CN113005224B

CN113005224B - Primer pair for amplifying watermelon latent virus and application thereof

Info

Publication number: CN113005224B
Application number: CN202110069899.2A
Authority: CN
Inventors: 赵立群; 邱艳红; 徐秀兰; 田文; 张海军; 张晓飞; 刘慧�; 温常龙
Original assignee: BEIJING AGRICULTURE TECHNOLOGY PROMOTION STATION; Beijing Academy of Agriculture and Forestry Sciences
Current assignee: BEIJING AGRICULTURE TECHNOLOGY PROMOTION STATION; Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2021-01-19
Filing date: 2021-01-19
Publication date: 2023-03-28
Anticipated expiration: 2041-01-19
Also published as: CN113005224A

Abstract

The invention discloses a primer pair for amplifying genome segments of watermelon latent viruses, which comprises a first primer and a second primer; the nucleic acid sequence of the first primer is shown as SEQ ID NO. 1; the nucleic acid sequence of the second primer is shown as SEQ ID NO. 2. The invention also discloses a reagent and a kit comprising the primer pair and application thereof. The invention also discloses a method for detecting whether the plant material to be detected is infected with the watermelon latent virus by using the primer pair and a method for detecting whether the virus to be detected is the watermelon latent virus. The primer pair has high sensitivity and good specificity in detecting the watermelon latent virus.

Description

Primer pair for amplifying watermelon latent virus and application thereof

Technical Field

The invention belongs to the technical field of plant viruses, relates to a biological detection technology, and particularly relates to a primer pair, an RT-PCR reagent, an RT-PCR kit and an application and a method thereof for detecting watermelon latent virus based on a one-step RT-PCR technology.

Background

Watermelon latent virus (CiLCV) is an important disease virus newly found in watermelon in recent years, and is a member of the genus delta partiivirus of the family dimiviridae (partiiviridae) type butane (deltapartiivirus). Consists of two dsRNA segments. Wherein dsRNA-1 has a full length 1603nt and contains an ORF for encoding RdRp; dsRNA-2 is 1466nt in length and contains an ORF encoding CP. The virus is discovered in Israel in 2013 at the earliest, is reported for the first time in Henan in China in 2017, and is detected on watermelon in Beijing in 2019. The virus can be transmitted to the offspring seedlings from the seeds with high efficiency, and the virus can be transmitted by the seeds of most watermelon varieties. The virus has unobvious symptoms in the seedling stage, but can be mixed with various melon viruses such as WMV, ZYMV, CGMMV, MABYV and MNSV in the later stage to cause various symptoms such as plant dwarfing, leaf deformity and the like, thereby seriously harming the watermelon industry. In view of strong concealment and great harm of the virus, the establishment of a rapid and convenient molecular detection method for enhancing the detection of the virus on seeds and seedlings is the key for preventing and controlling the virus diseases at present. However, primers and detection methods for the specificity and sensitivity of the virus are not available.

Disclosure of Invention

The invention aims to solve the technical problem of how to detect the watermelon latent virus or whether a plant sample to be detected is infected with the watermelon latent virus. In order to solve the technical problems, the invention designs the specific primer according to the conserved region RdRP of RNA1, and can quickly, accurately and sensitively detect the virus.

The first aspect of the invention provides a primer pair for amplifying a genome segment of a watermelon latent virus, which comprises a first primer and a second primer;

the nucleic acid sequence of the first primer is shown as SEQ ID NO. 1; the nucleic acid sequence of the second primer is shown as SEQ ID NO. 2;

or, the first primer and the second primer are primer pairs which can be used for amplifying the nucleotide sequence shown as SEQ ID NO.3 or SEQ ID NO. 4;

or the first primer and the second primer are primer pairs which can be used for amplifying homologous sequences of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4 of the watermelon latent virus.

In a second aspect, the invention provides a reagent for amplifying a genome fragment of a watermelon latent virus, wherein the reagent comprises a primer pair according to the first aspect of the invention.

