CN107385117B

CN107385117B - Detection method for composite virus disease (SPVD) pathogen of sweet potato seed

Info

Publication number: CN107385117B
Application number: CN201710855039.5A
Authority: CN
Inventors: 张道微; 董芳; 张超凡; 黄艳岚; 周虹; 张亚
Original assignee: HUNAN INSTITUTE OF CROPS
Current assignee: HUNAN INSTITUTE OF CROPS
Priority date: 2017-09-20
Filing date: 2017-09-20
Publication date: 2021-08-10
Anticipated expiration: 2037-09-20
Also published as: CN107385117A

Abstract

The invention provides a detection method of sweet potato seed potato composite virus disease (SPVD) pathogen, which comprises the following steps: extracting RNA of sweet potato seeds; reverse transcribing the RNA to cDNA; performing a first round of PCR amplification by using cDNA as a template and performing a first round of detection on a first round of amplification product by using agarose gel electrophoresis, wherein the designed primers comprise an outer primer and an inner primer; separating the first round of amplification products by agarose gel electrophoresis, and recovering the target DNA; and performing a second round of amplification of the PCR with the recovered target DNA as a template using the inner primers, and performing a second round of detection on the second round amplification product by agarose gel electrophoresis. The method effectively shortens the detection time, improves the detection accuracy, and is suitable for the actual production processes of sampling and detecting the sweet potato seeds and the like.

Description

Detection method for composite virus disease (SPVD) pathogen of sweet potato seed

Technical Field

The invention relates to the technical field of crop disease and insect pest detection, and particularly relates to a detection method of a sweet potato seed potato composite virus disease (SPVD) pathogen.

Background

Sweet potato complex virus diseases (SPVD) are viral diseases caused by the synergistic co-infection of Sweet Potato Chlorosis Stunt Virus (SPCSV) and Sweet Potato Feathery Mottle Virus (SPFMV) with Sweet potato. In the synergistic infection process, the SPCSV acts as an excitation virus to mediate the synergistic effect between the two, so that convenience is provided for the replication and transportation of the SPCMV in plants, the pathogenicity of the SPCMV is obviously enhanced, and the symptom is more obvious. The synergistic effect can promote the movement and accumulation of viruses in plants, influence the yield of storage roots and aggravate the symptoms of virus diseases, thereby causing the yield reduction and the quality damage of sweet potatoes and causing the loss of harvest in severe cases.

At present, SPVD has the most extensive harm to sweet potatoes, is easy to quickly spread through transmission media such as bemisia tabaci and the like, and the development of the logistics industry further aggravates the trans-regional transmission speed. Once sweet potatoes are infected with the compound virus disease, other direct and effective prevention and control modes are not available at present except virus-free breeding, so that virus-free fine variety breeding of the sweet potatoes and detection of the quality of fine variety breeding are main measures for preventing and controlling the compound virus disease of the sweet potatoes from being rapidly spread through logistics. The breeding of the sweet potato virus-free seed potatoes has achieved considerable effect at home and abroad, but the detection of the virus-free effect and the quality control of the seed potatoes need to be strengthened at present. The methods of phenotype identification, physiological index detection and the like require longer time and are greatly limited in practical production application, and the mainstream sweet potato compound virus disease rapid detection method mainly takes an enzyme-linked immunosorbent assay method and a fluorescent quantitative PCR (polymerase chain reaction) assay method as main materials, has the problems of high requirement on detection equipment, high detection cost, false positive and false negative and the like, and is not easy to accept in the practical production process.

Disclosure of Invention

In order to solve the technical problems in the prior art, the invention provides a detection method of a sweet potato seed potato composite virus disease (SPVD) pathogen, which comprises the following steps:

extracting RNA of sweet potato seeds;

reverse transcribing the RNA to cDNA;

performing a first round of PCR amplification by using cDNA as a template and performing a first round of detection on a first round of amplification product by using agarose gel electrophoresis, wherein the designed primers comprise an outer primer and an inner primer;

separating the first round of amplification products by agarose gel electrophoresis, and recovering the target DNA; and

and performing second round amplification of PCR by using the recovered target DNA as a template and performing second round detection on the second round amplification product by agarose gel electrophoresis.

