CN105567876A

CN105567876A - PLRV (Potato Leafroll Virus) RT-LAMP (Reverse Transcriptase Loop-Mediated Isothermal Amplification) detection kit and PLRV RT-LAMP detection method

Info

Publication number: CN105567876A
Application number: CN201610130521.8A
Authority: CN
Inventors: 刘杰
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-03-07
Filing date: 2016-03-07
Publication date: 2016-05-11

Abstract

The invention relates to a PLRV (Potato Leafroll Virus) RT-LAMP (Reverse Transcription- Loop-Mediated Isothermal Amplification) detection kit. The PLRV RT-LAMP detection kit comprises four specific primers, a reaction buffer solution, AMV transcriptase, Bst DNA (Deoxyribose Nucleic Acid) polymerase and nucleic acid dye. The invention also relates to a PLRV RT-LAMP detection method. By using the PLRV RT-LAMP detection kit and the PLRV RT-LAMP detection method, disclosed by the invention, PLRV can be accurately distinguished from other plant viruses which are easy to infect potatoes, and the PLRV RT-LAMP detection kit and the PLRV RT-LAMP detection method have the advantages of strong specificity, high sensitivity, good repeatability and the like.

Description

A kind of corium solani RT-LAMP detection reagent box and detection method

Technical field

The present invention relates to microorganism detection field, specifically, the present invention relates to a kind of corium solani RT-LAMP detection reagent box and detection method.

Background technology

Potato is one of most important cash crop in the whole world, both can as the consumer's goods of the mankind, animal-feed, also can as wine brewing and the raw material extracting starch.According to Food and Argriculture OrganizationFAO's statistics, current potato is the 4th kind of staple crops being only second to wheat, paddy rice and corn in the world.Cultivated area and the output of China potato rank first in the world.For a long time, the multiple virus of potato and viroid produce to cause to potato and greatly threaten, and are the major causes causing Potato Cultivars to degenerate, have a strong impact on the seed output and quality of potato.Wherein marmor upsilon and corium solani endanger the most serious virus.

Corium solani (potatoleafrollvirus, PLRV) is Polerovirus member, is divided into Lutoevirus in the past and belongs to (Lureovirus) member, and be distributed in each potato planting district of the world.Virion is spherical, and etc. rotational symmetry, diameter 24nm, genome is positive chain RNA, full-length genome 5882bp, and it has 6 ORFs.This virus is propagated by potato seed, and in field, the strict worm of virus passes.Virus is low at pin main body intensive amount, mainly concentrates in host's vascular bundle, is therefore difficult to a large amount of purification, cause the Progress on Molecular Biology of this virus slow.

The virus-free production of seed stock of extensive tissue culture is the main method controlling potato virus disease, and quick, accurate, sensitive virus detection techniques is set up in excellent potato seed production requirement.Traditional Potato viruses detection authentication method is plant indicator method, namely by there is distinctive infection symptoms thus judging whether to there is virus, and the diagnostic method mainly enzyme linked immunosorbent detection mostly adopted at present.Although Enzyme-Linked Immunospot improves many than traditional detection method sensitivity, but still there is the defect of the aspects such as the virus not easily detecting cross infection and the virus that can not detect in dormancy potato seed.Therefore Protocols in Molecular Biology becomes the developing direction of Potato viruses detection.Exploitation fast, PLRV molecular biology for detection accurately and efficiently, can monitor the quality of seed potato, Rapid identification field plant disease, monitors incidence in time, meets industry demand.

Ring mediated constant temperature nucleic acid amplification technology (loop-mediatedisothermalamplification, LAMP) is that a kind of novel nucleic acid amplification method that grew up in recent years is (see NotomiT etc., NucleicAcidsRes.2000Jun15; 28 (12): E63), and reverse transcription-loop-mediated isothermal amplification technique (RT-LAMP) is set up based on LAMP, it adds reversed transcriptive enzyme in reaction system, and the LAMP of the reverse transcription of RNA and cDNA amplification step in same test tube is completed.In addition, RT-LAMP also has fast, the simple to operate and sensitivity advantages of higher of detection speed: this technology depends on the primer that can identify 6 specific regions on target sequence and has de-rotation function and the BstDNA polysaccharase of the amplification in waterfall type, under isothermal conditions can amplified target sequence efficiently, fast and specifically.Compared with RT-PCR, the sensitivity of RT-LAMP is significantly higher, with the obvious advantage.

