CN106755597B

CN106755597B - Multiplex PCR method for synchronously detecting 4 pepper viruses

Info

Publication number: CN106755597B
Application number: CN201710098452.1A
Authority: CN
Inventors: 李莉; 冯耿; 王锡锋; 刘文文
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2017-02-23
Filing date: 2017-02-23
Publication date: 2020-06-02
Anticipated expiration: 2037-02-23
Also published as: CN106755597A

Abstract

The invention belongs to the technical field of crop disease diagnosis and molecular biology, and discloses a multiplex PCR method for synchronously detecting 4 pepper viruses, wherein a PCR system contains 4 pairs of specific primers (SEQ ID NO 1-8), 4 viruses are synchronously amplified in one PCR system to obtain specific bands of 1406bp,1202bp,600bp and 376bp, and a multiplex RT-PCR reaction system capable of synchronously detecting BBWV2, PVY, ChiVMV and CMV is established and optimized. The detection result shows that the optimized multiplex RT-PCR reaction system can quickly, efficiently and accurately detect field samples. The method has very important significance for monitoring the occurrence condition of 4 common virus diseases such as PVY and the like on the pepper in the field and predicting disease prevalence.

Description

Multiplex PCR method for synchronously detecting 4 pepper viruses

Technical Field

The invention belongs to the technical field of crop disease diagnosis and molecular biology, and particularly relates to a reverse transcription polymerase chain reaction (RT-PCR) system and application thereof.

Background

Pepper (Capsicum spp.) is a plant of the genus Capsicum of the family solanaceae, is a favorite vegetable and seasoning due to its unique fruit flavor and rich nutrition, and is also used for extraction of food pigments, medicines and industrial components, so it is widely cultivated in the regions of america, europe, asia, africa and oceania, and there is a tendency to further expand with the increase of demand and trade volume of pepper. Chinese pepper planting area 133 ten thousand hm²The total economic value is 700 hundred million yuan, the pepper is the first place in the world, and the pepper is also the main economic source for farmers in provinces poor mountainous areas such as Guizhou, Yunnan, Sichuan and Chongqing. The virus diseases are important diseases of the peppers, and since the last 70 th century, along with the continuous expansion of planting areas and the change of climate and cultivation system of planting areas, the virus diseases have a trend of rising year by year, and the virus diseases often cause flower, leaf and fruit drop after infection, the yield is reduced by 30-70%, and even the virus diseases are extremely harvested, so that the virus diseases become one of important limiting factors influencing the yield and quality of the peppers.

At present, more than 49 virus pathogens can infect pepper worldwide, about 15 major types of 20 viruses can cause serious symptoms, and about 23 pepper virus pathogens which can cause disease symptoms exist in China. Cucumber Mosaic Virus (CMV), Tobacco Mosaic Virus (TMV), Pepper mottle virus (chimi viral virus, ChiVMV), Pepper mild mottle virus (PMMoV), Tomato mosaic virus (ToMV), Potato Y virus (PVY), Broad bean wilting virus No.2 (Broad bean wilt virus 2, BBWV2), Tobacco rattle virus (tobacount virus, bpv), Pepper endogenous RNA virus (BPEV), and the like are commonly known. The pepper plants show different symptoms after being infected by virus, and the common symptoms comprise mosaic, yellowing, mottle, shrinkage, deformity, necrosis, plant dwarfing and the like. However, in nature, the condition that the same pepper plant is infected by two or more viruses (compound infection) at the same time is very common, and the compound infection can weaken the resistance of a host, aggravate disease symptoms, further make the disease symptoms more complicated, bring great difficulty to disease identification and directly influence the timely prevention and treatment of diseases. The pepper virus diseases naturally occurring in Guiyang city of Guizhou province in 2016 are serious and complicated in disease symptoms, and are found to be caused by four virus infections of BBWV-2CMV, PVY, ChiVMV and CMV through deep sequencing of small RNA and PCR identification, so that an accurate, rapid, simple and easy-to-operate method is urgently needed in production for simultaneously identifying multiple virus diseases.