In the above detection method, the sweet potato seed-potato complex virus disease (SPVD) pathogens include Sweet Potato Chlorotic Stunt Virus (SPCSV) and sweet potato pinnate mottle virus (SPFMV).

In the detection method, the RNA of the sweet potato seed is extracted by an SDS-LiCl method.

In the above detection method, the outer primers for the Sweet Potato Chlorotic Stunt Virus (SPCSV) to perform the first round of amplification of PCR are:

CS-F1：GACTCAGATTTGGAAACTAACC；

CS-R1：CGGACGTACTCTGATTTGC。

in the detection method, the outer primers for the first round of amplification of the sweet potato lupoid mottle virus (SPFMV) by the PCR are:

FM-F1：GCAGATTATGACGCACTTCAG；

FM-R1：CACACCCCTCATTCCTAAGAG。

in the above detection method, the inner primers for the first round of amplification by PCR and the second round of amplification by PCR of the Sweet Potato Chlorotic Stunt Virus (SPCSV) are:

CS-F1：GACTCAGATTTGGAAACTAACC；

CS-R2：GAGCTAACTGGTCTGAGG。

in the above detection method, the inner primers for the first round of amplification of PCR and the second round of amplification of PCR of the sweet potato lupous mottle virus (SPFMV) are:

FM-F2：GGTTGTTTGGTTTGGACGG；

FM-R1：CACACCCCTCATTCCTAAGAG。

in the detection method, the reference primers for performing the first round of amplification of the PCR are:

Actin-F：TGAGCAAGGAAATAACAG，

Actin-R：GCTAGAACATATAAGGTCTC；

H₂b-F：CAAGGTTCTCAAACAGGTC，

H₂b-R: GCTTGTAAACTTAGTCACG, respectively; and

UBI-F：GAGGTTGAATCGTCAGAC，

UBI-R:GACTCATCCACCTTGTAG。

in the above detection method, the target DNA of the Sweet Potato Chlorotic Stunt Virus (SPCSV) has a length of 338 bp; and the target DNA of the sweet potato pinnate mottle virus (SPFMMV) is 325bp in length.

In the above detection method, the target DNA of the Sweet Potato Chlorotic Stunt Virus (SPCSV) and the target DNA of the sweet potato pinnate mottle virus (SPFMV) are both the first round of PCR amplification products.

Compared with the prior art, the invention has the following advantages:

1. the method has short detection period, only needs 2 working days in the whole process from sample collection to detection result acquisition, is equivalent to the detection period of enzyme-linked immunosorbent assay and fluorescent quantitative PCR, and saves more time than detection methods such as physiological index detection and the like.

2. The requirement on the instrument is low, and special instruments such as an enzyme-linked immunosorbent assay and a fluorescent quantitative PCR assay are not needed under the condition that the detection period is equivalent to that of the enzyme-linked immunosorbent assay and the fluorescent quantitative PCR assay.

3. The detection accuracy is high, the technology is based on a PCR detection technology, the sensitivity is higher than that of an enzyme-linked immunosorbent assay by more than 2 orders of magnitude, false positive and false negative caused by antibody quality can be effectively avoided, the enzyme-linked immunosorbent assay depends on the antibody quality, the antibody quality of different batches is different, and the detection effect is greatly different; meanwhile, the semi-nested PCR is used for two rounds of detection, so that the appearance of false positive and false negative in a fluorescent quantitative PCR detection method can be effectively avoided.

4. The relative cost is low, the enzyme-linked immunosorbent assay needs a specially-made antibody, and the manufacturing cost of the antibody is higher at present; in the case of the similar operation flow as the fluorescent quantitative PCR, the cost of reagent consumption is only about 1/5 of the fluorescent quantitative PCR detection method.

5. Easy popularization and grasp, low requirement on the professional skill of a detector, no need of mastering professional analysis software, and visual and clear results can be obtained according to agarose electrophoresis.

Drawings

FIG. 1 is a graph showing the results of the first round detection of the first round outer primer amplification products of the species SPCSV of sweetpotato (M denotes D2000 DNA mark, 1-16 denote 16 samples of sweetpotato, respectively);

FIG. 2 is a graph showing the results of the first round detection of the first round outer primer amplification products of the species SPFMFV of sweetpotato (M denotes D2000 DNA mark, 1-16 denote 16 samples of sweetpotato, respectively);

FIG. 3 is a diagram showing the results of the first round of detection of the first round inner primer amplification products of the SPCSV of the seed sweet potato (M denotes D2000 DNA mark, 1-11 denote 11 sweet potato samples, respectively);

FIG. 4 is a graph showing the results of the first round detection of the amplification products of the first round inner primers of the species SPFMFV of sweetpotato (M denotes D2000 DNA mark, 1-11 denote 11 samples of sweetpotato, respectively);

FIG. 5 is a graph showing the results of detection of internal reference primers (M denotes D2000 DNA mark, and 1-2 denote internal reference IbH, respectively₂b, a gene target strip, 3-4 respectively represent reference beta-actin gene target strips, and 5-9 respectively represent reference IbUBI gene target strips);

FIG. 6 is a second round detection result chart of the second round inner primer amplification product of the sweet potato seed SPCSV;

FIG. 7 is a graph showing the results of the second round of detection of the amplification products of the second round inner primers of the sweet potato seed SPCMV;

FIG. 8 shows the analysis of the results of the first round of PCR amplification product detection of SPCSV (2S85 represents the inner primer amplification sequence, 1S85 represents the outer primer amplification sequence, FJ8077 represents the sequence of the SpCSV West African strain (National Center for Biotechnology Information website accession number FJ807785.1), and Consensus represents the Consensus sequence);

FIG. 9 shows the results of the first PCR amplification product detection analysis of SPFMVs (2 SPFMFVs for inner primer amplification sequences, 1 SPFMFV for outer primer amplification sequences, HQ844111 for the sequence of the West African strain of SPFMMV (National Center for Biotechnology Information website accession number HQ844111.1), Consensus sequences).

Detailed Description

The invention provides a detection method of sweet potato seed potato complex virus disease (SPVD) pathogen, in the method, the improved SDS-LiCl method is used for extracting RNA of the sweet potato seed potato, because the sweet potato seed potato contains abundant starch and polyphenol substances, the extraction and the later detection of the RNA are not facilitated, and simultaneously, the purity and the integrity of the RNA are the premise of ensuring the detection accuracy, therefore, the invention adopts the improved SDS-LiCl method, greatly reduces the interference of the polysaccharide and the polyphenol substances, and also fully ensures the integrity of the RNA.

Further, the RNA is reverse transcribed into cDNA; performing a first round of amplification of the half nested PCR by using the cDNA as a template and designing primers (comprising an outer primer and an inner primer), and performing a first round of detection on an amplification product of the first round by using agarose gel electrophoresis; separating the first round of amplification products by agarose gel electrophoresis, and recovering the target DNA; and using the recovered target DNA as a template, performing a second round of amplification of the half nested PCR by using the inner primer, and performing a second round of detection on an amplification product of the second round by using agarose gel electrophoresis; in this method, a first round of detection is performed on a first round of amplification products by agarose gel electrophoresis, while a target size of DNA (i.e., an outer primer product of the first round of amplification of the target size PCR, with a product length of 338bp) is screened out by the first round of detection results, a second round of amplification is performed using an inner primer using the target size of DNA as a template, and a second round of detection is performed. And the samples are comprehensively analyzed according to the first round of detection results and the second round of detection results, so that the accuracy of the detection results is ensured, and the false negative rate and the false positive rate of sample detection are effectively reduced.

The following examples are intended to illustrate the invention, but not to limit it in any way.

Step 1: extraction of RNA from potato blocks by SDS-LiCl method

1) Taking a complete sweet potato seed to be detected, cutting 0.5g of the whole sweet potato seed, chopping the whole sweet potato seed with a blade, grinding the cut sweet potato seed into powder by using liquid nitrogen, putting the powder into a 2mL centrifuge tube precooled at minus 10-0 ℃, directly and respectively chopping the sample when the number of the sample is large, putting the sample into a 2mL centrifuge tube with a round bottom, adding a small amount of liquid nitrogen, and mashing the sample with a small mallet.