Summary of the invention

The object of the present invention is to provide a kind of corium solani RT-LAMP detection reagent box and detection method.

In order to realize object of the present invention, in an aspect, the invention provides a kind of corium solani RT-LAMP detection reagent box, it comprises 4 Auele Specific Primers, and the nucleotide sequence of described primer is as follows:

Outer primer F3:AGGCGCGCTAACAGAGTT (SEQIDNO:1)

Outer primer B3:CCCGAAGGTGAAACTTCCTT (SEQIDNO:2)

Inner primer FIP:GGCGATTGCCTCCTCTTCTACG-GCCAGTGGTTATGGTCACG (SEQIDNO:3)

Inner primer BIP:AAGAACTGGAGTTCCCCGAGGA-GCCCATGAGGTTGTCCTTTG (SEQIDNO:4).

Further, test kit of the present invention also comprises reaction buffer, AMV reversed transcriptive enzyme, BstDNA polysaccharase and nucleic acid dye, and wherein said reaction buffer is by 2mMdNTP, 10 × ThermoPol reaction buffer, 0.6mM trimethyl-glycine and 6mMMg ²⁺composition.

In test kit of the present invention, the concentration of preferred outer primer F3 and outer primer B3 is 0.2 μm of ol/ μ l, and the concentration of inner primer FIP and inner primer BIP is 1.2 μm of ol/ μ l.

In test kit of the present invention, preferred nucleic acid dyestuff is SYBRGreenI.

Further, test kit of the present invention can also comprise RNA and extracts reagent and positive control and negative control.

In one aspect of the method, present invention also offers the method using test kit of the present invention to detect corium solani.

Corium solani RT-LAMP detection reagent box of the present invention and detection method are for 6 zone design specificitys of the envelope protein encoding gene of PLRV and highly sensitive 4 primers, and a step completes reverse transcription and amplification step, false positive rate is low, quick, efficient, and get final product result of determination by visual color change, without the need to the step such as electrophoresis and ultraviolet visualization, without the need to using the instruments such as thermal cycler, cost is low, simple to operate, it is easy to identify, is suitable for the Basic Laboratory and the Fields detection that carry out PLRV.

Embodiment

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.

The preparation of embodiment 1 corium solani RT-LAMP detection reagent box

1.1 reagent

Primer is synthesized by TIANGEN Biotech (Beijing) Co., Ltd.; BstDNA polysaccharase and 10 × ThermoPol reaction buffer are purchased from NEB; AMV reversed transcriptive enzyme is purchased from Promega company; SYBRGreenI and TRIZOLReagent is purchased from Invitrogen; Needed for all the other PCR, reagent is purchased from Sigma.

The preparation of 1.2 test kits:

Reaction buffer, according to following formulated: 2mMdNTP, 10 × ThermoPol reaction buffer, 0.6mM trimethyl-glycine and 6mMMg ²⁺;

Article 4, Auele Specific Primer: outer primer F3, its nucleotide sequence is as shown in SEQIDNO:l; Outer primer B3, its nucleotide sequence is as shown in SEQIDNO:2; Inner primer FIP, its nucleotide sequence is as shown in SEQIDNO:3, and inner primer BIP, its nucleotide sequence is as shown in SEQIDNO:4.Wherein the concentration of outer primer F3 and outer primer B3 is 0.2 μm of ol/ μ l, and the concentration of inner primer FIP and inner primer BIP is 1.2 μm of ol/ μ l.

The AMV reversed transcriptive enzyme of 2U;

The BstDNA polysaccharase of 8U;

Nucleic acid dye: 1000 × SYBRGreenI;

Positive control: corium solani genomic dna;

Negative control: 100mMTris-HCl (pH8.0) and 50mMEDTA.

