L, wherein the concentration of forward primer, reverse primer and probe is 10 μ mol/L, supplies 20 μ L with sterilizing DEPC water; Set up the blank test that does not add template simultaneously;
Fluorescent quantitative PCR response procedures is: 95 DEG C of denaturation 30 s, and 95 DEG C of sex change 5 s, 55 DEG C of annealing 30 s, 72 DEG C are extended 30 s and gather fluorescence, totally 40 circulations.
2. real-time fluorescence quantitative PCR detection method as claimed in claim 1, it is characterized in that: described standard plasmid DNA profiling is prepared by following methods: utilize conventional RT-PCR method to amplify the coat protein CP gene order of SPCSV-WA, this gene order total length 774 bp; CP gene clone is upper to pMD19-T, after sequence verification is correct, obtain SPCSV-WA
cpthe recombinant plasmid of gene; By concentration and the purity of spectrophotometric determination recombinant plasmid, the copy number that calculates recombinant plasmid according to Avogadro constant is 3.31 × 10
10copy/μ L, carries out 10 times of continuous gradient dilutions to recombinant plasmid, obtains the plasmid of 10 times of concentration differences, and plasmid concentration is 10
-1~ 10
-10, as the DNA profiling of standard plasmid.
3. real-time fluorescence quantitative PCR detection method as claimed in claim 1, is characterized in that: described reverse transcription reaction system during with synthetic cDNA the first chain of CSV-DL2 primer reverse transcription is 10 μ L: comprise the MgCl that 2 μ L 5 × M-MLV Buffer, 1 μ L concentration are 25mmol/L
2, the dNTP mixture that 1 μ L concentration is 10mmol/L, the reverse primer CSV-DL2 that 0.5 μ L concentration is 10 μ mol/L, inhibitor, the 0.5 μ L concentration that 0.25 μ L concentration is 40U/ μ L be the ThermoScript II M-MLV of 200U/ μ L, total RNA of 4.75 μ L Sweet Potato Leafs;
Reverse transcription reaction condition: 42 DEG C of reverse transcription 40 min, 95 DEG C of 5 min, 5 DEG C of 5 min.
4. the real-time fluorescence quantitative PCR detection method as described in claim 1-3 any one, is characterized in that: described pcr amplification reaction system while utilizing forward primer CSV-CP-P1 to carry out pcr amplification reaction is 50 μ L, comprising: 10 ×
exTaqdamping fluid 5 μ L, 2.5 mol/L dNTP mixture 2 μ L, concentration are the forward primer CSV-CP-P1 of 10 μ mol/L and the each 1 μ L of reverse primer CSV-CP-P2, concentration is the Ex of 5 U/ μ L
taqarchaeal dna polymerase 0.25 μ L, makes template with 5 μ L reverse transcription products, supplements ddH
2o is to reaction system to 50 μ L;
Pcr amplification reaction condition: 94 DEG C of sex change 1 min, 56 DEG C of annealing 30 s, 72 DEG C are extended 1 min, 35 circulations, last 72 DEG C are extended 10 min; Amplified production is observed and takes a picture through 1.0% agarose gel electrophoresis, UVP gel imaging system, obtains the standard plasmid DNA of SPCSV-WA.
5. PCR detection method as claimed in claim 4, is characterized in that: after described fluorescent quantitative PCR reaction, the typical curve of the quantitative fluorescent PCR obtaining is: Y=-3.239X+40.193.
