CN114317768B - Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis - Google Patents
Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis Download PDFInfo
- Publication number
- CN114317768B CN114317768B CN202111572463.1A CN202111572463A CN114317768B CN 114317768 B CN114317768 B CN 114317768B CN 202111572463 A CN202111572463 A CN 202111572463A CN 114317768 B CN114317768 B CN 114317768B
- Authority
- CN
- China
- Prior art keywords
- frankliniella occidentalis
- frankliniella
- sample
- identifying
- occidentalis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a dual PCR detection primer and a method for identifying frankliniella occidentalis and frankliniella occidentalis. The detection primers comprise a frankliniella species specific primer pair FiF1 and FiR1 and a frankliniella species specific primer pair FoF2 and FoR2. The invention utilizes double PCR technology, and single tube reaction can synchronously detect the frankliniella occidentalis and frankliniella occidentalis samples or the mixed samples of the two species, thereby solving the problems that two pests share hosts on crops and have high similarity and are difficult to rapidly identify. The invention establishes a double PCR detection method system with strong specificity, rapidness, high efficiency and easy operation, and can be used for rapidly identifying important pests of the frankliniella occidentalis and the frankliniella occidentalis on crops in actual production.
Description
Technical Field
The invention belongs to the technical field of insect molecular identification, and particularly relates to a dual PCR detection primer and a method for identifying frankliniella occidentalis and frankliniella occidentalis.
Background
Frankliniella intonsa (Trybom) and Frankliniella occidentalis (Pergande) both belong to Frankliniella of the family Thysanoptera, frankliniella of the genus Thripidaeae, both of which are polyphagious insects that destroy flowers, fruit trees and vegetables by directly sucking host juices, and are also important vector insects for the transmission of various plant viruses. In addition, the frankliniella occidentalis is also an important quarantine invasive pest, which is discovered for the first time in Beijing in 2003 in China and then rapidly spreads, and is colonized and harmed in a plurality of provinces at present. The two thrips are accurately identified so as to make a prevention and control measure by 'tailoring', and the method has important significance for inspection and quarantine, reduction of pesticide dosage, improvement of yield and quality of fruits and vegetables, guarantee of agricultural economic income and environmental protection.
At present, in actual production, the main identification means of frankliniella occidentalis and frankliniella occidentalis is identification according to morphological characteristics of adults, and the method is limited by high requirements on insect morphology and taxonomic professionals, and generally has great influence on pest diagnosis, forecast, quarantine quality and clearance speed. In recent years, with the development of molecular biology technology, pest species identification methods based on molecular technology are rapidly developed, and the insect state limitation and the professional classification personnel factor limitation are broken through, so that the method is widely applied to DNA barcode identification technology, genome-specific SSR sequence PCR identification method, species-specific PCR technology, restriction fragment length polymorphism technology, gene chip technology and the like. The method for identifying the types of the thrips by using the DNA barcode identification technology is the most commonly applied method at present, but the DNA barcode technology needs 5 steps of DNA extraction, PCR, gel electrophoresis, DNA sequencing and data comparison and analysis, and has certain defects in timeliness and convenience in a relative period of 3-5 days.
The dual PCR technology can realize the simultaneous detection of two different target genes in a single-tube reaction system, and has the advantages of rapidness, labor saving and labor saving in the aspect of species identification compared with DNA bar codes and a single-species specificity PCR species identification technology.
Disclosure of Invention
The invention aims to provide a dual PCR detection primer and a method which can be simultaneously used for identifying frankliniella occidentalis and frankliniella occidentalis.
The invention utilizes the mitochondria genome which is a relatively conserved gene of frankliniella occidentalis and frankliniella occidentalis as a target gene to carry out double PCR primer design, optimizes the system and conditions influencing double PCR reaction, and finally explores the double PCR detection primer and the method which can simultaneously identify frankliniella occidentalis and frankliniella occidentalis. And carrying out agarose gel electrophoresis by using the DNA products of the two types of double PCR amplification, and distinguishing the types of the frankliniella occidentalis and the frankliniella occidentalis according to the sizes of the fragments of the electrophoresis bands. The invention can rapidly and accurately identify two co-host agricultural pests with similar forms, and can provide technical support for pest control and inspection and quarantine.