Embodiment 2 corium solani specific detection

2.1RT-LAMP specific detection

Testing sample is the potato leaf picking up from Hebei Vegetable Base Yongnian, comprises and has infected the 6 increment product of PLRV and each 2 increment product of potato-infecting X virus, marmor upsilon, marmor solani and cucumber mosaic virus through ELISA method qualification.

The test kit using embodiment 1 to prepare detects above-mentioned sample according to following steps:

1. utilize TRIZOLReagent to extract testing sample RNA, concrete grammar is as follows:

(1) cut appropriate blade, fully grind, then add 1mlTrizolReagent and fully grind, room temperature places 5min;

(2) add chloroform 200 μ l, fully vibrate 15sec, after room temperature places 2-3min, and 12000 × g, 4 DEG C of centrifugal 10min;

(3) get in upper strata aqueous phase to new pipe, add equal-volume Virahol, room temperature places 30min, 12000 × g, and 4 DEG C of centrifugal 10min, abandon supernatant liquor;

(4) precipitation 75% washing with alcohol of DEPC water configuration, 7500 × g, 4 DEG C of centrifugal 5min, abandon supernatant liquor;

(5) vacuum-drying RNA precipitates, and adds DEPC water 40 μ l and dissolves RNA.

2. in PCR pipe, prepare the RT-LAMP reaction system of 25 μ l, it comprises outer primer F31 μ l, outer primer B31 μ l, inner primer FIP1 μ l, inner primer BIP1 μ l, reaction buffer 2.5 μ l, AMV reversed transcriptive enzyme 1 μ l, BstDNA polysaccharase 1 μ l, template 2 μ l, add water and be supplemented to 25 μ l, and using corium solani genomic dna as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;

3.LAMP reacts: by the PCR pipe of step 2 in 63 DEG C of isothermal reaction 80min, 80 DEG C of 5min inactivations subsequently;

4. result interpretation: add 1 μ lSYBRGreenI in the gained reaction product of step 3, if reaction solution color is orange, represents that result is negative, not containing PLRV in sample; If reaction solution color is green, represent that result is positive, containing PLRV in sample.

2.2 detected result

All green is presented in the PCR pipe of 6 parts of PLRV samples, and the PCR colour developing result of potato virus X, marmor upsilon, marmor solani and cucumber mosaic virus is feminine gender, show that the virus of PLRV and all the other common potato-infectings can make a distinction by 4 designed Auele Specific Primers exactly, there is very strong specificity.

Embodiment 3 corium solani sensitivity technique

3.1RT-LAMP sensitivity technique

In Example 2, qualification result is the RNA sample of the corium solani positive, and is diluted to 100fg-100ng totally 7 gradients with 10 times of concentration series dilution methods.

RT-LAMP reaction and result interpretation step are with the step 2-4 of embodiment 2.

3.2 detected result

Except DNA concentration be 100fg PCR pipe display orange except, all present green in the PCR pipe of all the other concentration, show that the lowest detection limit of detection method of the present invention reaches 1pgDNA, sensitivity is very high.

Claims

1. a corium solani RT-LAMP detection reagent box, comprise 4 Auele Specific Primers, the nucleotides sequence of described primer is classified as:

Outer primer F3:AGGCGCGCTAACAGAGTT (SEQIDNO:1)

Outer primer B3:CCCGAAGGTGAAACTTCCTT (SEQIDNO:2)

Inner primer FIP:GGCGATTGCCTCCTCTTCTACG-GCCAGTGGTTATGGTCACG (SEQIDNO:3)

Inner primer BIP:AAGAACTGGAGTTCCCCGAGGA-GCCCATGAGGTTGTCCTTTG (SEQIDNO:4).

2. test kit according to claim 1, it comprises reaction buffer, AMV reversed transcriptive enzyme, BstDNA polysaccharase and nucleic acid dye further.

3. test kit according to claim 2, wherein said reaction buffer is by 2mMdNTP, 10 × ThermoPol reaction buffer, 0.6mM trimethyl-glycine and 6mMMg ²⁺composition.

4. test kit according to claim 2, wherein said nucleic acid dye is SYBRGreenI.

5. the test kit according to any one of claim 1-4, it comprises RNA further and extracts reagent and positive control and negative control.

6. use the method that the test kit described in any one of claim 1-5 detects corium solani.