With the great development of molecular biology technology, multiple technologies based on nucleic acid operation play a great role in detecting virus diseases, such as Polymerase Chain Reaction (PCR), real-time fluorescence quantitative PCR, gene chips, isothermal amplification of nucleic acids and other technologies can simultaneously detect multiple target pathogens, and the method has the characteristics of rapidness, accuracy, less sample consumption and the like. The multiplex PCR (multiplex PCR) technology has been widely applied to the detection and identification of pathogens such as viruses, bacteria, fungi and the like due to the advantages of rapidness, sensitivity, accuracy and the like, and plays a great role in the early diagnosis of diseases. The multiplex PCR is to add two or more than two target pathogen nucleotide templates and specific primer pairs into the same PCR reaction system at the same time, and amplify two or more than two target genes with different fragment sizes through one-time reaction, so as to distinguish two or more than two target pathogens at the same time. Based on the principle, the invention establishes a multiplex PCR detection system of four pepper viruses such as Cucumber Mosaic Virus (CMV) which is a typical member of cucumber mosaic virus (Cucumovirus) belonging to Bromus mosaic virus family (Bromoviridae), pepper vein mottle virus (ChiVMV) and Potato Virus Y (PVY) of potato virus Y family (Potyviridae) potato virus Y genus (Potyvirus) and broad bean wilting virus No.2 (BBWV2) which is a typical member of broad bean virus (Fabavirus) belonging to cowpea mosaic virus family (Comoviridae) broad bean virus genus (Fabavirus).

Disclosure of Invention

The invention aims to provide a method for synchronously detecting four viruses infecting capsicum. The method can accurately, efficiently and sensitively detect various plant virus disease standard samples at the same time.

A multiplex RT-PCR method for synchronously detecting four pepper viruses of BBWV2, PVY, ChiVMV and CMV comprises the following specific primer pairs in the same PCR system:

the nucleotide sequence of the specific primer for amplifying the BBWV2 is as follows:

SEQ ID NO.1：5′-GCGTCCTGAGTTTGTTGTAGCG-3′，

SEQ ID NO.2：5′-CCTCCATCAAGCCTTGACCATATC-3′；

the nucleotide sequence of the specific primer for amplifying the PVY is as follows:

SEQ ID NO.3：5′-CGGTTCGTTTGAATGCAAGC-3′，

SEQ ID NO.4：5′-CTTGCTGCTTCTCCCCTATGG-3′；

the nucleotide sequence of the specific primer for amplifying the ChiVMV is as follows:

SEQ ID NO.5：5′‐TGGCTGTGCAAGTTACCTTC‐3′，

SEQ ID NO.6：5′‐ACCTGTGTGATGACGTGGGT‐3′；

the nucleotide sequence of the specific primer for amplifying the CMV is as follows:

SEQ ID NO.7：5′-AAANCTTGTTTCGCGCATTCA-3′；

SEQ ID NO.8：5′-GAGGGAGGGTTCTGGGAACA-3′。

the molar ratios of BBWV2, PVY, ChiVMV and CMV primers in the PCR system are respectively 2.5: 1: 2.5: 1.

the total volume of the PCR system is 25 mu L, wherein the PCR system contains 2 mu L of cDNA, 10mM dNTPs 3 mu L, rTaq 1.5U and 25mM MgCl₂1.5. mu.L and 10. mu. mol/L of BBWV2, PVY, ChiVMV and CMV upstream and downstream primers were 0.5. mu.L, 0.2. mu.L, 0.5. mu.L and 0.2. mu.L, respectively.

The PCR amplification reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 seconds, annealing at 57 ℃ for 45 seconds and elongation at 72 ℃ for 90 seconds for 40 cycles; final extension at 72 ℃ for 10 min.

The method is applied to synchronous detection of four pepper virus pathogens BBWV2, PVY, ChiVMV and CMV in crops.

The crops are peppers.

A detection kit contains the four pairs of primers.