6. the PCR detection method described in claim 1-5 any one is in the application detecting in sweet potato chlorotic stunt virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410121827.8A CN103937908B (en) | 2014-03-28 | 2014-03-28 | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410121827.8A CN103937908B (en) | 2014-03-28 | 2014-03-28 | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103937908A true CN103937908A (en) | 2014-07-23 |
| CN103937908B CN103937908B (en) | 2016-04-06 |
Family
ID=51185773
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410121827.8A Active CN103937908B (en) | 2014-03-28 | 2014-03-28 | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937908B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755579A (en) * | 2016-12-28 | 2017-05-31 | 河南省农业科学院植物保护研究所 | The multiplex PCR detection of sweet potato chlorotic stunt virus and sweet potato geminivirus infection and method for early warning in a kind of sweet potato root tuber |
| CN107360906A (en) * | 2017-08-04 | 2017-11-21 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of method for mitigating sweet potato SPVD harm |
| CN107385117A (en) * | 2017-09-20 | 2017-11-24 | 湖南省作物研究所 | A kind of sweet potato potato seed complex disease viral disease（SPVD）The detection method of cause of disease |
| CN113897462A (en) * | 2021-11-18 | 2022-01-07 | 中国科学院昆明植物研究所 | Primer and method for quantitatively detecting turnip mosaic virus in myosotis sylvatica |
-
2014
- 2014-03-28 CN CN201410121827.8A patent/CN103937908B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| KOKKINOS C D等: "Real-Time PCR Assays for Detection and Quantification of Sweetpotato Viruses", 《PLANT DISEASE》, vol. 90, no. 6, 30 June 2006 (2006-06-30) * |
| 乔奇等: "甘薯褪绿矮化病毒西非株系RT-LAMP检测方法的建立", 《中国农业科学》, vol. 46, no. 18, 31 December 2013 (2013-12-31) * |
| 王丽等: "甘薯羽状斑驳病毒实时荧光定量PCR检测方法的建立", 《沈阳农业大学学报》, vol. 44, no. 2, 30 April 2013 (2013-04-30) * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755579A (en) * | 2016-12-28 | 2017-05-31 | 河南省农业科学院植物保护研究所 | The multiplex PCR detection of sweet potato chlorotic stunt virus and sweet potato geminivirus infection and method for early warning in a kind of sweet potato root tuber |
| CN107360906A (en) * | 2017-08-04 | 2017-11-21 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of method for mitigating sweet potato SPVD harm |
| CN107385117A (en) * | 2017-09-20 | 2017-11-24 | 湖南省作物研究所 | A kind of sweet potato potato seed complex disease viral disease（SPVD）The detection method of cause of disease |
| CN113897462A (en) * | 2021-11-18 | 2022-01-07 | 中国科学院昆明植物研究所 | Primer and method for quantitatively detecting turnip mosaic virus in myosotis sylvatica |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103937908B (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111996191A (en) | Primer group and kit for simultaneously identifying African swine fever wild strain and gene deletion strain based on multiple qPCR technology | |
| CN101875982B (en) | Method for synchronously detecting multiple tobacco viruses | |
| CN103937908B (en) | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application | |
| CN106947832A (en) | The primer and probe of Porcine epidemic diarrhea virus quantitative fluorescent PCR | |
| CN108728581B (en) | Multiple RT-PCR method for simultaneously detecting 5 sugarcane viruses, primers and kit thereof | |
| CN102634591B (en) | Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof | |
| CN111363856B (en) | Method for simultaneously detecting four tomato viruses by multiple RT-PCR | |
| CN111254225A (en) | Mandarin fish frog virus and rhabdovirus double PCR detection kit and detection method | |
| CN110628944A (en) | Duck type-3 adenovirus and duck novel reovirus differential diagnosis kit | |
| CN104178585A (en) | Potato virus detection primers and potato virus detection method | |
| CN101225435A (en) | Method for quickly detecting transgenic soybean | |
| CN101824411A (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
| CN110846440A (en) | Complete primer pair for determining complete genome of passion flower virus in east Asia and application thereof | |
| CN103498010B (en) | Primer and kit for rapidly detecting tomato chlorosis virus (ToCV) and application thereof | |
| CN102796825A (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| CN110628725A (en) | Citrus yellowed vein clearing virus mutant and construction method thereof | |
| CN102559854A (en) | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular | |
| CN113005224B (en) | Primer pair for amplifying watermelon latent virus and application thereof | |
| CN107604101A (en) | One breeding pigeon New-type adenovirus real-time fluorescence quantitative PCR detection kit | |
| CN106520769B (en) | ISKNV gene intron and application thereof in distinguishing ISKNV live virus from inactivated virus | |
| CN102417934A (en) | Primers, TaqMan probe and kit used for detecting tomato yellow leaf curl virus | |
| CN107475391B (en) | Primer, probe, method and kit for specific real-time fluorescent PCR (polymerase chain reaction) detection of apples at arctic | |
| CN109628632A (en) | A kind of primer combination, probe, kit and method for transgenic corns MON87419 event-specific detection | |
| CN117187439B (en) | Detection primer, detection kit and detection method for paris polyphylla turnip mosaic virus | |
| CN106048068B (en) | Kit for quantitative detection of Lanzhou lily PR5 gene and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |