CN104404173A - NASBA method for detecting tomato spotted wilt virus - Google Patents
NASBA method for detecting tomato spotted wilt virus Download PDFInfo
- Publication number
- CN104404173A CN104404173A CN201410798148.4A CN201410798148A CN104404173A CN 104404173 A CN104404173 A CN 104404173A CN 201410798148 A CN201410798148 A CN 201410798148A CN 104404173 A CN104404173 A CN 104404173A
- Authority
- CN
- China
- Prior art keywords
- add
- nasba
- tswv
- primer
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an NASBA method for detecting a tomato spotted wilt virus (TSWV). The sequences of NASBA primers for detecting the TSWV are SEQ ID No: 1-2 respectively. According to the highly conserved region of gene N of the TSWV, two inner primers with specificity are designed. The conserved gene sequences are shared by different strains with TSWV to ensure the reliability in detecting different sources of TSWV at the level of strains. The NASBA method is suitable for rapid detection and confirmation of TSWV and can be widely used in disease monitoring in production and environment, as well as TSWV confirmation in the import and export trade.
Description
Technical field
The invention belongs to pathogenic detection technique field, being specifically related to a kind of NASBA method for detecting tomato spotted wilf virus.
Background technology
In recent years, tomato spotted wilf virus (Tomato spotted wilt virus, TSWV) has been listed in the world with its host range and tremendous economic loss of causing widely and has endangered one of maximum ten kind of plant viruses.In 60 ~ eighties of 20th century, this virus was once very popular on America and Europe and African tobacco and tomato, and annual sickness rate is 20% ~ 50%, causes the loss up to several 1,000,000,000 dollars.In Hawaii, America, Brazil, Italy and South Africa, TSWV once caused the crop such as tomato, lettuce to be close to total crop failure at the popular of 80 ~ nineties of 20th century.In recent years, Tospovirus virus particularly TSWV, has become the important factor that the whole world causes diversified economy crop and the very big financial loss of ornamental plant.
The vegetable seed such as capsicum, onion, romaine lettuce that China plants at present much comes from all over the world, especially the basic dependence on import of tomato seeds, import country origin comprises the states such as the U.S., Japan, Holland, Thailand, these importers have generation and the report of tomato spotted wilf virus at present, and China port once intercepted and captured TSWV virus in 2012 in the seed entered the territory.And traditional TSWV detects and by biological host, morphology tests, confirmation method generally judges whether plant has plant virus, these methods are time-consuming, complex operation, can not meet the needs of disease control.
The current quarantine identification primary limitation for this virus is at traditional sensing techniques such as electron microscopy, serological technique and RT-PCR, as ELISA method, molecular hybridization, fluorescence quantifying PCR method, regular-PCR method etc., but in these methods, serology, hybridization technique detection sensitivity are low, complex operation step, the cycle is long; Electronic Speculum, Fluorescence PCR assay rely on large-scale instrument, and therefore a lot of laboratory cannot reach requirement in instrument configuration and detectivity.In addition, because tomato spotted wilf virus is single strand RNA virus, be easy to degraded, the complicacy of above method operation and sensitivity limit detection to this disease and forecast.Although application round pcr detects sensitive, current detection practice shows often to occur detecting false positive or false negative.
Summary of the invention
The object of this invention is to provide a kind of NASBA method for detecting TSWV, namely utilize and there is high sensitivity and the guiding of specific primer, in the reaction system formed containing t7 rna polymerase, RNAseH, ThermoScript II AMV, NTP, dNTP and reaction buffer, realized the isothermal duplication of nucleotide sequence by In-vitro specificity enzymatic reaction homogeneous continuously, the tomato spotted wilf virus in sample is detected accurately.
First the present invention provides a kind of NASBA primer for detecting TSWV, and its primer sequence is respectively SEQ ID NO:1 ~ 2.
NA-P1:5′-aattctaatacgactcactatagggagTGTCAGTGGCTCCAATCCTG-3′
NA-P2:5′-aattctaatacgactcactatagggagGCTTTGTTGACACAAGGCAAAG-3′。
The present invention also provides a kind of test kit detecting TSWV, includes following component
1) NASBA amplification reaction solution A:
Every 25 μ L comprise 10 × AMV buffer 2.5 μ l, 6.25mmol/L NTPs 3 μ L, 10mmol/L dNTPs 1.5 μ L, 10 μm of ol/L primer NA-P1, NA-P2 each 0.5 μ L, distilled water 9ml;
Wherein 10 × AMV buffer is the Tris-HCL containing 40mmol/L PH8.5,70mmol/LKCL, 12mmol/L MgCL
2, the damping fluid of 5mmol/L DTT;
2) NASBA amplification reaction solution B:
Described NASBA amplification reaction solution B includes: 0.5U RNaseH, 32U t7 rna polymerase, 6.4U AMV ThermoScript II, 2 μ L DMSO, 0.1 μ L1mol/L dithiothreitol (DTT), 0.25 μ L 10mg/mL BSA, 20U RNA enzyme inhibitors,
Above-mentioned test kit, for detecting TSWV, includes following step:
1) extraction of sample RNA
A, get 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mL Trizol Reagent, put upside down mixing, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min;
B, get supernatant, 15 DEG C ~ 30 DEG C, place 5min; Add 0.2mL chloroform, with hand concuss (not vortex oscillation), about 15s, places 2min ~ 3min by 15 DEG C ~ 30 DEG C; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 15min;
C, draw the upper strata aqueous phase of 600 μ L, add 500 μ L Virahol mixing supernatants, 15 DEG C ~ 30 DEG C, place 10min; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min;
D, removal supernatant liquor, add 1mL 75% ethanol, washing in precipitation; 2 DEG C ~ 8 DEG C, 7500g, centrifugal 5min;
E, removal supernatant liquor, after precipitation seasoning, be dissolved in 30 μ L ~ 50 μ L without in the water of RNase, be template ribonucleic acid to be checked;
2) the NASBA amplification of TSWV is carried out
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L to be checked
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L template ribonucleic acid to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tubes, add rapidly 4 μ L reaction solution B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3) electrophoresis detection
Get 3g agarose, heat, fully dissolve in 100mL electrophoretic buffer, adding ethidium bromide stock solution to final concentration is 0.5 μ g/mL, and glue, adds electrophoretic buffer in electrophoresis chamber, makes liquid level just not have gel; 3 μ L ~ 6 μ L pcr amplification products are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result is observed and record under Ultraviolet Detector.If amplified fragments is 235bp, illustrate that virus to be checked is TSWV, if there is not 235bp amplified fragments, then illustrate that virus to be checked is not TSWV.
The present invention devises two specificity inner primers according to the N gene high conservative region of TSWV, and this conserved genetic sequences is that to have the different strains of TSWV common, to ensure the reliability of the TSWV detecting different sources from the level of strain.The present invention is applicable to carry out rapid detection confirmation to TSWV, can be widely used in the confirmation of this virus in the disease monitoring in production and environment, foreign trade.
Compared with prior art, beneficial effect of the present invention comprises:
The first, convenience.This invention is when carrying out constant-temperature amplification, and do not need expensive nucleic acid amplification reaction device, whole process is carried out at 42 DEG C all the time, and without the need to thermal cycler, only 1 common thermostat water bath just can complete.
The second, tolerance range is high.The cycle number of this invention enzyme circulating reaction is few, does not need high-temperature denatured step, lower relative to RT-PCR mispairing rate, is more suitable for detecting and quantitative special RNA.
3rd, highly sensitive.This invention, compared with round pcr, can just amplify a large amount of goal gene with less circulation, ensure that the hypersensitivity of detection.
4th, shorten the cycle.Because transcriptive process,reversed is directly merged in amplified reaction, PCR approximately needs 20 to take turns circulation could increase 10
6doubly, and NASBA only need circulate and 4 ~ 5 takes turns and can reach 10
6doubly.
5th, reduce the specification of quality to plant RNA template.Owing to being rich in a large amount of polysaccharide, aldehydes matter in cell walls, the extraction of plant virus RNA also exists the problems such as poor stability, repeatability is low, efficiency is low, in addition in leaching process RNA itself from signs of degradation, the content of viral RNA is often lower, proposes high requirement to the sensitivity of detection method and stability.Due to this invention for template be RNA, the product of reaction is also RNA, and the result of reaction is by the impact of DNA in environment.Even if there is external double-stranded DNA to pollute, but because it does not possess T7 promoter sequence, can not be amplified, secondly, this reaction is only carried out under 42 DEG C of constant temperatures, do not need high-temperature denatured step, so NASBA reaction process can not be subject to the pollution of external double-stranded DNA, therefore for template purity and specification of quality lower.
Accompanying drawing illustrates:
Fig. 1 be the present invention to NASBA AFLP system in diseased plant sample: wherein M:ssRNA Laddermarker; The susceptible material of 1:TSWV; 2: healthy tomato.
Fig. 2 specific outcome figure: wherein M:ssRNA Ladder marker; 1: tomato spotted wilf virus; 2: negative control; 3: nepovirus; 4: tomato black ring virus; 5: cucumber mosaic virus; 6: Tomato mosaic virus; 7: tomato yellow leaf curl virus.
Fig. 3 NASBA sensitivity technique collection of illustrative plates: wherein M:ssRNA Ladder marker; 1 ~ 6:1.56 × 10
-1, 1.56 × 10
-2, 1.56 × 10
-3, 1.56 × 10
-4, 1.56 × 10
-5, 1.56 × 10
-6the susceptible material total serum IgE of ng/ μ LTSWV.
Fig. 4 PCR sensitivity collection of illustrative plates: wherein M:DNA D2000marker; 1 ~ 6:1.56 × 10
-1, 1.56 × 10
-2, 1.56 × 10
-3, 1.56 × 10
-4, 1.56 × 10
-5, 1.56 × 10
-6the susceptible material total serum IgE of ng/ μ LTSWV.
Fig. 5: actual sample detects: wherein M:ssRNA Ladder marker; 1 ~ 9: actual sample.
Embodiment
NASBA (Nuleic and sequence based amplipicain, NASBA) namely " Nucleic acid sequence based amplification " detection technique is a kind of isothermal amplification technology of classics, be applicable to the amplification of singlestranded RNA RNA mono-step and detect, being widely used in the Detection and diagnosis of the mankind and animals and plants cause of disease.NASBA is guided by pair of primers, in the standard reaction system that the various reaction buffers used containing t7 rna polymerase, RNAseH, ThermoScript II AMV, NTP, dNTP and needs form, realized the isothermal duplication of nucleotide sequence by In-vitro specificity enzymatic reaction homogeneous continuously.
First the present invention designs Auele Specific Primer according to TSWV nucleocapsid protein (nucterotein, N); Extract the Yeast Nucleic Acid (RNA) of testing sample again, then carry out NASBA amplification with the Auele Specific Primer of N gene respectively; With agarose gel electrophoresis, amplified production is detected, finally whether judge in sample containing TSWV according to NASBA amplification.
The material information that the embodiment of the present invention uses is as follows:
1, virus
Tomato spotted wilf virus picks up from the field plant fruit of the open plantation of Dongzhou Period in Chuxiong, nepovirus (Tobacco ring spot virus, TRSV) be separated from import Japan sweet Stevia, tomato black ring virus (Tomato black ring virus, TBRV) cucumber mosaic virus (the Cuccumber mosaic virus of Italian cucumber seeds is located away from, CMV) with Tomato mosaic virus (Tomato mosaicvirus, ToMV) tomato yellow leaf curl virus (the Tomato yellow curlvirus of Chilean watermelon seed is located away from, ToYCLV) tomato planting district, Qingdao is located away from.