Note that: the materials such as blades, mortar and centrifuge tube ensure that the RNA enzyme is inactivated at high temperature before use or soaked in water of RNA enzyme inhibitor DEPC (diethyl pyrocarbonate), and then sterilized and dried in an autoclave for reuse, and the RNA enzyme is not reused in the primary extraction process.

2) 0.5mL of each of the extracts (extract components: 0.1M lithium chloride, 100 mM tris-HCl (tris (hydroxymethyl) aminomethane) pH 8.0,10mM EDTA (ethylenediaminetetraacetic acid), 1% SDS (sodium dodecyl sulfate)) and 0.5mL of water-saturated phenol, and thoroughly shaken and mixed for 30 s;

3) 0.5mL of chloroform/isoamyl alcohol (V/V25: 1) was added thereto, the mixture was sufficiently shaken and mixed, and the mixture was centrifuged at 12000rpm at 4 ℃ for 5 minutes.

4) The supernatant was transferred to another centrifuge tube, an equal volume of 4M LiCl (lithium chloride) was added, the mixture was precipitated at 4 ℃ for 3 hours, and centrifuged at 12000rpm at 4 ℃ for 10 min.

5) The supernatant was removed, 250mL DEPC treated water was added, 25mL 3M NaOAc (sodium acetate) (pH 5.2) was added, and 625mL of a-10-0 ℃ pre-cooled absolute ethanol solution was added.

6) Centrifuging at 12000rpm at 4 deg.C for 10min, removing supernatant, resuspending with 70% ethanol solution, and centrifuging at 13000rpm at 4 deg.C for 5 min.

7) And (3) sucking the supernatant by using a pipette as much as possible, completely airing, and adding 100 mu L of DEPC (diethylpyrocarbonate) treatment water to obtain a solution, namely the RNA extracted from the sample.

Step 2: reverse transcription of RNA into cDNA

1) Denaturation of RNA template

The following mixtures were prepared in RNase free centrifuge tubes (Shanghai Baomann Biotech Co., Ltd.):

the PCR tube (Shanghai Ming Jiang Bio-technology Co., Ltd.) was heated at 65 ℃ for 5min, and then quickly transferred to ice cubes and allowed to stand for 2 min.

2) Preparing a first strand cDNA synthesis reaction solution, and gently and uniformly mixing by using a pipette, wherein the synthesis reaction solution is as follows:

3) first Strand cDNA Synthesis reaction was carried out under the following conditions

And step 3: taking cDNA as a template, carrying out first round amplification of half nested PCR by using a designed primer, and carrying out first round detection on a first round amplification product by using agarose gel electrophoresis, wherein the first round amplification product comprises the following specific steps:

3ng of cDNA is taken as a template, an outer primer (CS-F1: GACTCAGATTTGGAAACTAACC; CS-R1: CGGACGTACTCTGATTTGC) and an inner primer (CS-F1: GACTCAGATTTGGAAACTAACC; CS-R2: GAGCTAACTGGTCTGAGG) are utilized to carry out the first round of PCR amplification of SPCSV, and the lengths of target bands of the first round of inner primer amplification product and the first round of outer primer amplification product of the SPCSV are 338bp and 108bp respectively;

performing a first round of PCR amplification of SPFMMV by using an outer primer (FM-F1: GCAGATTATGACGCACTTCAG; FM-R1: CACACCCCTCATTCCTAAGAG) and an inner primer (FM-F2: GGTTGTTTGGTTTGGACGG; FM-R1: CACACCCCTCATTCCTAAGAG), wherein the lengths of target bands of the inner primer amplification product and the outer primer amplification product of the first round of SPFMMV are 325bp and 102bp respectively;

the internal reference primer is (Actin-F: TGAGCAAGGAAATAACAG; Actin-R: GCTAGAACATATAAGGTCTC); (H)₂b-F：CAAGGTTCTCAAACAGGTC； H₂b-R: GCTTGTAAACTTAGTCACG) and (UBI-F: GAGGTTGAATCGTCAGAC, respectively; GACTCATCCACCTTGTAG) and the lengths of the target bands of the amplification products of the internal reference primers are 279bp, 244bp and 244bp respectively.

The reaction system is as follows:

the amplification program comprises pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 10min and 36 cycles;

thereafter, the first round of detection was performed by electrophoresis on 1.5% agarose gel.

And 4, step 4: separating the first round amplification products by agarose gel electrophoresis, and recovering the DNA of interest

And (3) separating the first round of PCR amplification products of the inner primers and the outer primers obtained in the step (3) by utilizing 1.2% agarose gel electrophoresis added with a Goldview stain, fully separating the first round of PCR amplification products by the agarose gel electrophoresis, photographing under a gel imaging system or an ultraviolet lamp to obtain an electrophoresis result, and recovering a target strip of the first round of PCR amplification products of the outer primers by using an agarose gel recovery kit, namely, performing agarose gel electrophoresis recovery on DNA fragments with target sizes.

And 5: using the recovered target DNA as a template, performing a second round of amplification of the half nested PCR by using the inner primer, and performing a second round of detection on the second round of amplification products by using agarose gel electrophoresis

Carrying out PCR second-round inner primer amplification of SPCSV by using the recovered PCR first-round amplification outer primer product (namely the target DNA) as a template and using an inner primer (CS-F1: GACTCAGATTTGGAAACTAACC; CS-R2: GAGCTAACTGGTCTGAGG); the length of the second round inner primer amplification product of the SPCSV is 108 bp;

performing PCR second round inner primer amplification of SPCMV by using inner primers (FM-F2: GGTTGTTTGGTTTGGACGG; FM-R1: CACACCCCTCATTCCTAAGAG); the second round inner primer amplification product of SPFMV is 102bp in length.

The reaction system is as follows:

the amplification program comprises pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 10min and 38 cycles;

thereafter, a second round of detection was performed by 2% agarose gel electrophoresis.

And (3) detection results:

the length of a target band amplified by the outer primer of the PCR of the SPCSV is 338bp, and the length of a target band amplified by the inner primer of the PCR is 108 bp;

the length of the target band amplified by the outer primer of the PCR of the SPFMMV is 325bp, and the length of the target band amplified by the inner primer of the PCR is 102 bp.

Under the condition that the internal reference works normally:

1) if the sample can obtain the target band from the inner primer amplification product and the outer primer amplification product of the first round of PCR of the sample in the first round and can also obtain the target band from the inner primer amplification product of the second round in the second round of detection, the sample is a positive sample infected with the corresponding virus;

2) if the sample can obtain a target band from the first round outer primer amplification product of the PCR of the sample in the first round detection, and the first round inner primer amplification product has no target band, and the sample can obtain a target band from the second round inner primer amplification product in the second round detection, the sample is a false negative sample, namely, a positive sample infected with the corresponding virus;

3) if the sample can obtain a target band in the first round of the PCR product of the sample in the first round, the first round of the PCR product of the sample has no target band, and the second round of the PCR product of the sample in the second round of the detection has no target band, the sample is a false positive sample; i.e., a negative sample not infected with the corresponding virus;

4) if the target band is not obtained from the first round inner primer amplification product and the first round outer primer amplification product of the PCR of the sample in the first round detection, the sample is a negative sample which is not infected by the corresponding virus.

In the invention, the method of combining the first round of detection and the second round of detection is adopted to realize the rapid and accurate detection of the pathogen of the sweet potato seed potato compound virus disease (SPVD), the whole detection process only needs 2 working days, which is equivalent to the detection time of enzyme-linked immunosorbent assay and fluorescent quantitative PCR, effectively shortens the detection time, reduces the detection cost, improves the detection accuracy, and avoids the problems of false positive, false negative and the like, therefore, the method provided by the invention is suitable for the actual production processes of sampling detection and the like of the sweet potato seed potatoes.

The foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding. It will be apparent to those skilled in the art that changes and modifications may be made within the scope of the appended claims. Accordingly, it is to be understood that the above description is intended to be illustrative, and not restrictive. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims, along with the full scope of equivalents to which such claims are entitled.

Sequence listing

<110> institute for crop study in Hunan province

<120> detection method for sweet potato seed potato composite virus disease (SPVD) pathogen

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> unknown ()

<400> 1

gactcagatt tggaaactaa cc 22

<210> 2

<211> 19

<212> DNA

<213> unknown ()

<400> 2

cggacgtact ctgatttgc 19

<210> 3

<211> 18

<212> DNA

<213> unknown ()

<400> 3

gagctaactg gtctgagg 18

<210> 4

<211> 21

<212> DNA

<213> unknown ()

<400> 4

gcagattatg acgcacttca g 21

<210> 5

<211> 19

<212> DNA

<213> unknown ()

<400> 5

ggttgtttgg tttggacgg 19

<210> 6

<211> 21

<212> DNA

<213> unknown ()

<400> 6

cacacccctc attcctaaga g 21

<210> 7

<211> 18

<212> DNA

<213> unknown ()

<400> 7

tgagcaagga aataacag 18

<210> 8

<211> 20

<212> DNA

<213> unknown ()

<400> 8

gctagaacat ataaggtctc 20

<210> 9

<211> 19

<212> DNA

<213> unknown ()

<400> 9

caaggttctc aaacaggtc 19

<210> 10

<211> 19

<212> DNA

<213> unknown ()

<400> 10

gcttgtaaac ttagtcacg 19

<210> 11

<211> 18

<212> DNA

<213> unknown ()

<400> 11

gaggttgaat cgtcagac 18

<210> 12

<211> 18

<212> DNA

<213> unknown ()

<400> 12

gactcatcca ccttgtag 18

<210> 13

<211> 227

<212> DNA

<213> unknown ()

<400> 13

tgactcagat ttggaaacta acccaaagaa taaactacag tccgagtatg cgtctcgtcg 60

tgacgtccag actgaaggaa cggctggttt gggaagacga gatatggagt taactagtgg 120

tattcttacc tcagaccagt tagcacttgc aagattgggt aagatccaag tatattccaa 180

ttctccagat attatgtcaa agagtcaaga ggatgagttt aagcgtc 227

<210> 14

<211> 240

<212> DNA

<213> unknown ()

<400> 14

agaactttga ttccgactca gatttggaaa ctaacccaaa gaataaacta cagtccgagt 60

atgcgtctcg tcgtgacgtc cagactgaag gaacggctgg tttgggaaga cgagatatgg 120

agttaactag tggtattctt acctcagacc agttagctct tgcaagattg ggtaagatcc 180

aagtatattc caattctcca gatattatgt caaagagtca agaggatgag tttaagcgtc 240

<210> 15

<211> 147

<212> DNA

<213> unknown ()

<400> 15

tgactcagat ttggaaacta acccaaagaa taaactacag tccgagtatg cgtctcgtcg 60

tgacgtccag actgaaggaa cggctggttt gggaagacga gatatggagt taactagtgg 120

tattcttacc tcagaccagt tagctca 147

<210> 16

<211> 227

<212> DNA

<213> unknown ()

<400> 16

tgactcagat ttggaaacta acccaaagaa taaactacag tccgagtatg cgtctcgtcg 60

tgacgtccag actgaaggaa cggctggttt gggaagacga gatatggagt taactagtgg 120

tattcttacc tcagaccagt tagctcttgc aagattgggt aagatccaag tatattccaa 180

ttctccagat attatgtcaa agagtcaaga ggatgagttt aagcgtc 227

<210> 17

<211> 253

<212> DNA

<213> unknown ()

<400> 17

actagagatg cagcaccgta caaggcatac rtgccraggt atggtctaca acgtaatttg 60

actgatatga gtcttgcgcg atatgcattt gatttttacg agctgcattc aactacacct 120

gcacgtgcta aagaagcaca tttacagatg aaggcagccg cacttaagaa tgcgcgaaat 180

cggttgtttg gtttggacgg aaacgtctcc acgcaagaag aagatrcgga gaggcacacg 240

acaactgacg tac 253

<210> 18

<211> 333

<212> DNA

<213> unknown ()

<400> 18

cagattatga cgcacttcag tgacgttgct gaagcttaca tagagatgcg aaaccgtaca 60

aaggcataca tgccaaggta tggtctacaa cgtaatttga ctgatatgag tcttgcgcga 120

tatgcatttg atttctacga gctgcattca actacacctg cacgtgctaa agaagcacat 180

ttacagatga aagcagccgc acttaagaat gcgcgaaatc ggttgtttgg tttggacgga 240

aacgtctcca cgcaagaaga agatrcggag aggcacacga caactgatgt tactagaaat 300

atacataacc tcttaggaat gaggggtgtg caa 333

<210> 19

<211> 112

<212> DNA

<213> unknown ()

<400> 19

gggttgtttg gtttggacgg aaacgtctcc acgcaagaag aagatrcgga gaggcacacg 60

acaactgatg ttactagaaa tatacataac ctcttaggaa tgaggggtgt gt 112

<210> 20

<211> 284

<212> DNA

<213> unknown ()

<400> 20

tagagatgca ccgtacaagg catacatgcc aaggtatggt ctacaacgta atttgactga 60

tatgagtctt gcgcgatatg catttgattt tacgagctgc attcaactac acctgcacgt 120

gctaaagaag cacatttaca gatgaagcag ccgcacttaa gaatgcgcga aatcggttgt 180

ttggtttgga cggaaacgtc tccacgcaag aagaagatrc ggagaggcac acgacaactg 240

atgttactag aaatatacat aacctcttag gaatgagggg tgtg 284

Claims

1. A detection method of sweet potato seed potato compound virus pathogens is characterized in that the sweet potato seed potato compound virus pathogens are sweet potato chlorotic stunt virus and sweet potato feathery mottle virus,

the method comprises the following steps:

extracting RNA of sweet potato seeds;

reverse transcribing the RNA to cDNA;

carrying out first round amplification of semi-nested PCR by using cDNA as a template and using an outer primer and an inner primer for amplifying the sweet potato chlorotic dwarf virus and an outer primer and an inner primer for amplifying the sweet potato feathery mottle virus to obtain a first round amplification product, and carrying out first round detection on the first round amplification product by using agarose gel electrophoresis;

performing a second round of amplification of semi-nested PCR by using the recovered target DNA as a template and the inner primer for amplifying the sweet potato chlorotic stunt virus and the inner primer for amplifying the sweet potato pinnate mottle virus to obtain a second round of amplification product, and performing a second round of detection on the second round of amplification product by using agarose gel electrophoresis,

the sequence of the outer primer for amplifying the sweet potato chlorotic dwarfing virus is as follows:

CS-F1：GACTCAGATTTGGAAACTAACC；

CS-R1：CGGACGTACTCTGATTTGC，

the sequence of the outer primer for amplifying the sweet potato pinnate mottle virus is as follows:

FM-F1：GCAGATTATGACGCACTTCAG；

FM-R1：CACACCCCTCATTCCTAAGAG，

the sequence of an inner primer for amplifying the sweet potato chlorotic stunt virus is as follows:

CS-F1：GACTCAGATTTGGAAACTAACC；

CS-R2：GAGCTAACTGGTCTGAGG，

the internal primer sequence for amplifying the sweet potato pinnate mottle virus is as follows:

FM-F2：GGTTGTTTGGTTTGGACGG；

FM-R1：CACACCCCTCATTCCTAAGAG，

wherein, the first round of amplification of the semi-nested PCR is also carried out by using internal reference primers which are:

Actin-F：TGAGCAAGGAAATAACAG，

Actin-R：GCTAGAACATATAAGGTCTC；

H₂b-F：CAAGGTTCTCAAACAGGTC，

H₂b-R：GCTTGTAAACTTAGTCACG；

UBI-F：GAGGTTGAATCGTCAGAC，

UBI-R:GACTCATCCACCTTGTAG，

the recovered target DNA is the target DNA of the sweet potato chlorotic stunt virus and the target DNA of the sweet potato feathery mottle virus, and the target DNA of the sweet potato chlorotic stunt virus and the target DNA of the sweet potato feathery mottle virus are first round external primer amplification products of semi-nested PCR.

2. The detection method according to claim 1, wherein the RNA of the sweet potato seed is extracted by SDS-LiCl method.