In some embodiments, the molar ratio of the first primer to the second primer is 1:1.

In some embodiments, the reagent further comprises a reverse transcriptase and/or a DNA polymerase.

In some embodiments, the reagent further comprises a positive control sample, and the positive control sample can be a plant leaf infected with the watermelon latent virus, can also be the watermelon latent virus, and can also be an artificially synthesized nucleotide sequence shown as SEQ ID NO. 3.

In a third aspect, the invention provides a kit for amplifying a genome fragment of a watermelon latent virus, wherein the kit comprises a primer pair according to the first aspect of the invention or a reagent according to the second aspect of the invention.

In a fourth aspect, the invention provides the use of a primer pair according to the first aspect of the invention, a reagent according to the second aspect of the invention or a kit according to the third aspect of the invention in a1 or a 2:

a1, detecting watermelon latent virus;

a2, preparing a preparation for detecting the watermelon latent virus;

in some embodiments, a1 refers to:

detecting whether the plant material to be detected is infected with the watermelon latent virus; or

Detecting whether the virus to be detected is the watermelon latent virus;

in some embodiments, a2 refers to:

preparing a preparation for detecting whether the plant material to be detected is infected with the watermelon latent virus; or

And (3) preparing a preparation for detecting whether the virus to be detected is the watermelon latent virus.

The fifth aspect of the invention provides a method for detecting whether a plant material to be detected is infected with watermelon latent virus, which comprises the following steps:

b1, carrying out PCR amplification on the nucleic acid of the plant material to be detected by adopting the primer pair of the first aspect of the invention;

b2, determining whether the plant material to be detected is infected with the watermelon latent virus according to the amplified product.

In some embodiments, the plant material to be tested is watermelon leaves or seeds.

In some embodiments, the nucleic acid of the test plant material is total RNA of the test plant material.

In some embodiments, the PCR amplification is RT-PCR amplification.

In some embodiments, the determining step is: characterizing the DNA fragment in the PCR amplification product, and judging that the watermelon latent virus is not infected in the plant material to be detected when the DNA fragment of 588bp is not contained in the PCR amplification product; and when the PCR amplification product contains a 588bp DNA fragment, judging that the plant material to be detected is infected with the watermelon latent virus.

In some embodiments, the characterizing is by performing agarose gel electrophoresis of the amplification product.

In some embodiments, the temperature program used for PCR amplification is:

(1) Reacting at 50 ℃ for 30min;

(2) Reacting at 94 ℃ for 2min;

(3) Carrying out cyclic reaction;

(4) Reacting at 72 ℃ for 10min;

the circulating reaction steps are as follows: reacting at 94 ℃ for 30s; reacting for 30s at 55-56 ℃; the reaction is carried out for 35s at 72 ℃ and circulated for 30 times.

The sixth aspect of the present invention provides a method for detecting whether a virus to be detected is a watermelon latent virus, including:

c1, carrying out PCR amplification on the nucleic acid of the virus sample to be detected by adopting the primer pair of the first aspect of the invention;

c2, judging whether the virus to be detected is infected with the watermelon latent virus according to the amplified product.

In some embodiments, the nucleic acid of the test viral sample is total RNA of the test viral sample.

In some embodiments, the PCR amplification is RT-PCR amplification.

In some embodiments, the determining step is: characterizing the DNA fragment in the amplification product, and judging that the virus sample to be detected is not the watermelon latent virus when the amplification product does not have the DNA fragment of 588 bp; and when the amplified product contains a 588bp DNA fragment, judging that the virus sample to be detected is the watermelon latent virus.

In some embodiments, the characterization is by agarose gel electrophoresis of the amplification products.