2, reagent
Reverse transcription polysaccharase AMV, RNaseH, RNase inhibitor, t7 rna polymerase, dNTP, ssRNA marker, rNTP are all purchased from NEW ENGLAND BIOLAB company; Pcr amplification reagent, DNA marker and etc. be all purchased from Beijing Tian Gen company.
Below in conjunction with embodiment, the present invention will be described in detail
Embodiment 1: the design of primer
According to the N full length gene sequence (KC294570.1 (Kunming isolate) of TSWV in NCBI GenBank, HM581936.1 (Nanjing isolate), JF730744.1 (Korea S's isolate), HM180089 (Taiwan isolate), HQ406984.1 (U.S.'s isolate), KC494503.1 (New Zealand's isolate), KM379142.1 (Turkey's isolate), KF146703.1 (Venezuela's isolate)), by the high conservative region of comparative analysis TSWV N gene under the prerequisite of the degenerate and versatility that ensure amplification, design 5' end band have T7 promoter sequence NASBA react primer (NA-P1 NA-P2, NA-P3 NA-P4), after having designed, primer to be compared under the Primer-Blast module of database checking.Wherein NA-P3 the sequence of NA-P4 be respectively: NA-P3:5 '-aattctaatacgactcactatagggagTCCTAAGGCTTCCCTGGTGT-3 ' and NA-P4:5 '-aatt-ctaatacgactcactatagggagGCTTGTCGAGGAAACTGGGA-3 '.
In positive tomato and negative tomato are detected, with NA-P1 NA-P2 for amplimer pair time, there is in the position of corresponding about the 235bp of RNA marker the single band that expection is special in the amplified production of TSWV positive, and negative control is without band.And with NA-P3 NA-P4 amplimer pair time, there is comprising the biobelt of expection band in positive, an amplified band has also appearred in negative control, and the unexpected band of its size and positive is close.Confirm by order-checking, the product of this band is tomato mitochondrial RNA(mt RNA) sequence, and long is 312bp.Although this product than NA-P1 NAP2 larger, very easily detected result is caused and obscures, also easily cause the decline of amplification efficiency.Therefore, select primer pair NA-P1 NAP2 detect primer as NASBA of the present invention.
The detection of embodiment 2:TSWV
1, the extraction of viral RNA
Get 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mL Trizol Reagent, put upside down mixing, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Get supernatant, 15 DEG C ~ 30 DEG C, place 5min; Add 0.2mL chloroform, with hand concuss (not vortex oscillation), about 15s.15 DEG C ~ 30 DEG C, place 2min ~ 3min; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 15min.Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase.Add 500 μ L Virahol mixing supernatants, 15 DEG C ~ 30 DEG C, place 10min.2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Remove supernatant liquor, in precipitation, add 1mL 75% ethanol, washing; 2 DEG C ~ 8 DEG C, 7500g, centrifugal 5min.Remove supernatant liquor, after precipitation seasoning, be dissolved in 30 μ L ~ 50 μ L without in the water of RNase, be template ribonucleic acid to be checked.
2, NASBA amplification system
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L template ribonucleic acid to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tubes, add rapidly 4 μ L reaction solution B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3, electrophoresis detection
Get 3g agarose, heat, fully dissolve in 100mL electrophoretic buffer, adding ethidium bromide stock solution to final concentration is 0.5 μ g/mL, and glue, adds electrophoretic buffer in electrophoresis chamber, makes liquid level just not have gel; 3 μ L ~ 6 μ L pcr amplification products are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result is observed and record under Ultraviolet Detector.Expection product size is 235bp.See Fig. 1.
The present invention adopts NASBA to detect TSWV and completes following experiment:
(1) specificity experiments
1, extract the RNA of tomato spotted wilf virus, nepovirus, tomato black ring virus, cucumber mosaic virus and Tomato mosaic virus, tomato yellow leaf curl virus, use NASBA method detects.
2, the extraction of viral RNA
Get 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mL Trizol Reagent, put upside down mixing, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Get supernatant, 15 DEG C ~ 30 DEG C, place 5min; Add 0.2mL chloroform, with hand concuss (not vortex oscillation), about 15s.15 DEG C ~ 30 DEG C, place 2min ~ 3min; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 15min.Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase.Add 500 μ L Virahol mixing supernatants, 15 DEG C ~ 30 DEG C, place 10min.2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Remove supernatant liquor, in precipitation, add 1mL 75% ethanol, washing; 2 DEG C ~ 8 DEG C, 7500g, centrifugal 5min.Remove supernatant liquor, after precipitation seasoning, be dissolved in 30 μ L ~ 50 μ L without in the water of RNase, be template ribonucleic acid to be checked.
3, amplified reaction
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L template ribonucleic acid to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tubes, add rapidly 4 μ L reaction solution B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
4, NASBA product electrophoresis detection
Get 3g agarose, heat, fully dissolve in 100mL electrophoretic buffer, adding ethidium bromide stock solution to final concentration is 0.5 μ g/mL, and glue, adds electrophoretic buffer in electrophoresis chamber, makes liquid level just not have gel; 3 μ L ~ 6 μ L pcr amplification products are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result is observed and record under Ultraviolet Detector.Electrophoresis result shows, use NASBA method to carry out detecting tomato spotted wilf virus, nepovirus, tomato black ring virus, cucumber mosaic virus and the RNA of Tomato mosaic virus, tomato yellow leaf curl virus, only have tomato spotted wilf virus to obtain the amplified production (see Fig. 2) of expection 235bp.
(2) susceptibility control experiment
1, with DEPC water, TSWV viral RNA template liquid is done 10 times of gradient dilutions downwards, be followed successively by 1.56 × 10
-1, 1.56 × 10
-2, 1.56 × 10
-3, 1.56 × 10
-4, 1.56 × 10
-5, 1.56 × 10
-6ng/ μ L, respectively getting 2 μ L is that template carries out NASBA and RT-PCR amplified reaction respectively.NASBA primer selects NA-P1 and NA-P2, and PCR primer sequence (5 '-3 ') be respectively: P1:TGTCAGTGGCTCCAATCCTG and P2:GCTTTGTTGACACAAGGCAAAG
2, the extraction of viral RNA
Get 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mL Trizol Reagent, put upside down mixing, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Get supernatant, 15 DEG C ~ 30 DEG C, place 5min; Add 0.2mL chloroform, with hand concuss (not vortex oscillation), about 15s.15 DEG C ~ 30 DEG C, place 2min ~ 3min; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 15min.Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase.Add 500 μ L Virahol mixing supernatants, 15 DEG C ~ 30 DEG C, place 10min.2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Remove supernatant liquor, in precipitation, add 1mL 75% ethanol, washing; 2 DEG C ~ 8 DEG C, 7500g, centrifugal 5min.Remove supernatant liquor, after precipitation seasoning, be dissolved in 30 μ L ~ 50 μ L without in the water of RNase, be template ribonucleic acid to be checked.
3, NASBA amplified reaction
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L template ribonucleic acid to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tubes, add rapidly 4 μ L reaction solution B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
4, RT-PCR amplified reaction
RT-PCR amplification system illustrates configuration with reference to the Quant One step RT-PCR test kit of TIANGEN company, and reaction conditions is 50 DEG C of reverse transcription 30min; 94 DEG C of denaturation 2min; 94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, circulating reaction 35 times; 65 DEG C extend 10min.
5, NASBA product electrophoresis detection
Get 3g agarose, heat, fully dissolve in 100mL electrophoretic buffer, adding ethidium bromide stock solution to final concentration is 0.5 μ g/mL, and glue, adds electrophoretic buffer in electrophoresis chamber, makes liquid level just not have gel; 3 μ L ~ 6 μ L pcr amplification products are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result is observed and record under Ultraviolet Detector.NASBA Product Identification: electrophoresis result shows, primer of the present invention detects tomato spotted wilf virus can obtain 10
-4the template (see Fig. 3) of extension rate, can reach fg level level, uses RT-PCR method to obtain 10
-3extension rate (Fig. 4), only has pg level level.
Embodiment 3: actual sample detects and contrast experiment
By from Yunnan, Shandong, Deng Di field, Sichuan gather the sick sample with typical TSWV symptom and laboratory sample retention, adopt NASBA, RT-PCR to detect respectively, compare the effect of two kinds of methods, to assess the reliability of NASBA method further.
1, actual sample NASBA detects
1) extraction of viral RNA
Get 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mL Trizol Reagent, put upside down mixing, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Get supernatant, 15 DEG C ~ 30 DEG C, place 5min; Add 0.2mL chloroform, with hand concuss (not vortex oscillation), about 15s.15 DEG C ~ 30 DEG C, place 2min ~ 3min; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 15min.Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase.Add 500 μ L Virahol mixing supernatants, 15 DEG C ~ 30 DEG C, place 10min.2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min.Remove supernatant liquor, in precipitation, add 1mL 75% ethanol, washing; 2 DEG C ~ 8 DEG C, 7500g, centrifugal 5min.Remove supernatant liquor, after precipitation seasoning, be dissolved in 30 μ L ~ 50 μ L without in the water of RNase, be template ribonucleic acid to be checked.
2) amplified reaction
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L template ribonucleic acid to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tubes, add rapidly 4 μ L reaction solution B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3) NASBA Product Identification
Observe electrophoresis result and record under Ultraviolet Detector, electrophoresis result shows, and in 9 increment product, 3 increment product are positive, and other samples are negative (see Fig. 5).
2, pcr amplification
1) method: conventional RT-PCR reaction conditions is 50 DEG C of reverse transcription 30min; 94 DEG C of denaturation 2min; 94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, circulating reaction 35 times; 65 DEG C extend 10min.
2) agarose gel electrophoresis result: in 9 increment product, 3 parts is positive, and all the other are 6 parts.
Conclusion: utilize above-mentioned NASBA and PCR method simultaneously to detect actual sample, the coincidence rate 100% of two kinds of methods, but NASBA is lower to equipment requirements, and convenience is higher.
Claims (5)
1. one kind is detected the NASBA amplimer pair of tomato spotted wilf virus, it is characterized in that, the upstream primer of described primer pair, the sequence of downstream primer are respectively SEQ ID NO:1 ~ 2.
2. primer pair according to claim 1 is detecting the application of tomato spotted wilf virus in plant sample.
3. detect a NASBA amplification kit for tomato spotted wilf virus, comprise following component:
1) NASBA amplification reaction solution A:
Every 25 μ L comprise 10 × AMV buffer 2.5 μ l, 6.25mmol/L NTPs 3 μ L, 10mmol/LdNTPs 1.5 μ L, 10 μm of ol/L primer NA-P1, NA-P2 each 0.5 μ L, distilled water 9ml; Wherein primer NA-P1, NA-P2 is upstream primer according to claim 1, downstream primer;
Wherein 10 × AMV buffer is the Tris-HCL containing 40mmol/L PH8.5,70mmol/L KCL, 12mmol/L MgCL
2, the damping fluid of 5mmol/L DTT;
2) NASBA amplification reaction solution B:
Described NASBA amplification reaction solution B includes: 0.5U RNaseH, 32U t7 rna polymerase, 6.4U AMV ThermoScript II, 2 μ L DMSO, 0.1 μ L1mol/L dithiothreitol (DTT), 0.25 μ L 10mg/mL BSA, 20U RNA enzyme inhibitors.
4. test kit according to claim 3 is detecting the application of tomato spotted wilf virus in plant sample.
5. use the test kit described in claim 3 to detect a method for tomato spotted wilf virus in plant sample, it is characterized in that, described method comprises following step:
1) extraction of sample RNA
A, get 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mL Trizol Reagent, put upside down mixing, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min,
B, get supernatant, 15 DEG C ~ 30 DEG C, place 5min; Add 0.2mL chloroform, use hand concuss, about 15s, 15 DEG C ~ 30 DEG C, place 2min ~ 3min; 2 DEG C ~ 8 DEG C, 12000g, centrifugal 15min,
C, carefully absorption are about the upper strata aqueous phase of 600 μ L, and not disturbance mesophase spherule and lower floor's phase, adds 500 μ L Virahol mixing supernatants, 15 DEG C ~ 30 DEG C, place 10min, 2 DEG C ~ 8 DEG C, 12000g, centrifugal 10min;
D, removal supernatant liquor, add 1mL 75% ethanol, washing in precipitation; 2 DEG C ~ 8 DEG C, 7500g, centrifugal 5min;
E, removal supernatant liquor, after precipitation seasoning, be dissolved in 30 μ L ~ 50 μ L without in the water of RNase, be template ribonucleic acid to be checked;
2) the NASBA amplification of TSWV is carried out
A, in the reaction tubes that 14 μ L loop-mediated isothermal amplification liquid A are housed, add 3 μ L template ribonucleic acid to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tubes, add rapidly 4 μ L reaction solution B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3) electrophoresis detection
Get 3g agarose, heat, fully dissolve in 100mL electrophoretic buffer, adding ethidium bromide stock solution to final concentration is 0.5 μ g/mL, and glue, adds electrophoretic buffer in electrophoresis chamber, makes liquid level just not have gel; 3 μ L ~ 6 μ L pcr amplification products are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result is observed and record under Ultraviolet Detector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410798148.4A CN104404173B (en) | 2014-12-21 | 2014-12-21 | A kind of NASBA method for detecting tomato spotted wilf virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410798148.4A CN104404173B (en) | 2014-12-21 | 2014-12-21 | A kind of NASBA method for detecting tomato spotted wilf virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404173A true CN104404173A (en) | 2015-03-11 |
| CN104404173B CN104404173B (en) | 2016-06-15 |
Family
ID=52641836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410798148.4A Expired - Fee Related CN104404173B (en) | 2014-12-21 | 2014-12-21 | A kind of NASBA method for detecting tomato spotted wilf virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404173B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499390A (en) * | 2019-09-29 | 2019-11-26 | 云南省烟草农业科学研究院 | Molecular labeling primer, the method and its application of assisted Selection for the anti-spotted wilt RTSW gene-assisted selection of tobacco |
| CN112625141A (en) * | 2020-12-28 | 2021-04-09 | 昆明海关技术中心 | Protein standard substance of tomato spotted wilt virus and application thereof |
| CN115820930A (en) * | 2022-09-26 | 2023-03-21 | 云南省农业科学院生物技术与种质资源研究所 | RT-qPCR detection method for single tomato seed carrying tomato spotted wilt virus TSWV and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120193A (en) * | 2014-07-01 | 2014-10-29 | 中国农业科学院蔬菜花卉研究所 | Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus |
-
2014
- 2014-12-21 CN CN201410798148.4A patent/CN104404173B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120193A (en) * | 2014-07-01 | 2014-10-29 | 中国农业科学院蔬菜花卉研究所 | Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus |
Non-Patent Citations (2)
| Title |
|---|
| 佟爱仔: ""侵染云南烟草的番茄斑萎病毒（TSWV）的RT-PCR检测"", 《云南农业大学学报》 * |
| 张志宏: ""利用NASBA技术检测草莓斑驳病毒"", 《果树学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499390A (en) * | 2019-09-29 | 2019-11-26 | 云南省烟草农业科学研究院 | Molecular labeling primer, the method and its application of assisted Selection for the anti-spotted wilt RTSW gene-assisted selection of tobacco |
| CN110499390B (en) * | 2019-09-29 | 2023-03-10 | 云南省烟草农业科学研究院 | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof |
| CN112625141A (en) * | 2020-12-28 | 2021-04-09 | 昆明海关技术中心 | Protein standard substance of tomato spotted wilt virus and application thereof |
| CN115820930A (en) * | 2022-09-26 | 2023-03-21 | 云南省农业科学院生物技术与种质资源研究所 | RT-qPCR detection method for single tomato seed carrying tomato spotted wilt virus TSWV and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404173B (en) | 2016-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN102154503A (en) | Method for detecting DNA (deoxyribonucleic acid) content of CHO (cholesterol) cells by probe | |
| CN104762409A (en) | Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology | |
| CN103276101B (en) | Method for detecting tomato transgenic component by using quadruple fluorescent quantitation | |
| CN104404173B (en) | A kind of NASBA method for detecting tomato spotted wilf virus | |
| CN102899416B (en) | Cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and rapid detection method thereof | |
| CN101363063A (en) | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR | |
| CN104031991A (en) | Fluorescent quantitative PCR detection method of resistance of bemisia tabaci on thiamethoxam and kit thereof | |
| CN101701257B (en) | PCR authenticating primer and method of oryza punctata | |
| CN104450975A (en) | RT-HDA primer, kit and method for detecting tomato spotted wilt virus | |
| CN101781677A (en) | Kit for detecting leukemia broad-spectrum marker WT1 gene mRNA expression | |
| CN104232795B (en) | The real-time fluorescence quantitative RT-PCR detection kit of citrus yellow vein virus and detection method | |
| CN110093437A (en) | The fluorescence PCR detection reagent and method of golden larch | |
| CN104498632A (en) | Method for detecting tomato spotted wilf virus based on loop-mediated isothermal amplification technology | |
| CN104498633B (en) | NASBA primer, test kit and the method for detection Peach latent mosaic viroid | |
| CN104450972B (en) | NASBA primer, test kit and the method for detection Fructus Mali pumilae rust fruit virus | |
| CN105063238B (en) | A kind of RPA primers and kit for detecting grape leaf roll associated virus 2 | |
| CN104513867A (en) | Primer set, reagent kit and method for detecting hop stunt viroid based on loop-mediated isothermal amplification technology | |
| CN112280906A (en) | DPO-PCR primer pair for detecting arabis mosaic virus and bean pod mottle virus and application thereof | |
| CN105567876A (en) | PLRV (Potato Leafroll Virus) RT-LAMP (Reverse Transcriptase Loop-Mediated Isothermal Amplification) detection kit and PLRV RT-LAMP detection method | |
| CN104450973B (en) | For detecting NASBA amplimer, test kit and the detection method of hop stunt viroid | |
| CN104894280A (en) | Primer, kit and method for detecting transgenic maize NOS terminator | |
| CN104152588A (en) | Nested RT-PCR primer group, detection method and kit for CYVCV | |
| CN104498634A (en) | Primer group, kit and method for detecting apple scar skid viroid based on loop-mediated isothermal amplification technology | |
| CN104263854B (en) | South leaf mustard mosaic virus SYBR Green I real-time fluorescent RT-PCR detection reagent box and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 266002 Shandong province Qingdao city qutangxia Road No. 70 Patentee after: Qingdao Customs Technology Center Address before: 266002 Shandong province Qingdao city qutangxia Road No. 70 Patentee before: Inspection and Quarantine Technology Center of Shandong entry exit inspection and Quarantine Bureau |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160615 Termination date: 20211221 |