The invention provides a dual PCR detection primer FoR identifying frankliniella occidentalis and frankliniella occidentalis, which comprises a frankliniella species specific primer pair FiF1 and FiR1 and a frankliniella occidentalis species specific primer pair FoF2 and FoR2;
the nucleotide sequence of the primer FiF1 is shown in SEQ ID NO. 1;
the nucleotide sequence of the primer FiR1 is shown as SEQ ID NO. 2;
the nucleotide sequence of the primer FoF2 is shown as SEQ ID NO. 3;
the nucleotide sequence of the primer FoR2 is shown as SEQ ID NO. 4.
The second purpose of the invention is to provide a double PCR detection method for identifying frankliniella occidentalis and frankliniella occidentalis, which comprises the following steps:
a. extracting the genome DNA of a sample to be identified;
b. taking the extracted sample DNA as a template, and performing double PCR amplification on the FiF1 and the FiR1 of the frankliniella occidentalis species specific primer pair and the FoF2 and the FoR2 of the frankliniella occidentalis species specific primer pair;
c. and (5) carrying out agarose gel electrophoresis analysis on the amplification product, and identifying the type of the sample according to the size of the band of the amplification product.
Preferably, the step c of identifying the type of the sample according to the size of the amplified product band specifically comprises:
(1) If the band of the amplification product is 704bp, the sample to be detected is the frankliniella;
(2) If the band of the amplification product is 296bp, the sample to be detected is frankliniella occidentalis;
(3) If the amplification product has two bands of 704bp and 296bp simultaneously, the sample to be detected is a mixed sample of the frankliniella occidentalis and the frankliniella occidentalis.
Preferably, the dual PCR amplification of step b, each amplification reaction system is 20 μ L, and comprises: primers FiF1, fiR1, foF2, foR2 each 0.2. Mu.M, sample DNA 1. Mu.L, rTaq DNA polymerase 0.5U,10 XPCR Buffer 2. Mu.L, each 2.5mM dNTPs 1.6. Mu.L, the balance sterile water.
Preferably, in the step b, the double PCR amplification is performed under the following conditions:
pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: denaturation at 95 ℃ for 30 seconds, annealing at 64-67 ℃ for 60 seconds, extension at 72 ℃ for 30 seconds, and extension at 72 ℃ for 5 minutes.
Preferably, the double PCR amplification in step b comprises the following amplification reaction conditions:
pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: denaturation at 95 ℃ for 30 seconds, annealing at 64 ℃ for 60 seconds, extension at 72 ℃ for 30 seconds, and extension at 72 ℃ for 5 minutes.
The third purpose of the invention is to provide a kit for identifying frankliniella occidentalis and frankliniella occidentalis, which comprises the dual PCR detection primer and the conventional PCR reagent for identifying frankliniella occidentalis and frankliniella occidentalis.
The invention has the following advantages:
the invention designs specific and species-specific primers by comparing mitochondrial genome sequences of different thrips, and finally screens and establishes a reaction system and conditions for simultaneously detecting the double PCR of the thrips and the thrips occidentalis by different concentration combinations of the primer pairs, annealing temperature gradient tests and the like.
The double PCR primer combination designed by the invention, the established reaction system and reaction conditions have strong specificity and high sensitivity, and species identification of frankliniella occidentalis and frankliniella occidentalis can be realized quickly, accurately and efficiently by utilizing the double PCR technology, so that the double PCR primer combination can be used for identifying agricultural pests and pests in inspection and quarantine in practice, thereby providing reference for formulating pest control strategies and quarantine.
Drawings
FIG. 1 is a primer specific PCR amplification agarose electrophoresis assay, lane M: d2000 Standard DNA Marker, lanes 1-7: primers FiF1/FiR1 amplified Frankliniella occidentalis, frankliniella flaviperidis, frankliniella tabaci, frankliniella palmata, frankliniella communis products, lanes 8-14: the primers FoF2/FoR2 are used FoR amplifying products of Frankliniella occidentalis, frankliniella flavipes, frankliniella tabescens, frankliniella palmata and Frankliniella communis.
FIG. 2 is an agarose electrophoresis picture of the dual PCR amplification effect at different annealing temperatures, lane M: d2000 Standard DNA Marker, lanes 1-12: the annealing temperatures were 47.8 deg.C, 48.3 deg.C, 49.5 deg.C, 51.4 deg.C, 53.7 deg.C, 56.4 deg.C, 59.1 deg.C, 61.7 deg.C, 64.1 deg.C, 66.1 deg.C, 67.4 deg.C, and 68 deg.C, respectively.
FIG. 3 is an agarose electrophoresis picture of the effect of double PCR amplification of different concentration combinations of primer pairs.
FIG. 4 is the agarose electrophoresis picture of the double PCR amplification detection of Frankliniella occidentalis, frankliniella occidentalis and two species mixed samples, lane M: d2000 standard DNA Marker; lane 1: a thrips sample; lane 2: frankliniella occidentalis samples; lane 3: mixed samples of frankliniella occidentalis and frankliniella occidentalis; lane 4: and (5) negative control.
FIG. 5 is a double PCR sensitive agarose electrophoresis assay;
panel A is an electrophoretogram of thrips detected by double PCR, lane M: d2000 standard DNA Marker; lanes 1-5: single-head sample DNA no-dilution, DNA sample 10-fold dilution, DNA sample 20-fold dilution, DNA sample 50-fold dilution, DNA sample 100-fold dilution, lane 6: negative control;
panel B is an electrophoretogram of Frankliniella occidentalis detected by double PCR, lane M: d2000 standard DNA Marker; lanes 1-5: single-head sample DNA no-dilution, DNA sample 10-fold dilution, DNA sample 20-fold dilution, DNA sample 50-fold dilution, DNA sample 100-fold dilution, lane 6: negative control;
panel C is a mixed sample electropherogram of double PCR detection of frankliniella and frankliniella occidentalis, lane M: d2000 standard DNA Marker; lanes 1-7: flower thrips: frankliniella occidentalis =1, frankliniella: frankliniella occidentalis =1, frankliniella: frankliniella occidentalis =1, frankliniella: frankliniella occidentalis =1, frankliniella: frankliniella occidentalis =1, frankliniella: frankliniella occidentalis =1, negative control;
panel D is a mixed sample electrophoretogram for double PCR detection of Frankliniella occidentalis and Frankliniella occidentalis, lane M: d2000 standard DNA Marker; lanes 1-7: frankliniella occidentalis: frankliniella =1, frankliniella occidentalis: frankliniella =1, frankliniella occidentalis: frankliniella =1, frankliniella occidentalis: frankliniella =1, frankliniella occidentalis: frankliniella =1, frankliniella occidentalis: thrips =1, negative control.
FIG. 6 is a double PCR electrophoresis test chart of the detection of Frankliniella occidentalis and Frankliniella occidentalis from south-West Ningning, yunnan Kunming, guizhou Guiyang, lane M: d2000 standard DNA Marker; the amplified band in lanes 1-8 is about 700bp, indicating that the sample is thrips; the amplified band in lanes 9-13 is about 300bp, indicating that the sample is frankliniella occidentalis; the amplified bands of lanes 14-16 are about 700bp and about 300bp, indicating that the sample is a mixed sample of frankliniella occidentalis and frankliniella occidentalis; lane 17: and (5) negative control.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to be limiting thereof.
Example 1
1. Double PCR primer design and synthesis: according to the mitochondrial sequences of frankliniella occidentalis and frankliniella occidentalis in the NCBI database, an upstream Primer pair and a downstream Primer pair (table 1) for specifically amplifying the mitochondrial genes of the frankliniella occidentalis are designed by utilizing a Primer3 online program, and the designed Primer combinations are screened according to the following two principles: 1. the difference of the target band lengths of the two species amplified by the double PCR is more than 100bp;2. primers for each species had better amplification products.
TABLE 1 upstream and downstream primer pairs designed for specific amplification of the mitochondrial Gene of thrips
Finally, the following primer pair combination is established as the optimal primer of the embodiment through screening, and the subsequent experiment is carried out, wherein the primer is synthesized by the biological engineering (Shanghai) company Limited.
Upstream and downstream primer pairs for specific amplification of thrips mitochondrial genes: fiF1 and FiR1; fiF1: tggaaaccacacagcgaca (SEQ ID No. 1), fiR1: the gttggggatgggttggggctta (SEQ ID NO. 2) has the nucleotide sequence shown in SEQ ID NO.5 corresponding to the amplified fragment.
An upstream primer pair and a downstream primer pair for specific amplification of a thrips occidentalis mitochondrial gene: foF2 and FoR2; and (4) FoF2: ttgatccgagagaggtgggg (SEQ ID NO. 3), foR2: aattcccgtaggaacagcga (SEQ ID No. 4), and the nucleotide sequence of the corresponding amplified fragment is shown in SEQ ID No. 6.
2. Extracting sample DNA of frankliniella occidentalis and frankliniella occidentalis: a commercially available genome DNA extraction kit (Tiangen company: DP 304) is adopted to respectively extract the individual genome DNA of the frankliniella occidentalis and the single individual genome DNA of the frankliniella occidentalis and the DNA of a mixed sample of the two types, and a micro ultraviolet spectrophotometer NanoDrop-1000C thermo, USA is adopted to detect the quality and the concentration of the extracted DNA.
3. Detecting by primer specificity PCR gel electrophoresis: using the DNA extracted in step 2 as a template, performing conventional PCR amplification using the above-mentioned FiF1 and FiR1 primer pair or FoF2 and FoR2 primer pair, respectively, and performing gel electrophoresis analysis on the amplification product, the results of which are shown in fig. 1. FIG. 1 shows that the primer amplification of frankliniella occidentalis and frankliniella occidentalis are both single bands, and no band is amplified in other samples, so that the species specificity of the primer is ensured. Primer-specific conventional PCR amplification system was 20 μ Ι _, including: 0.4. Mu.M each of the forward primer and the reverse primer, 1. Mu.L of template DNA, 0.5U of rTaq (TAKARA Co., ltd.), 10 XPCR Buffer (Mg) 2+ plus) 2. Mu.L, dNTPs (2.5 mM each) 1.6. Mu.L, sterile water to make up to 20. Mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: 30 seconds at 95 ℃, 60 seconds at 55 ℃, 30 seconds at 72 ℃ and 5 minutes at 72 ℃, and 5 mu L of product is taken for gel electrophoresis detection after the reaction is finished.
4. Double PCR amplification effect at different annealing temperatures: the annealing temperature gradient test was performed using the frankliniella occidentalis and frankliniella occidentalis mixed DNA samples as templates, and the optimal annealing temperature for the double PCR was established, with the results shown in fig. 2. FIG. 2 shows that the double PCR amplification effect is the best when the annealing temperature for amplification is 64.1 ℃ and thus the annealing temperature for double PCR is set to 64 ℃ in this example. Annealing temperature optimization exploration dual PCR amplification system was 20 μ Ι _ including: primers FiF1, fiR1, foF2 and FoR2 each 0.4. Mu.M, template DNA 1. Mu.L, rTaq (TAKARA) 0.5U,10 XPCR Buffer (Mg) 2+ plus) 2. Mu.L, dNTPs (2.5 mM each) 1.6. Mu.L, sterile water to make up to 20. Mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: denaturation at 95 ℃ for 30 seconds, annealing at 48-68 ℃ for 60 seconds, extension at 72 ℃ for 30 seconds, and extension at 72 ℃ for 5 minutes, and after the reaction is finished, taking 5 mu L of product to perform gel electrophoresis detection.
5. The primers of the dual PCR reaction system are optimized in different concentration combinations: the amounts of the primers used are shown in Table 2The mixture ratio is combined for PCR amplification, and the optimal dosage of each primer of the double PCR is determined. The optimized amplification system of the primer pair of the dual PCR reaction system with different concentration combinations is 20 mu L, and comprises the following steps: primers (amount shown in Table 2), template DNA 1. Mu.L, rTaq (TAKARA) 0.5U,10 XPCR Buffer (Mg) 2+ plus) 2. Mu.L, dNTPs (2.5 mM each) 1.6. Mu.L, sterile water to make up to 20. Mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: denaturation at 95 ℃ for 30 seconds, annealing at 64 ℃ for 60 seconds, extension at 72 ℃ for 30 seconds, and extension at 72 ℃ for 5 minutes, and after the reaction is finished, taking 5 mu L of product to perform gel electrophoresis detection.
TABLE 2 Dual PCR reaction System primer pairs different concentration combinations
The results of amplification with different combinations of primer concentrations are shown in FIG. 3. FIG. 3 shows the optimal amount of 20. Mu.L duplex PCR primers: fiF1, fiR1, foF2 and FoR2 were all 0.2. Mu.M (final concentration), and both thrips were amplified by double PCR at this primer concentration and thrips occidentalis with bright bands.
6. The method comprises the following steps of performing double PCR amplification detection on frankliniella occidentalis, frankliniella occidentalis and two kinds of mixed samples: the optimized double PCR system and reaction conditions are used for carrying out double PCR amplification on the frankliniella occidentalis, frankliniella occidentalis and the mixed sample of the two species, and the electrophoresis result of the amplification product is shown in figure 4. FIG. 4 shows that the double PCR conditions for the optimized screening can distinguish between single species and mixed samples of two species.
7. Double PCR sensitivity detection: the optimized and established double PCR system and reaction conditions are utilized to respectively detect that the DNA samples of the single-headed thrips and the frankliniella occidentalis are not diluted, are diluted by 10 times, are diluted by 20 times, are diluted by 50 times and are diluted by 100 times, and the agarose gel electrophoresis results of the amplification products are shown in FIGS. 5A and 5B, which shows that the detection can still be carried out when the DNA of the single-headed samples is diluted by 50 times. Meanwhile, the two thrips were mixed by using the double PCR, the species ratio of which is from 1 to 1.
Example 2: practical detection applications
The identification results of frankliniella occidentalis and frankliniella occidentalis from south-China-Canning, yunnan Kunming and Guizhou Guiyang by applying the optimized primer combination and the established optimized double PCR method in the embodiment 1 are shown in FIG. 6, and it can be seen from FIG. 6 that the optimized primer and the optimized method in the embodiment 1 can accurately distinguish frankliniella occidentalis, frankliniella occidentalis samples and mixed samples of the two species.
Sequence listing
<110> Guangxi Zhuang nationality college of autonomous region agro-sciences
<120> double PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tggaaaacca cacagcgaca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gttgggatgg gttgggctta 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttgatccgag aggaggtggg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aattcccgta ggaacagcga 20
<210> 5
<211> 704
<212> DNA
<213> Frankliniella intonsa (Trybom)
<400> 5
tggaaaacca cacagcgaca aattagcaac attaaatata catagagaaa agcaataatt 60
tttgtttatc aaaccaaaaa aacgaatatc ctgattatca aaaaacctat gaataaaaaa 120
tccggcacac ataaaaagca aagccttaaa accagcatga acaaccaaat gaaaaaaagc 180
taaactaggt aaaccgattg agattgtaga taatataaaa cccaactgtc ttaatgtaga 240
aagggcaata atttttttta aatcaaattc taataaacca gaaaatccag atataattat 300
agttaacaaa gagataaaaa gtaatgtaaa cttcaatttc tcatttaaaa aaaagctaaa 360
tcgaatcaaa atataaacac ccgccgtaac taaagttgac gagtgaacaa gagaagaaac 420
aggagtagga gctgctatag cagctggcaa tcaagctgaa aaaggaatct gagctctttt 480
agttaaagaa gcgataaaaa ctattaaaca aaaccaagta aaataataac ttaaaaaatt 540
tatataattt catcttccgt aacaaaaaaa taaagaaata ctagttagaa taaacacatc 600
ccctacacgg tttgtaagag cagtaattat acctgaccta aaggacttta aattttgata 660
ataaattacc aataaataag atactaagcc caacccatcc caac 704
<210> 6
<211> 296
<212> DNA
<213> Frankliniella occidentalis (PerGANDE)
<400> 6
ttgatccgag aggaggtggg gacccagttt tataccagca cttgttttga ttttttgggc 60
acccagaagt ttatatttta atcttgcctg gttttggttt aatctcccat attattacac 120
aagaaaggaa taaaaaaaga acatttggat taataggaat aatttacgct ataatggcta 180
ttggattttt aggatttatt gtttgagctc atcatatatt cacaattgga atagatgtag 240
atacacgagc ctactttact tcagcaacca taattatcgc tgttcctacg ggaatt 296
Claims (7)
1. A dual PCR detection primer FoR identifying frankliniella occidentalis and frankliniella occidentalis is characterized by comprising a frankliniella species specific primer pair FiF1 and FiR1 and a frankliniella species specific primer pair FoF2 and FoR2;
the nucleotide sequence of the primer FiF1 is shown as SEQ ID NO. 1;
the nucleotide sequence of the primer FiR1 is shown as SEQ ID NO. 2;
the nucleotide sequence of the primer FoF2 is shown as SEQ ID NO. 3;
the nucleotide sequence of the primer FoR2 is shown as SEQ ID NO. 4.
2. A double PCR detection method for identifying frankliniella occidentalis and frankliniella occidentalis is characterized by comprising the following steps:
a. extracting the genome DNA of a sample to be identified;
b. taking the extracted sample DNA as a template, and carrying out double PCR amplification on FiF1 and FiR1 of the frankliniella occidentalis species specific primer pair and FoF2 and FoR2 of the frankliniella occidentalis species specific primer pair according to claim 1;
c. and (5) carrying out agarose gel electrophoresis analysis on the amplification product, and identifying the type of the sample according to the size of the band of the amplification product.
3. The method according to claim 2, wherein the step c of identifying the type of the sample based on the size of the band of the amplification product comprises:
(1) If the band of the amplification product is 704bp, the sample to be detected is the frankliniella occidentalis;
(2) If the band of the amplification product is 296bp, the sample to be detected is the Frankliniella occidentalis;
(3) If the amplification product has two bands of 704bp and 296bp simultaneously, the sample to be detected is a mixed sample of the frankliniella occidentalis and the frankliniella occidentalis.
4. The method of claim 2, wherein the dual PCR amplification of step b comprises 20 μ L of each amplification reaction system, and comprises: primers FiF1, fiR1, foF2, foR2 each 0.2. Mu.M, sample DNA 1. Mu.L, rTaq DNA polymerase 0.5U,10 XPCR Buffer 2. Mu.L, each 2.5mM dNTPs 1.6. Mu.L, the balance sterile water.
5. The method of claim 2, wherein the double PCR amplification of step b is performed under the following conditions: pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: denaturation at 95 ℃ for 30 seconds, annealing at 64-67 ℃ for 60 seconds, extension at 72 ℃ for 30 seconds, and extension at 72 ℃ for 5 minutes.
6. The method of claim 5, wherein the double PCR amplification of step b is performed under the following conditions: pre-denaturation at 95 ℃ for 4 min, followed by 35 cycles: denaturation at 95 ℃ for 30 seconds, annealing at 64 ℃ for 60 seconds, extension at 72 ℃ for 30 seconds, and extension at 72 ℃ for 5 minutes.