In some embodiments, the temperature program used for PCR amplification is:

(1) Reacting at 50 ℃ for 30min;

(2) Reacting at 94 ℃ for 2min;

(3) Carrying out cyclic reaction;

(4) Reacting at 72 ℃ for 10min;

The primer pair for detecting the watermelon latent virus provided by the invention consists of a primer CiLCV-588-F (namely a first primer) and a primer CiLCV-588-R (namely a second primer). The primer pair can specifically amplify CiLCV, the length of an amplified fragment is 588bp, and cucumber green mottle mosaic virus, cucumber mosaic virus, melon endogenous RNA virus, melon chlorosis virus, pumpkin mosaic virus, tomato spotted wilt virus, watermelon mosaic virus and pumpkin yellow mosaic virus cannot be amplified. Therefore, whether the watermelon seeds or plants carry the virus disease can be identified, and the method has wide application prospect. The primer pair provided by the invention has the advantages of good specificity, high accuracy and high sensitivity, and the detection method provided by the invention has the advantages of simple and convenient operation, high detection efficiency and the like, and can meet the basic requirements of seed producers and users, seedling raising fields and watermelon field detection.

Drawings

FIG. 1 shows the results of the specificity test of example 3, lane 1 corresponding to the detection of amplification products from a positive control watermelon sample containing watermelon latent virus; lane 2 corresponds to detection of amplification products from a watermelon sample containing cucumber green mottle mosaic virus; lane 3 corresponds to detection of amplification products from watermelon samples containing cucumber mosaic virus; lane 4 corresponds to detection of amplification products from a melon sample containing melon endogenous RNA viruses; lane 5 corresponds to detection of amplification products from melon samples containing the melon chlorotic virus; lane 6 shows the detection of amplification products from a watermelon sample containing cucumovirus; lane 7 corresponds to detection of amplification products from a sample of watermelon containing tomato spotted wilt virus; lane 8 corresponds to detection of amplification products from a watermelon sample containing watermelon mosaic virus; lane 9 corresponds to detection of amplification products from pumpkin samples containing zucchini yellow mosaic virus; lane 10 corresponds to detection of amplification products from healthy watermelon samples; lane M is DNADL2000Marker, with bands from top to bottom of 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in sequence.

FIG. 2 shows the results of the sensitivity test of example 4, lane 1 corresponding to detection of the amplification product of RNA solution 1; lane 2 corresponds to detection of amplification products from RNA solution 2; lane 3 corresponds to detection of amplification products from RNA solution 3; lane 4 corresponds to detection of amplification products from RNA solution 4; lane 5 corresponds to detection of the amplification product of RNA solution 5; lane 6 corresponds to detection of amplification products from RNA solution 6; lane 7 corresponds to detection of amplification products from RNA solution 7; lane 8 corresponds to detection of amplification products from RNA solution 8; lane 9 corresponds to detection of amplification products from RNA solution 9; lane 10 corresponds to a blank control, lane M corresponds to a DNA DL2000Marker, and the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in sequence.

FIG. 3 shows the results of the accuracy test of example 5, wherein lanes 1-4 are shown for detecting latent watermelon virus in a test sample using the primer pairs of the present invention. Wherein,

lanes

1, 2 and 3 correspondingly detect the amplification products of the to-be-detected Beijing watermelon sample containing the watermelon latent virus; lane 4 correspondingly detects the amplification product of the watermelon sample to be detected, which does not contain the watermelon latent virus; lane M corresponds to DNA DL2000Marker, and the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in sequence.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below may serve as a basis for further modifications or applications by those skilled in the art and do not constitute a specific limitation of the invention in any way.

The experimental procedures in the following examples are all conventional procedures unless otherwise specified, and may be performed according to the techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the following examples are conventionally commercially available unless otherwise specified.

Defining:

a primer pair capable of being used for amplifying a nucleotide sequence shown as SEQ ID NO.3 refers to: except for the primer pairs with the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, the primer pairs respectively extend a plurality of bases at the 3' end, which does not obviously influence the efficiency of amplifying the watermelon latent virus. Or at different other positions of the nucleotide sequence shown in SEQ ID NO.3, respectively, as long as they can be used to efficiently amplify the template of the nucleotide sequence shown in SEQ ID NO.3, are suitable for use in the present invention. It is clear that the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are only one of many combinations of primer pairs that can be used to amplify the watermelon latent virus that can be obtained according to the embodiments of the present invention.

The homologous sequence of the nucleotide sequence shown as SEQ ID NO.3 of the watermelon latent virus refers to: a sequence homologous to the nucleotide sequence shown in SEQ ID No.3 in the ORF of RdRp of different natural or artificial mutants of the watermelon latent virus. If the homologous sequence does not differ from the nucleotide sequence shown in SEQ ID NO.3 by a region that does not fall within the sequence match shown in SEQ ID NO.1 and SEQ ID NO.2, it is apparent that the amplification efficiency is the same. If the difference between the homologous sequence and the nucleotide sequence shown in SEQ ID NO.3 falls within the region where the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 match, it is clear that, after the sequences of the primer pair are adjusted accordingly, the primers match the corresponding sequences of the new mutant strain, and consequently the amplification efficiency is substantially the same.

Cucumber green mosaic virus (CGMMV), cucumber Mosaic Virus (CMV), melon endogenous virus (CMEV), cucurbit chlorotic virus (CCYV), squash mosaic virus (SqMV), tomato Spotted Wilt Virus (TSWV), watermelon Mosaic Virus (WMV), zucchini Yellow Mosaic Virus (ZYMV), zymin Yellow Mosaic Virus (ZYMV) are all biological materials common in the art.

Example 1: design and Synthesis of primers

Based on the genome of the watermelon latent virus with GenBank accession number KY081285, a specific primer pair for identifying the watermelon latent virus is obtained aiming at a conserved region RdRP encoded by dsRNA1 through a large amount of sequence analysis, sequence design, manual screening optimization and effect verification. The specific primer pair consists of CILCV-588-F and CILCV-588-R. The primer sequences are as follows:

CiLCV-588-F：5'-TCCAGACGTTGGCTACACAC-3'(SEQ ID NO.1)；

CiLCV-588-R：5'-ATTGCGAACCTCTCAGGTGG-3'(SEQ ID NO.2)；

wherein, ciLCV-588-F is a forward primer, and CiLCV-588-R is a reverse primer.

The theoretical amplification product size of the specific primer pair is 588bp, the nucleotide sequence of the theoretical amplification product is shown as SEQ ID NO.3 in a sequence table, and the corresponding RNA sequence is shown as SEQ ID NO.4 in the sequence table.

5'-TCCAGACGTTGGCTACACACGCACACAACTGGCAGACATTACCGAAAAGACAAAAGTACGACATGTATGGGGTCGCGCATTCCATTATATTTTACTTGAAGGATTAACAGCTGATCCACTGATCAGAGCAGTTCAGAGAGCTGACACGTTCATCCATATCGGTAAAGATCCGACAGTTAGTGTACCCAGATTACTATCAGACACAGCTGAGCAATGCAAATGGTTATATGCTTTAGATTGGAAACAATTTGATGCAACCGTTAGCCGGTTTGAAATTGAAGCTGCATTCGATATCGTTCTCAACCTTCTAGACTTTCCTAACAGAGAGACAAAACTGATGTTTGAGCTTTCGAAGCAACTCTTTATTCACAAGAAAATTGCTGCTCCTGATGGCAAAATCTATTGGGCACACAAAGGAATCCCTTCTGGGAGTTACTTTACATCCATAATCGGTTCAATTATTAACAGAGTTAGAATTGAATATCTATGGAGAACTATTACAGGTCACGGACCAATTGTATGTTATACACAAGGTGATGATTCACTTTGCGGAGACAACATTCTGATTCCACCTGAGAGGTTCGCAAT-3'(SEQ ID NO.3)。