The single specific bands of 1406bp,1202bp,600bp and 376bp can be obtained by RT-PCR of the specific primer pairs of the four viruses BBWV2, PVY, ChiVMV and CMV provided by the invention. By optimizing a PCR reaction system and reaction conditions, a multiplex RT-PCR method for synchronously detecting the 4 viruses is established, the technical bottleneck of synchronously detecting four viruses of BBWV2, PVY, ChiVMV and CMV infecting the pepper is broken through, and reference can be provided for identification of other virus pathogens. The specific invention content relates to: 1) extracting virus RNA; 2) designing a specific primer pair and analyzing the specificity; 3) PCR identification system of four viruses; 4) establishing and optimizing a multiplex PCR detection method based on a single PCR technology; 5) and (4) measuring the sensitivity of the multiplex PCR detection method. The optimal system and conditions for the multiplex PCR reaction of the present invention are optimally determined as follows: 10mM dNTPs 3. mu. L, rTaq 1.5.5U, 25mM MgCl₂1.5 μ L, and an annealing temperature of 57 ℃. The optimal reaction conditions for multiplex PCR amplification are: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 seconds, annealing at 57 ℃ for 45 seconds, and extension at 72 ℃ for 90 seconds for 40 cycles; final extension at 72 ℃ for 10 min.

The specific primer pairs of the four viruses can be used as a combination for synchronously detecting the four viruses of BBWV2, PVY, ChiVMV and CMV on the pepper, a single specific band can be obtained by PCR detection, and the primer pairs can be used for identifying 4 pepper virus diseases.

The pepper standard sample compositely infected by the four viruses is a field natural disease plant, is collected from a test field of agricultural science institute of Guizhou province, and is confirmed to carry the four pepper viruses BBWV2, PVY, ChiVMV and CMV by small RNA deep sequencing and PCR identification.

The detection method can be made into a kit for detecting four viruses.

Compared with the prior art, the invention has the following advantages:

1. the invention firstly proposes to synchronously detect four viruses of BBWV2, PVY, ChiVMV and CMV on the pepper;

2. the detection primer pair designed by the invention has specificity and compatibility, and can amplify four viruses in the same standard sample;

3. the invention optimizes the reaction system and conditions of PCR amplification, greatly shortens the detection time and improves the detection efficiency on the premise of ensuring the reliable detection result; the reaction system of the invention has good sensitivity, and the detection bottom line of the multiplex PCR system is 10^-1cDNA。

4. The detection of the invention is completed by one-time amplification reaction in the same PCR system, thereby not only saving the use amount of various reagents of virus RNA and PCR amplification system, especially reverse transcriptase and rTaq, reducing the detection cost to the maximum extent, but also saving the manpower.

Drawings

FIG. 1. schematic representation of the specificity of four virus-specific primers.1-a is the Primer-Blast search result for Primer pair BBWV2-F (SEQ ID NO.1)/BBWV2-R (SEQ ID NO. 2); 1-b is the Primer-Blast search result of the Primer pair PVY-F (SEQ ID NO.3)/PVY-R (SEQ ID NO. 4); 1-c is the Primer-Blast search result of the Primer pair ChiVMV-F (SEQ ID NO.5)/ChiVMV-R (SEQ ID NO. 6); 1-d is the Primer-Blast search result of the Primer pair CMV-F (SEQ ID NO.7)/CMV-R (SEQ ID NO.8)

FIG. 2 PCR amplification results of four virus-specific primers

Lane M represents a nucleic acid standard molecular weight (DL2000DNA Marker), which is 2000bp, 1000bp, 750bp, 500bp and 250bp from top to bottom, respectively; lanes 1-4 are the specific bands of BBWV2, PVY, ChiVMV and CMV in the pepper standard sample, respectively; lane 5 is the result of amplification of healthy plants (negative control), and no specific band was amplified.

FIG. 3 compatible PCR amplification results of four virus-specific primers

Lane M represents a nucleic acid standard molecular weight (DL2000DNA Marker), which is 2000bp, 1000bp, 750bp, 500bp and 250bp from top to bottom, respectively; lane 1 is the result of simultaneous amplification using the specific primers of the four viruses, using the total RNA of a pepper standard sample compositely infected with the four viruses as a template; lane 2 is healthy plants; lanes 3-6 show the amplification results of BBWV2, PVY, ChiVMV, and CMV virus-specific primers, respectively.

FIG. 4 optimization of multiplex PCR System

A, optimizing annealing temperature, wherein lanes 1-5 are respectively 53, 55, 57, 59 and 61 ℃; b, optimizing the dosage of dNTPs, wherein lanes 1-5 are respectively 1, 2, 3, 4 and 5 mu L; optimizing the dosage of rTaq, wherein lanes 1-5 are respectively 0.5, 1.0, 1.5, 2.0 and 2.5U; in the figure, M represents a nucleic acid standard molecular weight (DL2000DNA Marker) of 2000bp, 1000bp, 750bp, 500bp and 250bp from the top to the bottom, respectively.