7. A kit for identifying frankliniella occidentalis and frankliniella occidentalis, which is characterized by comprising the dual PCR detection primer and the conventional PCR reagent for identifying frankliniella occidentalis and frankliniella occidentalis of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111572463.1A CN114317768B (en) | 2021-12-21 | 2021-12-21 | Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111572463.1A CN114317768B (en) | 2021-12-21 | 2021-12-21 | Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114317768A CN114317768A (en) | 2022-04-12 |
| CN114317768B true CN114317768B (en) | 2023-04-07 |
Family
ID=81055262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111572463.1A Active CN114317768B (en) | 2021-12-21 | 2021-12-21 | Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114317768B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805782A (en) * | 2009-08-05 | 2010-08-18 | 云南出入境检验检疫局检验检疫技术中心 | Method for fast identifying frankliniella occidentalis |
| CN101818146B (en) * | 2010-01-22 | 2011-11-23 | 中国农业科学院植物保护研究所 | Specific COI primer, detection method and reagent kit of Frankliniella occidentalis |
| CN102392075B (en) * | 2011-11-17 | 2013-12-04 | 山东省农业科学院植物保护研究所 | Method for identifying Frankliniella occidentalis species by utilizing PCR (Polymerase Chain Reaction)-RFLP (Restriction Fragment Length Polymorphism) technology |
| CN107663547B (en) * | 2016-07-28 | 2020-04-07 | 新疆农业科学院植物保护研究所 | PCR (polymerase chain reaction) rapid detection method for frankliniella occidentalis based on specific SS-COI (sequence specific-polymerase chain reaction) primer |
| CN109706252B (en) * | 2019-03-13 | 2020-09-18 | 中国农业科学院植物保护研究所 | One-step dual-specificity SS-COI primer combination of Frankliniella occidentalis strain and application thereof |
-
2021
- 2021-12-21 CN CN202111572463.1A patent/CN114317768B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114317768A (en) | 2022-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110195126B (en) | SSR core primer group developed based on tartary buckwheat whole genome data and application thereof | |
| Rahman et al. | Current PCR-based methods for the detection of mycotoxigenic fungi in complex food and feed matrices | |
| US20240158873A1 (en) | Dna barcode for screening floccularia luteovirens with high antioxidant activity | |
| US20240158783A1 (en) | Dna barcode for screening total soluble protein content index of floccularia luteovirens | |
| Przybylska et al. | PCR-RFLP method to distinguish Frankliniella occidentalis, Frankliniella intonsa, Frankliniella pallida and Frankliniella tenuicornis | |
| Fu et al. | Development of reverse transcription loop-mediated isothermal amplification assay for rapid and visual detection of Telosma mosaic virus (TeMV) in passion fruit | |
| Kumar et al. | Advance detection techniques of phytopathogenic fungi: current trends and future perspectives | |
| Luo et al. | Development of a rapid one-step PCR protocol to distinguish between alfalfa (Medicago sativa) and sweet clover (Melilotus spp.) seeds | |
| CN104673889B (en) | Cotton Macrosiphus spp PCR quick determination methods based on specific SS COI primers | |
| CN111235283B (en) | Specific primers of spruce flower monochamus alternatus and rapid molecular detection method | |
| CN114317768B (en) | Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis | |
| JP6600831B2 (en) | Oligonucleotide for food pest detection | |
| Zhang et al. | Identification of tps2 used as an endogenous reference gene in qualitative and real-time quantitative pcr detection of flammulina velutipes | |
| WO2023087791A1 (en) | Dna barcode for identifying origin of floccularia luteovirens, primer group, and application | |
| WO2023087783A1 (en) | Dna barcode for screening floccularia luteovirens having high total fat content | |
| Li et al. | Establishment of molecular identity cards for Cucumis melo cultivars using ssr markers | |
| CN112813189B (en) | Method for rapidly identifying transgenic corn strain by utilizing quadruple real-time fluorescent PCR (polymerase chain reaction) | |
| CN104673890B (en) | Cotton black aphid PCR quick determination methods based on specific SS COI primers | |
| CN109762912B (en) | Specific primer pair for identifying citrus fruit fly and application thereof | |
| CN109880917B (en) | Specific primer for detecting pine needle cecidomyiia and application thereof | |
| CN102367485B (en) | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer | |
| CN112126718A (en) | Multiple RT-PCR primer group for simultaneously detecting three viruses of hot pepper and method thereof | |
| CN105567842B (en) | Identify Hericium erinaceus monkey outstanding No. 2 primer pairs and method | |
| US20240218463A1 (en) | Dna barcode for screening floccularia luteovirens with high total polysaccharide content | |
| US20240218465A1 (en) | Dna barcode for recognizing original place of floccularia luteovirens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |