CN102367485B - Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer - Google Patents
Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer Download PDFInfo
- Publication number
- CN102367485B CN102367485B CN 201110388017 CN201110388017A CN102367485B CN 102367485 B CN102367485 B CN 102367485B CN 201110388017 CN201110388017 CN 201110388017 CN 201110388017 A CN201110388017 A CN 201110388017A CN 102367485 B CN102367485 B CN 102367485B
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- pcr
- reference gene
- rbcl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a primer for carrying out PCR (Polymerase Chain Reaction) detection on a reference gene of a plant disease and application of the primer, belonging to the technical field of biological engineering. The reference gene is a rbcL gene, the primer has a positive primer sequence of 5'TATCTTGGCAGCATTCCGAGTA3' and a negative primer sequence of 5'ACCCTCTTCAAATAGGTCTAATGG3', and a DNA fragment of 228bp of an amplified rbcL gene of the primer specificity is used for evaluating a PCR template in a process of detecting departure and entry plant parasitic diseases. In the invention, the general reference gene is firstly established in the qualitative PCR detection of the plant diseases. The detection primer provided by the invention overcomes the defect that one reference gene corresponds to one plant, thus the detection efficiency is greatly increased and the detection time is shortened.
Description
Technical field
The present invention is specifically related to a kind of primer and application thereof that detects the reference gene of inspection and quarantining for import/export Plant diseases foreign gene for PCR.Belong to technical field of bioengineering.
Background technology
Progressively intensification along with global economic integration, countries in the world and interzone economic relation are inseparable, especially after the China joined WTO, the sharp increase of Agricultural Products Trade amount both at home and abroad, the speed of farm crop quarantine harmful organisms invasion and the difficulty of prevention and control are all continuing to increase, especially agricultural plants disease aspect quarantine is faced with huge challenge.By the disaster that quarantine harmful organisms causes, its harm is often even more serious than meteorologicdisasters, and prevention and control are not as good as just causing heavy losses.Abide by the principles such as SPS agreement science, risk management, transparency, non-discrimination, identity property, China lifts a ban markets such as wheat, potato, fruit in succession, a large amount of epidemic disease wheats, epidemic disease beans, excessive risk fruit enter China, in addition to overseas introduce a fine variety, border trade and smuggling etc., and exist weak link and system quarantine ability still powerful not in quarantine, it is increasing to cause epidemic situation to import the difficulty of the risk of diffusion and epidemic situation defence into, and therefore, the Plant diseases quarantine faces huge challenge.
Ended for the end of the year 2007, China has found 46 kinds of quarantine harmful organisms, and 20 century 70s are found a kind, find 2 kinds the eighties, find 9 kinds the nineties, 25 kinds of in recent years new discoveries, and only 2006 with regard to 5 kinds of new discoveries.The annual crop yield that causes because of biological epidemics is lost in about 10%, and financial loss reaches more than 600 hundred million yuan.In March, 2007, the serious threat that is originated from Panamanian research of fusarium wilt disesase of banana, Guangdong, Hainan, Guangxi and Banana in Fujian industry are inflicted heavy losses on, the citrus fruit fly that Guangyuan City Wangcang County, Sichuan Province in 2008 occurs, many places cause oranges and tangerines seriously unsalable in the whole nation, cause serious financial loss to the orchard worker.In order to prevent the threat of even more serious external epidemic disease evil, country invades Exotic pests and the serious harm that causes is paid attention to more, some relevant laws and regulations have in succession been put into effect, reinforcement is to the quarantine and examination work of harmful organism, each entry and exit port of China and efficient, special, sensitive, the fast and simple diagnostic method of place of production Plant diseases quarantine and examination an urgent demand.Therefore, State General Administration for Quality Supervision has promulgated tens kinds of agricultural plants disease PCR detection methods continuously.Such as: SN/T 1135.4-2006 potato smut disease bacterium quarantine identification method, SN/T 2071-2008 Asia candidatus liberobacter asiaticum quarantine identification method, SN/T 1465-2004 Acidovorax Avenae Subsp quarantine identification method, SN/T 1813-2006 butterfly orchid bacterial soft rot bacterium quarantine identification method, SN/T 1390-2004 Ralstonia solanacearum quarantine identification method, SN/T 2614-2010 grape bitter rot bacterium quarantine identification method etc.
Polymerase chain reaction technology (polymerase chain reaction, be called for short round pcr) is owing to have weak point consuming time, special strong, sensitive high, and becomes one of the most widely used technology of present phytopathological inspection quarantine.Because round pcr is highly sensitive, false positive, false-negative detected result appear easily, therefore, in testing process, usually will set up multiple contrast to come policer operation PCR process, comprise: confidential reference items DNA contrast, Positive Objects DNA contrast, the contrast of negative target dna, PCR suppress contrast, amplifing reagent contrast, extract blank, positively extract contrast, environment contrast.Thereby get rid of false positive, the false negative result that may occur in the PCR testing process.Wherein, setting up of confidential reference items DNA contrast is in order to weigh the template DNA quality, whether being fit to carry out PCR detects, a thereby strong foundation getting rid of the false negative detected result (be that negative result is not because do not contain the foreign DNA template in the sample, but suppress the pcr amplification factor because exist in the dna profiling) that is caused by the impurity that contains in the template.With existing report, the general SPS of selection of the Plant diseases detection gene of only finding paddy rice is reference gene, it is reference gene that soybean is generally selected the Lectin gene, it is reference gene that IVR gene or zSS II b gene are generally selected in the detection of corn, and other plant disease detection reference gene has no report.Along with importing and exporting floristic increasing, it is more and more unrealistic that a kind of Plant diseases detects the method that a kind of plant reference gene is selected, not only reduced working efficiency but also increased the cost of detection and the time of detection, this is heavy to Detection task, the large inspection and quarantine department of workload has increased many troubles especially.Therefore, a necessary general plant reference gene detection primer, the reference gene needs when detecting to satisfy the relevant disease of varied import and export plant set up.
Summary of the invention
The object of the present invention is to provide a kind of primer that detects the reference gene of Plant diseases for PCR, be used for the evaluation of entry and exit phytotrophy disease testing process pcr template.
The object of the present invention is achieved like this:
The relatively more conservative functional gene ribulose 1 of chloroplast(id) on the plant that the present invention announces with NCBI, the large subunit gene of 5-bisphosphate Carboxylase/oxygenase shows that according to the rbcL gene order of more than 30 kind of plant of having reported its coding region has the conservative property of height.Download the rbcL gene order of cloning and sequencing, then utilize DNAMAN to carry out sequence alignment and detect primer according to the conserved regions design qualitative PCR.
1. it is characterized in that: it is 5 '-TATCTTGGCAGCATTCCGAGTA-3 ' that described qualitative PCR detects the forward primer sequence, and the reverse primer sequence is 5 ’ – ACCCTCTTCAAATAGGTCTAATGG-3 '.
2. the dna fragmentation of the 228bp of the amplification rbcL gene of described primer specificity is used for the evaluation of entry and exit phytotrophy disease testing process pcr template.
Compared with prior art, the present invention has the following advantages:
1. the present invention proposes to set up general reference gene first in the Plant diseases qualitative PCR detects;
2. the present invention proposes the rbcL gene of plant chloroplast is applied to the detection of Plant diseases qualitative PCR as reference gene first;
3. the detection primer of the present invention's proposition has overcome the defective for a reference gene of a kind of plant, has improved greatly detection efficiency, has shortened detection time.
Description of drawings
Fig. 1 is that the rbcL gene specific detects the analysis of primer solubility curve; A is rbcL-1 primer solubility curve; B is rbcL-2 primer solubility curve;
Fig. 2 is the optimization of rbcL-1 primer annealing temperature; M is molecule scalar 100 bp DNA Ladder Marker, swimming lane 1-10 represents respectively annealing temperature: 48.8 ℃, 49.9 ℃, 51.3 ℃, 52.8 ℃, 54.5 ℃, 56.1 ℃, 57.7 ℃, 59.0 ℃, 59.9 ℃, 60.5 ℃, swimming lane 11 is blank;
Fig. 3 is 30 kinds of different plant reference gene rbcL specific amplification electrophorograms; M is molecule scalar 100bp DNA Ladder, and swimming lane 1-30 is the plant sample material number;
Fig. 4 is primer rbcL-1 pcr amplification sensitivity electrophorogram; M is molecule scalar 100bp DNA Ladder, swimming lane 12,34,56,78,9 10,11 12,13 14,15 16,17 18,19 20, be respectively 20ng/ μ L, 10ng/ μ L, 5ng/ μ L, 1ng/ μ L, 500fg/ μ L, 100fg/ μ L, 50fg/ μ L, 10fg/ μ L, 5fg/ μ L, 1fg/ μ L.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention, these embodiment only are not used in for explanation the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example is usually according to normal condition.
Embodiment 1 rbcL gene specific PCR detects the analysis of primer solubility curve
1 experiment material
1.1 vegetable material
DNA is provided by University Of Agriculture and Forestry In Fujian's sugarcane synthetic study.
1.2 enzyme and reagent
Power SYBR Green PCR Master Mix is ABI company product; RNase A is available from the precious biotechnology (Dalian) of TaKaRa company limited; Primer is synthetic to have Nanjing Genscript Biotechnology Co., Ltd. to finish with cloning and sequencing; All the other biochemical reagents are domestic analytical pure.
Key instrument
The quantitative PCR instrument: American AB I company produces 7500 types; Whizzer: German Eppendorf 5810 types; PCR instrument: the German Eppendorf Master Cycler gradient of company 96; Nucleic acid-protein analyser: Sweden APBiotech product; Biohazard Safety Equipment: Shanghai Li Xin company limited.
2 experimental techniques and process
2.1 DNA extraction and PCR primer
DNA extraction detects the nucleic acid extraction purification process according to standard GB/T/T 19495.3-2004 transgenic product.Primer is synthetic by the auspicious biotechnology of Nanjing spun gold company limited, its nucleotide sequence and amplified production lengths table 1.
Table 1 primer sequence and product size
2.2 the detection of DNA concentration and purity
Gets 2.0 μ L DNA and detect its integrity with 0.8% agarose gel electrophoresis, and with biotype spectrophotometric determination DNA concentration and purity, it is diluted to final concentration with TE is 20 ng/ μ L that-20 ℃ save backup.
2.3 quantitative PCR technique is to the detection of sugarcane Chloroplast rbcL Gene
The test kit that quantitative PCR adopts American AB I company to provide, the PCR reaction system is 25 μ L, Power SYBR Green PCR Master Mix 12.5 μ L wherein, each 0.5 μ L of upstream and downstream primer 10 μ mol/L, template DNA (20 ng/ μ L) 1 μ L, with sterilization distilled water polishing to 25 μ L, all the other carry out to specifications.Quantitative pcr amplification adopts two-step approach, reaction conditions: 50 ℃ of 2 min; 95 ℃ of 30 s; 60 ℃ of 40 s; 40 circulations.After reaction cycle finishes, the Ct value of record sample, the melting curve temperature range is set to 65.0 ℃ to 95.0 ℃, the 0.5 ℃ of reading in every interval once, each 1 s, then the variation of continuous recording fluorescent signal carries out the solubility curve analysis to primer, with behind the variation negate inverse of the variation of temperature and fluorescent signal to the temperature mapping, can obtain the Tm value of product.Except indicating especially, each sample is all done 3 repetitions, and sets up simultaneously the negative control of blank and non-transgenic sample.
3 results
The advantage that detects primer solubility curve analysis of fluorescence dyestuff is to detect the amplification of various double chain DNA sequences, need not designing probe, and testing process is easy, and is with low cost.Yet just because of fluorescence dye energy and any dsDNA combination, dna profiling is not had selectivity, therefore can be combined with non-specific dsDNA yet, produce easily the false positive signal, therefore will judge in conjunction with solubility curve the specificity of amplified production.After the PCR reaction finishes, measure simultaneously the Rn value in each step by increasing gradually temperature and draw melting curve, along with the sex change of reaction double center chain DNA is unwind, the Rn value reduces, negative first order derivative and temperature mapping with Δ Rn (fluorescent signal change), on the melting temperature(Tm) of amplified production, just can produce special peak value (Tm, double-stranded DNA unwind 50% temperature).And the melting temperature (Tm) of non-specific amplification, primer dimer etc. is low than specific binding, thereby specific signals and non-specific signal are come respectively.The present invention carries out quantitative pcr amplification according to the quantitative PCR response procedures with the Sugarcane Leaves genome DNA sample of 20 ng content, adding respectively 2 pairs of different primers compares each other, size, solubility curve peak type and the solubility curve height etc. of Ct value when relatively 2 pairs of primers play the peak under same reaction conditions are selected the detection primer of Chloroplast rbcL Gene the best.General desirable melting curve should be the single peak type curve, if there is two or more peaks, the non-specific amplification generations such as primer dimer has been described.The present invention can find out from the fluorescent quantitative PCR curve of 2 pairs of Auele Specific Primers, the rbcL-1 primer is to playing the peak early than rbcL-2, the Ct value is 16.6, peak value is up to 1.2, the rbcL-2 primer to the Ct value be 31.0, peak value is up to 1.1, the amplification efficiency that the rbcL-1 primer is described is higher than the rbcL-2 primer, and namely the detection sensitivity of rbcL-1 primer is higher than the rbcL-2 primer under the same amplification condition.Draw from the solubility curve analysis of primer, rbcL-1, rbcL-2 primer are to substantially all presenting the unimodality curve, and peak value is higher to be 1.1～1.2, illustrate that two pairs of primer amplification bands are single, high specificity does not have non-specific amplification to occur, but the rbcL-1 primer obviously is better than the rbcL-2 primer, and therefore, following experimental selection rbcL-1 primer is the experimental verification object.
The foundation of plant reference gene rbcL PCR detection system
1 experiment material
1.1 vegetable material
This experiment is selected 30 kinds of angiosperms altogether according to the inward Plant Quarantine harmful organism register of the People's Republic of China (PRC), belongs to respectively 16 sections 29 and belongs to, and sample number into spectrum, classification position, state and source see Table 2.
Table 2 plant sample material
1.2 enzyme and reagent
Molecular biology reagent is such as dNTPs, Taq archaeal dna polymerase, 10 * PCR Buffer, available from the precious biotech firm in Takara Dalian; 100bp Ladder DNA Marker(MD109-01) available from TIANGEN Biotech (Beijing) Co., Ltd., primer is synthetic to be finished by Nanjing Genscript Biotechnology Co., Ltd. with cloning and sequencing; All the other biochemical reagents are domestic analytical pure.
1.3 laboratory apparatus
Pcr amplification instrument 5333: German eppendorf company, nucleic acid electrophoresis apparatus DYY-8C: Liuyi Instruments Plant, Beijing, gel imaging system Gel Doc XR:BIO-Rad produces.
2 experimental techniques and process
2.1 the detection of extracting genome DNA and concentration and purity
See 2.1,2.2 extracting genome DNA and detections among the embodiment 1.
2.2 qualitative PCR reaction system and program
Qualitative PCR reaction system 25 μ L:10 * PCR Buffer (contains Mg
2+) 2.5 μ L, dNTP (10 mmol/L) 0.5 μ L, each 1 μ L of primer 5 μ mol/L, ExTaq enzyme 0.125 μ L, template DNA (20 ng) 1 μ L adds sterilization distilled water 18.875 μ L.Amplification program: 95 ℃ of 5 min; 95 ℃ of 30 s, 56 ℃ of 30 s, 72 ℃ of 30 s, 35 circulations; Behind last 72 ℃ of extension 7 min, 4 ℃ save backup, and add 6 * Loadingbuffer, 1 μ L during electrophoresis, get 6 μ L amplified productions in 1.5% agarose gel electrophoresis analysis.
2.3 the optimization of primer annealing temperature and sensitivity detect
The optimization of annealing temperature is at PCR 48.8 ~ 60.5 ℃ of annealing regions to be set, and 10 thermogrades are set, and is respectively 48.8 ℃, 49.9 ℃, 51.3 ℃, 52.8 ℃, 54.5 ℃, 56.1 ℃, 57.7 ℃, 59.0 ℃, 59.9 ℃, 60.5 ℃.
Take Sugarcane Leaves DNA as template, starting point concentration is 20ng/ μ L, carries out gradient dilution, is respectively 20ng/ μ L, 10ng/ μ L, 5ng/ μ L, 1ng/ μ L, 500fg/ μ L, 100fg/ μ L, 50fg/ μ L, 10fg/ μ L, 5fg/ μ L, 1fg/ μ L.
3 experimental results
3.1 the optimization of rbcL-1 primer annealing temperature
According to the sequence of checking among the embodiment 1, not only amplification efficiency is high for the rbcL-1 primer, high specificity, and amplified production size is 228bp, is fit to carry out the qualitative PCR detection.The present invention is provided with 10 different annealing temperatures take Sugarcane Leaves DNA as template, carries out the different annealing temperature shaker test, and rbcL-1 primer annealing temperature optimization the results are shown in Figure 2.Annealing temperature all can increase in 48.8 ℃～60.5 ℃ scope and arrive the product of high specificity as seen from Figure 2, but when annealing temperature is 52.8～60.5 ℃, the amplified production amount obviously strengthens, these characteristics are fit to primer with other detect parameters very much carries out simultaneously pcr amplification or collocation and carries out the multiplex PCR amplification, so improved PCR detection efficiency, shorten detection time greatly.
3.2 the specific detection of pcr amplification primer rbcL-1
Consideration according to factors such as above annealing temperature optimization and multiplex PCRs, select 56 ℃ and for annealing temperature 30 kind of plant have been carried out pcr amplification, amplification as shown in Figure 3, primer rbcL-1 all can increase in 30 plant material and obtain the amplified band of stable and consistent, purpose band neat and consistent, size is 228bp, the non-specific amplification band does not appear, this is consistent with quantitative PCR solubility curve analytical results among the embodiment 1, the Deflection level that this gene fragment is described is low, conservative property is high, is suitable as common template and is used for the PCR detection.
3.3 the sensitivity of pcr amplification primer rbcL-1 detects
Carry out qualitative PCR amplification (Fig. 4) according to 56 ℃ of the annealing temperatures after optimizing, as can be seen from Figure 4, when dna content is 1fg/ μ L, primer rbcL-1 still can detect the purpose band of 228bp, illustrate that this Auele Specific Primer rbcL-1 lowest detection limit (sensitivity) can reach 1fg/ μ L, can satisfy present qualitative PCR fully and detect needs.But, consider that chloroplast(id) is generally 50～200 in plant leaf tenuigenin, belong to multiple copied, in addition, different Plant Genome are not of uniform size, select 20 ng/ μ L template concentrations for accuracy and sensitivity, this research proposal of improving detection, namely genomic dna concentration final concentration in the PCR reaction system is the requirement of 1ng/ μ L.
＜110〉University Of Agriculture and Forestry In Fujian
＜120〉be used for primer and the application thereof that PCR detects the reference gene of Plant diseases
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 1
tatcttggca gcattccgag ta 22
<210> 2
<211> 24
<212> DNA
＜213〉artificial sequence
<400> 2
accctcttca aataggtcta atgg 24
Claims (2)
1. one kind is used for the primer that PCR detects the reference gene of Plant diseases, it is characterized in that: described reference gene is the rbcL gene, described primer is: the forward primer sequence is 5 ' TATCTTGGCAGCATTCCGAGTA 3 ', and the reverse primer sequence is 5 ' ACCCTCTTCAAATAGGTCTAATGG 3 '.
2. the according to claim 1 application of described primer is characterized in that: the dna fragmentation of the 228bp of the amplification rbcL gene of described primer specificity is used for the evaluation of entry and exit phytotrophy disease testing process pcr template.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110388017 CN102367485B (en) | 2011-11-30 | 2011-11-30 | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110388017 CN102367485B (en) | 2011-11-30 | 2011-11-30 | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102367485A CN102367485A (en) | 2012-03-07 |
| CN102367485B true CN102367485B (en) | 2013-04-17 |
Family
ID=45760075
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110388017 Expired - Fee Related CN102367485B (en) | 2011-11-30 | 2011-11-30 | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102367485B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305620B (en) * | 2013-06-26 | 2014-12-31 | 中国科学院植物研究所 | Specific primer pair based on rbcL gene and used for identifying land plant species and application thereof |
| CN114107325B (en) * | 2021-10-19 | 2024-03-12 | 深圳华大因源医药科技有限公司 | Metagenome internal reference, preparation method and application thereof, and metagenome blood flow pathogen detection method |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7700278B1 (en) * | 2003-01-08 | 2010-04-20 | University Of South Florida | Detection of red tide organisms by nucleic acid amplification |
| US7627437B2 (en) * | 2005-01-14 | 2009-12-01 | Idaho Research Foundation | Categorization of microbial communities |
| CN201587947U (en) * | 2009-11-18 | 2010-09-22 | 东北农业大学 | Standard molecule kit for detecting foreign genes of transgenic soya beans, corns, and paddy rice |
| CN101962681B (en) * | 2010-10-29 | 2013-03-13 | 四川省自然资源科学研究院 | Gene chip for detecting genuine coptis medicinal materials |
-
2011
- 2011-11-30 CN CN 201110388017 patent/CN102367485B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102367485A (en) | 2012-03-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114182030B (en) | LAMP constant-temperature rapid detection method for Burkholderia gladioli | |
| CN102367485B (en) | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer | |
| Azevedo-Nogueira et al. | Real-time PCR assay for Colletotrichum acutatum sensu stricto quantification in olive fruit samples | |
| Fu et al. | Development of reverse transcription loop-mediated isothermal amplification assay for rapid and visual detection of Telosma mosaic virus (TeMV) in passion fruit | |
| KR102238486B1 (en) | Primer sets for the detection of Phytophthora species and use thereof | |
| CN102703604B (en) | Kit for rapidly detecting banana bunchy top virus by isothermal gene amplification and use method of kit | |
| CN105177182B (en) | A kind of DPO primer and kit detecting No. 3 real-time fluorescence PCRs of grape leaf roll associated virus | |
| CN103525936A (en) | Specific identification for transgenic rice kefeng No.6 strain via adoption of RPA (Recombinase Ploymerase Amplification) technology | |
| CN108384881B (en) | Fluorescent quantitative PCR detection method of cercospora fuscogilva | |
| CN110878373A (en) | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof | |
| CN105624285A (en) | Mycoplasma pneumoniae fluorescent PCR detection reagent kit | |
| CN113136442B (en) | Method and kit for detecting erwinia amylovora based on LFD-RPA technology and application of method and kit | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN110734998B (en) | Primers, method and kit for identifying NFC orange juice and FC orange juice | |
| CN110564822B (en) | LAMP technology-based transgenic corn Bt 176-related gene detection method and kit | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN105238878A (en) | Sugarcane streak mosaic virus RT-LAMP (reverse transcription and loop-mediated isothermal amplification) primer set and detection method and application of thereof | |
| CN113430296B (en) | Dual PCR primer and detection method for synchronously and rapidly detecting peronophythora litchi and colletotrichum | |
| CN114317768B (en) | Dual PCR detection primer and method for identifying frankliniella occidentalis and frankliniella occidentalis | |
| CN102618658B (en) | Specific quantitative PCR (Polymerase Chain Reaction) accurate detection method for genetically modified maize TC1507 line | |
| KR101434832B1 (en) | Primers of polymerase chain reactions for the detection of Phytophthora species broken out on kind of fruit tree or seedling, and detection kits and methods thereof | |
| KR101166786B1 (en) | Genetic Marker for K3 or K5 Race Typing of Xanthomonas oryzae pv. Oryzae and Method of K3 or K5 Race Typing of Xanthomonas oryzae pv. Oryzae using the same | |
| AU2021104367A4 (en) | Specific primer for detecting sugarcane pokkah boeng pathogen and detection method | |
| CN102424863B (en) | Enhanced fluorescence quantitative PCR (polymerase chain reaction) method | |
| CN102409094B (en) | Transgenic corn NK603 strain specific quantitative PCR (Polymerase Chain Reaction) accurate detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Guo Jinlong Inventor after: Wang Hengbo Inventor after: Huang Guoqiang Inventor after: Xu Liping Inventor after: Chen Pinghua Inventor after: Chen Rukai Inventor before: Wang Hengbo Inventor before: Guo Jinlong Inventor before: Huang Guoqiang Inventor before: Xu Liping Inventor before: Chen Pinghua Inventor before: Chen Rukai |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: WANG HENGBO GUO JINLONG HUANG GUOQIANG XU LIPING CHEN PINGHUA CHEN RUKAI TO: GUO JINLONG WANG HENGBO HUANG GUOQIANG XU LIPING CHEN PINGHUA CHEN RUKAI |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130417 Termination date: 20151130 |
|
| EXPY | Termination of patent right or utility model |