FIG. 5 sensitivity determination for multiplex PCR system.

Lane M represents a nucleic acid standard molecular weight (DL2000DNA Marker), which is 2000bp, 1000bp, 750bp, 500bp and 250bp from top to bottom, respectively; the cDNA concentrations in lanes 1 to 4 were 10⁰～10^-3。

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and not to limit the scope of the invention.

Example 1 extraction of Total RNA from leaf tissue of Capsicum annuum

Total RNA was extracted from healthy pepper plants co-infected with four viruses BBWV2, PVY, ChiVMV and CMV using TRIzol reagent from Invitrogen, USA. The operation steps are as follows: 1) adding liquid nitrogen into fresh or frozen pepper leaves, fully grinding, and quickly transferring 100mg of dry powder tissues into a 1.5ml of DEPC-treated sterile centrifuge tube frozen by liquid nitrogen; 2) adding 1mL of TRIzol reagent, fully and uniformly mixing, and standing for 5 minutes at room temperature; 3) adding 0.2mL of chloroform, shaking by hand for 15 seconds vigorously, and standing for 2-3 minutes at room temperature; centrifuging at 12000g/4 ℃ for 15 minutes; 4) taking the supernatant, adding isopropanol with the same volume, uniformly mixing, and placing on ice for 10 minutes; centrifuging at 12000g/4 ℃ for 15 minutes, and removing supernatant; 5) adding 1mL of precooled 75% ethanol (prepared by sterile DEPC water) into the precipitate, washing, centrifuging at 7500g/4 ℃ for 5 minutes, and repeatedly washing the precipitate for 3 times; 6) drying the precipitate, adding 50 μ L DEPC treated water to dissolve, and obtaining the pepper total RNA. 7) The purity and concentration of RNA samples were determined by using a NanoDrop-2000 UV spectrophotometer using 1. mu.L of RNA solution. And storing qualified samples in a refrigerator at the temperature of-70 ℃ for later use.

Example 2 design of four Virus-specific primer pairs

According to nucleotide sequences of four viruses such as BBWV2, PVY, ChiVMV, CMV and the like published by NCBI, VectorNTI software is adopted to design a specific primer pair of each virus respectively, the annealing temperature of each pair of primers is similar, certain conservation is realized, an amplification product does not form a secondary mechanism, the GC content is between 40 and 60 percent, the basic groups of the four primers are not complementary, and the primers are synthesized by Shanghai bioengineering limited company (the condition of the 4 primers is shown in Table 1).

Table 1 specific primers in multiplex PCR detection system for four viruses, BBWV2, PVY, ChiVMV and CMV

Example 3 specific detection of four pairs of primers

In example 2, four pairs of primers are designed to detect four viruses, namely BBWV2, PVY, ChiVMV and CMV respectively. The faba virus (Fabavirus) belonging to BBWV2 includes 5 viruses in total, and besides BBWV2 infecting pepper, the other four viruses are faba wilting virus No.1 (Broad bean wilt virus 1, BBWV-1), sesamo mild mosaic virus (LMMV), Cucurbit mosaic virus (CMMV) and Gentian Mosaic Virus (GMV), which do not infect pepper. Similarly, three other viruses belonging to the genus Cucumovirus (Cucumovirus) as CMV, namely, Peanut Stunt Virus (PSV), Tomato Aspermy Virus (TAV), and whipple virus (GMMV), do not infect capsicums. The PVY and ChiVMV belong to Potyvirus, and the primers of the PVY and the ChiVMV do not amplify a band of the other side, which indicates that the primers of the PVY and the ChiVMV have uniqueness.