5'-UCCAGACGUUGGCUACACACGCACACAACUGGCAGACAUUACCGAAAAGACAAAAGUACGACAUGUAUGGGGUCGCGCAUUCCAUUAUAUUUUACUUGAAGGAUUAACAGCUGAUCCACUGAUCAGAGCAGUUCAGAGAGCUGACACGUUCAUCCAUAUCGGUAAAGAUCCGACAGUUAGUGUACCCAGAUUACUAUCAGACACAGCUGAGCAAUGCAAAUGGUUAUAUGCUUUAGAUUGGAAACAAUUUGAUGCAACCGUUAGCCGGUUUGAAAUUGAAGCUGCAUUCGAUAUCGUUCUCAACCUUCUAGACUUUCCUAACAGAGAGACAAAACUGAUGUUUGAGCUUUCGAAGCAACUCUUUAUUCACAAGAAAAUUGCUGCUCCUGAUGGCAAAAUCUAUUGGGCACACAAAGGAAUCCCUUCUGGGAGUUACUUUACAUCCAUAAUCGGUUCAAUUAUUAACAGAGUUAGAAUUGAAUAUCUAUGGAGAACUAUUACAGGUCACGGACCAAUUGUAUGUUAUACACAAGGUGAUGAUUCACUUUGCGGAGACAACAUUCUGAUUCCACCUGAGAGGUUCGCAAU-3'(SEQ ID NO.4)。

Example 2: establishment of an authentication method

1. Method for identifying whether to-be-detected virus is watermelon latent virus

1. The total RNA of the sample to be detected is extracted by a TRIZOL method or other reagent kit which can be used for extracting the virus RNA according to the instructions.

2. The total RNA extracted in step 1 was used as a template, and the primer pair designed in example 1 was used for amplification by one-step RT-PCR.

The reaction system was as follows (25. Mu.l): primer CiLCV-588-F0.5. Mu.l (10. Mu. Mol/L), primer CiLCV-588-R0.5. Mu.l (10. Mu. Mol/L), primeScript 1Step Enzyme Mix 1. Mu.l, 2x 1stepBuffer (Dye Plus) 12.5. Mu.l, template 1. Mu.L (i.e.total RNA extracted in step 1, concentration 100ng-200 ng/. Mu.L), and the balance 25. Mu.l with RNase-free water. Among them, primeScript 1StepEnzyme Mix and 2x 1step Buffer (Dye Plus) were derived from PrimeScript from Takara ^TM One Step RT-PCR Kit Ver.2 (Dye Plus), cat # RR057A.

The reaction conditions were as follows:

reacting for 30min at 1.50 ℃;

reacting for 2min at 2.94 ℃;

reacting at 3.94 ℃ for 30s;

reacting at 4.55 ℃ for 30s;

reacting at 5.72 ℃ for 35s;

reacting at 6.72 ℃ for 5min

In which 30 cycles of reaction were performed from steps 3-5.

3. And (3) taking the product obtained in the step (2), and detecting by adopting agarose gel electrophoresis. And the watermelon latent virus is taken as a positive control sample.

If the amplification products of the positive control sample and the detection sample both contain 588bp DNA fragments, the result is positive, and the virus sample to be detected contains the watermelon latent virus.

If the amplification product of the positive control sample contains the DNA fragment of 588bp, and the amplification product of the detection sample does not contain the DNA fragment of 588bp, the result is negative, and the virus sample to be detected does not contain the watermelon latent virus.

If the positive control sample has no specific amplification, the detection process is judged to be wrong, and the detection needs to be carried out again.

2. Method for identifying whether plant material to be detected is infected with watermelon latent virus

1. The total RNA of the plant to be detected is extracted by a TRIZOL method or other reagent boxes which can be used for extracting the plant RNA according to the instructions, and the sample can be plant tissues to be detected, such as leaves or seeds.

2. Step 2 of the method for identifying whether the virus to be detected is the watermelon latent virus.

3. Step 3 of the method for identifying whether the virus to be detected is the watermelon latent virus.

If the amplification products of the positive control sample and the detection sample both contain 588bp DNA fragments, the result is positive, and the plant material to be detected is infected with the watermelon latent virus.

If the amplification product of the positive control sample contains the DNA fragment of 588bp, and the amplification product of the detection sample does not contain the DNA fragment of 588bp, the result is negative, and the plant material to be detected is not infected with the watermelon latent virus.

Example 3: experiment of specificity

The viruses to be tested were as follows:

cucumber green mottle mosaic virus, cucumber mosaic virus, melon endogenous RNA virus, melon chlorosis virus, pumpkin mosaic virus, tomato spotted wilt virus, watermelon mosaic virus and pumpkin yellow mosaic virus.

The test samples of the plants infected with the above viruses were determined, and the test was carried out according to the "method for identifying whether the plant material to be tested is infected with the watermelon latent virus" of example 2.

The results are shown in FIG. 1. In FIG. 1, lane 1 corresponds to the detection of a positive control watermelon sample containing watermelon latent virus; lane 2 corresponds to detection of amplification products from a watermelon sample containing cucumber green mottle mosaic virus; lane 3 corresponds to detection of amplification products from watermelon samples containing cucumber mosaic virus; lane 4 corresponds to detection of amplification products from a melon sample containing melon endogenous RNA viruses; lane 5 corresponds to detection of amplification products from melon samples containing the melon chlorotic virus; lane 6 corresponds to detection of amplification products from a watermelon sample containing cucumovirus; lane 7 corresponds to detection of amplification products from a sample of watermelon containing tomato spotted wilt virus; lane 8 detects the amplification product of the watermelon sample containing watermelon mosaic virus; lane 9 corresponds to the amplification product of a pumpkin sample containing zucchini yellow mosaic virus; lane 10 corresponds to detection of amplification products from a healthy watermelon sample (no specific known virus); lane M corresponds to DNA DL2000Marker. Except that the amplification product of the positive control sample of the watermelon latent virus corresponding to the lane 1 contains a DNA fragment of 588bp, other samples to be detected have no specific amplification band, which shows that the RT-PCR detection method of the watermelon latent virus established by the invention has good specificity.

Example 4: sensitivity test

The viruses to be tested were as follows: watermelon latent virus (CiLCV).

1. The total RNA of the watermelon leaves containing the watermelon latent virus is extracted and determined by a TRIZOL method.

2. Taking the total RNA obtained in the step 1, and performing tenfold gradient dilution by using sterile water to respectively obtain the following RNA solutions: RNA solution 1 with an RNA concentration of 200 ng/. Mu.l, RNA solution 2 with an RNA concentration of 20 ng/. Mu.l, RNA solution 3 with an RNA concentration of 2 ng/. Mu.l, an RNA concentration of 2X 10 ^-1 ng/. Mu.l RNA solution 4, RNA concentration 2X 10 ^-2 ng/. Mu.l RNA solution 5, RNA concentration 2X 10 ^-3 RNA concentration of 2X 10 in ng/. Mu.l RNA solution 6 ^-4 ng/. Mu.l RNA solution 7, RNA concentration 2X 10 ^-5 ng/. Mu.l RNA solution 8, RNA concentration 2X 10 ^-6 ng/. Mu.l RNA solution 9.

3. And (3) taking the RNA solution obtained in the step (2) as a template, wherein the dosage of the RNA solution in each reaction system is 1 mu l, and performing one-step RT-PCR amplification by adopting the primer pair designed in the embodiment 1.

The reaction system and reaction conditions refer to step 2 of "method for identifying whether the virus to be detected is the watermelon latent virus" in example 2, and sterile water is used as a blank control.

4. And (4) taking the amplification product in the step (3), and detecting by agarose gel electrophoresis.

The results are shown in FIG. 2. In FIG. 2, lane 1 corresponds to RNA solution 1, lane 2 corresponds to RNA solution 2, lane 3 corresponds to RNA solution 3, lane 4 corresponds to RNA solution 4, lane 5 corresponds to RNA solution 5, lane 6 corresponds to RNA solution 6, lane 7 corresponds to RNA solution 7, lane 8 corresponds to RNA solution 8, lane 9 corresponds to RNA solution 9, lane 10 corresponds to a blank control (sterile water), and lane M corresponds to DNADL2000Marker. The results showed that the concentration of viral RNA in the template was 2X 10 ^-3 The results were all positive at ng/. Mu.l or higher (lanes 1-6). The PCR detection method for the watermelon latent virus established by the invention has good sensitivity.

Example 5: detecting plant samples to be tested

1. Watermelon sample

Taking a plurality of watermelon leaves with the disease symptoms of the watermelon latent virus disease and watermelon leaves without the watermelon latent virus as plant materials to be detected. Each plant material to be tested is taken from different watermelon plants.

And (3) taking a plant material to be detected, extracting total RNA of the watermelon leaves to be detected by using a TRIZOL method, and detecting according to the second method for identifying whether the plant material to be detected is infected with the watermelon latent virus in the embodiment 2.

The results are shown in FIG. 3. In FIG. 3,

lanes

1, 2 and 3 show the results of detecting whether watermelon latent virus is infected in watermelon to be tested by using the primers of the present invention; lane 4 shows the results of the control sample detection without the watermelon latent virus; lane M corresponds to DNA DL2000Marker; the amplification products of the three samples corresponding to

lanes

1, 2 and 3 were sequenced by Sanger method, respectively, and the nucleotide sequences were identical to those of SEQ ID No.3, and the samples were determined to be latent watermelon virus after Blast analysis. The result shows that the established watermelon latent virus RT-PCR detection method can effectively identify the watermelon latent virus from watermelon samples.

The results show that each plant material to be detected containing the watermelon latent virus detects the watermelon latent virus, and the accuracy of the method provided by the invention is 100%.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is made possible within the scope of the claims attached below.

Sequence listing

<110> agriculture technology promotion station in Beijing city

Beijing Academy of Agricultural and Forestry Sciences

<120> primer pair for amplifying watermelon latent virus and application thereof

<130> C1CNCN210001

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tccagacgtt ggctacacac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

attgcgaacc tctcaggtgg 20

<210> 3

<211> 588

<212> DNA

<213> watermelon latent virus (citrus Lanatus Crytic virus)

<400> 3

tccagacgtt ggctacacac gcacacaact ggcagacatt accgaaaaga caaaagtacg 60

acatgtatgg ggtcgcgcat tccattatat tttacttgaa ggattaacag ctgatccact 120

gatcagagca gttcagagag ctgacacgtt catccatatc ggtaaagatc cgacagttag 180

tgtacccaga ttactatcag acacagctga gcaatgcaaa tggttatatg ctttagattg 240

gaaacaattt gatgcaaccg ttagccggtt tgaaattgaa gctgcattcg atatcgttct 300

caaccttcta gactttccta acagagagac aaaactgatg tttgagcttt cgaagcaact 360

ctttattcac aagaaaattg ctgctcctga tggcaaaatc tattgggcac acaaaggaat 420

cccttctggg agttacttta catccataat cggttcaatt attaacagag ttagaattga 480

atatctatgg agaactatta caggtcacgg accaattgta tgttatacac aaggtgatga 540

ttcactttgc ggagacaaca ttctgattcc acctgagagg ttcgcaat 588

<210> 4

<211> 588

<212> RNA

<213> watermelon latent virus (citrullus lanatus Crytic virus)

<400> 4

uccagacguu ggcuacacac gcacacaacu ggcagacauu accgaaaaga caaaaguacg 60

acauguaugg ggucgcgcau uccauuauau uuuacuugaa ggauuaacag cugauccacu 120

gaucagagca guucagagag cugacacguu cauccauauc gguaaagauc cgacaguuag 180

uguacccaga uuacuaucag acacagcuga gcaaugcaaa ugguuauaug cuuuagauug 240

gaaacaauuu gaugcaaccg uuagccgguu ugaaauugaa gcugcauucg auaucguucu 300

caaccuucua gacuuuccua acagagagac aaaacugaug uuugagcuuu cgaagcaacu 360

cuuuauucac aagaaaauug cugcuccuga uggcaaaauc uauugggcac acaaaggaau 420

cccuucuggg aguuacuuua cauccauaau cgguucaauu auuaacagag uuagaauuga 480

auaucuaugg agaacuauua caggucacgg accaauugua uguuauacac aaggugauga 540

uucacuuugc ggagacaaca uucugauucc accugagagg uucgcaau 588

Claims

1. A primer pair for amplifying a watermelon latent virus genome segment, wherein the primer pair consists of a first primer and a second primer;

the nucleic acid sequence of the first primer is shown as SEQ ID NO. 1; the nucleic acid sequence of the second primer is shown as SEQ ID NO. 2.

2. A reagent for amplifying a segment of the genome of a watermelon latent virus, said reagent comprising the primer pair of claim 1.

3. The reagent of claim 2, wherein the molar ratio of the first primer to the second primer is 1:1;

the reagent further comprises reverse transcriptase and/or DNA polymerase;

the reagent also includes a positive control sample.

4. A kit for amplifying a genome fragment of a watermelon latent virus, comprising the primer pair of claim 1 or the reagent of claim 2 or 3.

5. Use of the primer pair of claim 1, the reagent of claim 2 or 3, or the kit of claim 4 in a1 or a 2:

a1, detecting the latent watermelon virus;

a2, preparing a preparation for detecting the watermelon latent virus.

6. The use according to claim 5, wherein a1 is:

Detecting whether the virus to be detected is the watermelon latent virus;

a2 means:

7. A method of detecting whether a plant material to be tested is infected with a watermelon latent virus, said method comprising:

b1, carrying out PCR amplification on the nucleic acid of the plant material to be detected by adopting the primer pair of claim 1;

8. The method of claim 7, wherein the plant material to be tested is watermelon leaves or watermelon seeds.

9. The method of claim 7, wherein the nucleic acid of the test plant material is total RNA of the test plant material.

10. The method of claim 7, wherein the PCR amplification is RT-PCR amplification.

11. The method of claim 7, wherein the determining step is: characterizing the DNA fragment in the PCR amplification product, and judging that the watermelon latent virus is not infected in the plant material to be detected when the DNA fragment of 588bp is not contained in the PCR amplification product; when the PCR amplification product contains a 588bp DNA fragment, judging that the plant material to be detected is infected with the watermelon latent virus;

the characterization is realized by agarose gel electrophoresis of the amplification product;

the temperature program adopted by the PCR amplification is as follows:

(1) Reacting at 50 ℃ for 30min;

(2) Reacting at 94 ℃ for 2min;

(3) Carrying out cyclic reaction;

(4) Reacting at 72 ℃ for 10min;

12. A method for detecting whether a virus to be detected is a watermelon latent virus, the method comprising:

c1, carrying out PCR amplification on the nucleic acid of the virus sample to be detected by using the primer pair of claim 1;

13. The method of claim 12, wherein the nucleic acid of the test viral sample is total RNA of the test viral sample.

14. The method of claim 12, wherein the PCR amplification is RT-PCR amplification.

15. The method of claim 12, wherein the determining step is: characterizing the DNA fragment in the amplification product, and judging that the virus sample to be detected is not the watermelon latent virus when the amplification product does not have the DNA fragment of 588 bp; when the amplified product contains a 588bp DNA fragment, judging that the virus sample to be detected is the watermelon latent virus;

the temperature program adopted by the PCR amplification is as follows:

(1) Reacting at 50 ℃ for 30min;

(2) Reacting at 94 ℃ for 2min;

(3) Carrying out cyclic reaction;

(4) Reacting at 72 ℃ for 10min;