To ensure the specificity of the primers designed in the present invention, the NCBI's online alignment software Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) The specificity of the primers designed in example 2 was searched. The set amplification length for retrieval is 100-2000 bp, the maximum amplification product length is 2000bp, and All species in an NR (All non-redundant GenBank CDS transitions + RefSeq Proteins + PDB + SwissProt + PIR + PRF) database are retrieved. The results show that: the search result with BBWV2-F (SEQ ID NO.1)/BBWV2-R (SEQ ID NO.2) as primer pair obtains 6 possible amplification products with the length of 1406bp, which belong to BBWV2, and other species (such as 1-a in FIG. 1) are not searched; searching by taking PVY-F (SEQ ID NO.3)/PVY-R (SEQ ID NO.4) as a primer pair to obtain 287 pieces of possible amplification products with the length of 1202bp and 1 piece of possible amplification products with the length of 1205bp, wherein the possible amplification products belong to PVY (such as 1-b in figure 1), and other species are not searched; using ChiVMV-F (SEQ ID NO.5)/ChiVMV-R (SEQ ID NO.6) as a primer pair for searching, obtaining 2 possible amplification results (such as 1-c in figure 1) with the length of 600bp in total, belonging to ChiVMV and not finding other species; CMV-F (SEQ ID NO.7)/CMV-R (SEQ ID NO.8) is used as a primer pair for searching, 280 possible amplification results (such as 1-d in figure 1) with the length of 355-383 bp are obtained in total, and the amplification results belong to CMV and have no possibility of gene amplification of other species. Therefore, the designed primer of the invention is demonstrated to have specificity.

Example 4 RT-PCR System for four Capsicum viruses

Synthesis of cDNA: the total reaction volume was 20. mu.L, where 1. mu.L of total Capsicum RNA (1. mu.g/. mu.L), 2. mu.L of downstream primer (10. mu. mol/. mu.L), DEPC-treated ddH₂O8 mu L, uniformly mixing, denaturing at 90 ℃ for 1min, and immediately placing on ice for 2 min; dNTPs (10mM) 2. mu.L, 5 XMMLV Buffer 4. mu.L, M-MLV reverse transcriptase (Promega, USA) 1. mu.L and RR were added in this orderI (Takara, China) 0.5. mu.L. Mixing, incubating at 37 deg.C for 1hr, and incubating at 70 deg.C for 10 min.

And (3) PCR reaction system: the total reaction volume was 25. mu.L, 2. mu.L of cDNA in the reaction, 10 XPCR Buffer (15mM Mg)²⁺) 2.5. mu.L of dNTPs (10mM) 2. mu.L, upstream and downstream primers 0.3. mu.L each, rTaq (Takara, China)1U, plus ddH₂And the content of O is filled up to 25 mu L. The amplification conditions were 94 ℃ pre-denaturation for 3min, 40 cycles of 94 ℃ 30s, 57 ℃ 45s and 72 ℃ 90s, and final 72 ℃ extension for 10 min. And (3) carrying out electrophoresis on the PCR amplification product on 1% agarose gel at the voltage of 2 volts per centimeter for 1.5-2 hours, and observing the picture under ultraviolet. And (3) displaying an electrophoresis result: single bands of 1406bp,1202bp,600bp and 376bp were obtained by amplification with specific primers for BBWV2, PVY, ChiVMV and CMV, respectively (FIG. 2 lanes 1-4).

The electrophoresis strip is recovered, purified and connected to a pEASY-T5 Vector (Beijing all-purpose gold biotechnology, Inc.), a freeze-thaw method is adopted to transform competent cells of Trans-T1 (Beijing all-purpose gold biotechnology, Inc.), 3 PCR positive monoclonals are selected, sequencing is carried out by Beijing Liuhe Huada Gen technology, Inc., Vector NTI software is adopted for comparison, and the result shows that the obtained BBWV2, PVY, ChiVMV and CMV four virus sequences have the consistency of 98.3%, 99.1%, 99.2% and 98.7% respectively with the original reference sequence, and the consistency is more than 98%, thus the correctness of the amplification result is proved.

Example 5 establishment of multiplex RT-PCR System for four viruses

The multiplex PCR reaction is to detect multiple viruses in one PCR reaction system, so that RNA and primers in the multiplex PCR reaction system are both a mixture of multiple viral RNAs and specific primer pairs, and the concentrations of other designs such as reverse transcriptase, RNA polymerase, dNTPs and the like are the same. The nucleotide template used in the invention is total RNA of pepper plants infected by four viruses of BBWV2, PVY, ChiVMV and CMV simultaneously; the primers are a mixture of four virus-specific primer pairs, the optimal ratio of the primer pairs is BBWV 2: PVY: ChiVMV: CMV ═ 2.5: 1: 2.5: 1, the results show that 4 pairs of primers respectively amplify single bands of 1406bp,1202bp,600bp and 376bp, and have good compatibility (FIG. 3, Lane 1).

Optimization of a PCR reaction system: the invention optimizes different annealing temperatures, dNTPs, rTaq concentrations and the like. The annealing temperature was set with 5 gradients of 53, 55, 57, 59 and 61 ℃; in a total reaction volume of 25 μ L, dNTPs doses were set with 5 gradients of 1, 2, 3, 4 and 5 μ L, and rTaq doses were set with 5 gradients of 0.5, 1.0, 1.5, 2.0 and 2.5U, with optimization showing: the optimal annealing temperature was 57 ℃, 3. mu.L of 10mM dNTPs and 1.5U of rTaq (see FIG. 4).

The optimal multiplex RT-PCR system is: the total volume of the cDNA synthesis reaction was 20. mu.L, wherein 1. mu.L of total Capsicum RNA (1. mu.g/. mu.L), 2. mu.L of downstream primer (10. mu. mol/. mu.L), DEPC-treated ddH₂O8 mu L, uniformly mixing, denaturing at 90 ℃ for 1min, and immediately placing on ice for 2 min; dNTPs (10mM) 2. mu.L, 5 XMMLV Buffer 4. mu.L, M-MLV reverse transcriptase (Promega, USA) 1. mu.L and RRI (Takara, China) 0.5. mu.L were added in this order. Mixing, incubating at 37 deg.C for 1hr, and incubating at 70 deg.C for 10 min. mu.L of cDNA from the above synthesis system was taken, and 10 XPCR Buffer (15mM Mg)²⁺) 2.5. mu.L, 3. mu.L dNTPs (10mM), 1.5U rTaq (Takara, China), and 0.5, 0.2. mu.L BBWV2, PVY, ChiVMV, CMV upstream and downstream primers, respectively, plus ddH₂And the content of O is filled up to 25 mu L.

The optimal reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 seconds, annealing at 57 ℃ for 45 seconds, and extension at 72 ℃ for 90 seconds for 40 cycles; final extension at 72 ℃ for 10 min.

And (3) carrying out electrophoresis on the PCR reaction product on 1% agarose gel at the voltage of 2 volts per centimeter for 1.5-2 hours, and observing the picture under ultraviolet. And (3) displaying an electrophoresis result: single bands of 1406bp,1202bp,600bp and 376bp were obtained by amplification with specific primers for BBWV2, PVY, ChiVMV and CMV, respectively (FIG. 3 lanes 3-6).

Example 6 sensitivity determination of multiplex PCR System

The cDNA concentrations obtained according to example 4 were diluted 1, 10, 100 and 1000 times (i.e., 10 times) respectively⁰-10^-3) Other PCR amplification conditions are unchanged, and results show that four viruses, namely BBWV2, PVY, ChiVMV and CMV can be well detected when cDNA is diluted by 1 time and 10 times; when diluted 100 times, BBWV2 bands are fuzzy, and three viruses, namely PVY, ChiVMV and CMV, can be detected; however, when diluted 1000-fold, no BBWV2 and PVY, ChiVMV and CMV were detected under these four concentration gradientsAll can be detected (see FIG. 5), therefore, the bottom line of the multiplex PCR system is 10^-1cDNA。

EXAMPLE 7 use of multiplex RT-PCR System

The established multiplex PCR system is used for detecting 4 pepper standard samples which are collected from Guiyang city of Guizhou province in 2016 and show that: three viruses BBWV, ChiVMV and CMV were amplified in

samples

1 and 3, and four viruses BBWV, ChiVMV, CMV and PVY were amplified in

samples

2 and 4. The consistency of the monoclonal sequencing result and the reference sequence is more than 98 percent, which shows that the multiple RT-PCR detection system established by the invention can be used for detecting field standard samples and has reliable results.

SEQUENCE LISTING

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> a multiplex PCR method for synchronously detecting 4 pepper viruses

<130>PP17009-ZWB

<160>8

<170>PatentIn version 3.3

<210>1

<211>22

<212>DNA

<213> specific primers for amplification of BBWV2

<400>1

gcgtcctgag tttgttgtag cg 22

<210>2

<211>24

<212>DNA

<213> primer 2 specific for amplification of BBWV2

<400>2

cctccatcaa gccttgacca tatc 24

<210>3

<211>20

<212>DNA

<213> primer 1 specific for amplification of PVY

<400>3

cggttcgttt gaatgcaagc 20

<210>4

<211>21

<212>DNA

<213> primer 2 specific for amplification of PVY

<400>4

cttgctgctt ctcccctatg g 21

<210>5

<211>20

<212>DNA

<213> ChiVMV amplification specific primer 1

<400>5

tggctgtgca agttaccttc 20

<210>6

<211>20

<212>DNA

<213> ChiVMV amplification specific primer 2

<400>6

acctgtgtga tgacgtgggt 20

<210>7

<211>21

<212>DNA

<213> primer 1 specific for amplification of CMV

<220>

<221>misc_feature

<222>(4)..(4)

<223>n is a, c, g, or t

<400>7

aaancttgtt tcgcgcattc a 21

<210>8

<211>20

<212>DNA

<213> primer 2 specific for amplification of CMV

<400>8

gagggagggt tctgggaaca 20

Claims

1. A multiplex RT-PCR method for synchronously detecting four pepper viruses of BBWV2, PVY, ChiVMV and CMV comprises the following specific primers in the same PCR system:

SEQ ID NO.1：5′-GCGTCCTGAGTTTGTTGTAGCG-3′，

SEQ ID NO.2：5′-CCTCCATCAAGCCTTGACCATATC-3′；

SEQ ID NO.3：5′-CGGTTCGTTTGAATGCAAGC-3′，

SEQ ID NO.4：5′-CTTGCTGCTTCTCCCCTATGG-3′；

SEQ ID NO.5：5′‐TGGCTGTGCAAGTTACCTTC‐3′，

SEQ ID NO.6：5′‐ACCTGTGTGATGACGTGGGT‐3′；

SEQ ID NO.7：5′-AAANCTTGTTTCGCGCATTCA-3′；

SEQ ID NO.8：5′-GAGGGAGGGTTCTGGGAACA-3′。

2. the method of claim 1, wherein the molar ratio of the BBWV2, PVY, ChiVMV and CMV primers in the PCR system is 2.5: 1: 2.5: 1.

3. the method of claim 2, wherein the PCR system comprises a total volume of 25 μ L, 2 μ L cDNA, 3 μ L, rTaq 1.5.5U 10mM dNTPs, 25mM MgCl₂1.5. mu.L and 10. mu. mol/L of BBWV2, PVY, ChiVMV and CMV upstream and downstream primers were 0.5. mu.L, 0.2. mu.L, 0.5. mu.L and 0.2. mu.L, respectively.

4. The method of claim 3, wherein the PCR amplification reaction conditions are: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 seconds, annealing at 57 ℃ for 45 seconds and elongation at 72 ℃ for 90 seconds for 40 cycles; final extension at 72 ℃ for 10 min.

5. Use of the method according to any one of claims 1 to 4 for the simultaneous detection of the four pepper virus pathogens BBWV2, PVY, ChiVMV and CMV in crop plants.

6. Use according to claim 5, wherein the crop is capsicum.

7. A detection kit contains primers for detecting four pepper viruses of BBWV2, PVY, ChiVMV and CMV, which are respectively as follows:

SEQ ID NO.1：5′-GCGTCCTGAGTTTGTTGTAGCG-3′，

SEQ ID NO.2：5′-CCTCCATCAAGCCTTGACCATATC-3′；

SEQ ID NO.3：5′-CGGTTCGTTTGAATGCAAGC-3′，

SEQ ID NO.4：5′-CTTGCTGCTTCTCCCCTATGG-3′；

SEQ ID NO.5：5′‐TGGCTGTGCAAGTTACCTTC‐3′，

SEQ ID NO.6：5′‐ACCTGTGTGATGACGTGGGT‐3′；

SEQ ID NO.7：5′-AAANCTTGTTTCGCGCATTCA-3′；

SEQ ID NO.8：5′-GAGGGAGGGTTCTGGGAACA-3′。