CN103710463B - Rapid detection kit and method of strawberry mild yellow edge virus - Google Patents

Rapid detection kit and method of strawberry mild yellow edge virus Download PDF

Info

Publication number
CN103710463B
CN103710463B CN201310731171.7A CN201310731171A CN103710463B CN 103710463 B CN103710463 B CN 103710463B CN 201310731171 A CN201310731171 A CN 201310731171A CN 103710463 B CN103710463 B CN 103710463B
Authority
CN
China
Prior art keywords
sequence
strawberry
yellow edge
virus
edge virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201310731171.7A
Other languages
Chinese (zh)
Other versions
CN103710463A (en
Inventor
尚巧霞
陈柳
崔高峰
祝宁
冉策
陈笑瑜
邢冬梅
韩成贵
魏艳敏
赵晓燕
杨瑞
刘正坪
张志勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jinhe Agricultural Biotechnology Co. Ltd. (Beijing)
Original Assignee
Beijing University of Agriculture
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing University of Agriculture filed Critical Beijing University of Agriculture
Priority to CN201310731171.7A priority Critical patent/CN103710463B/en
Publication of CN103710463A publication Critical patent/CN103710463A/en
Application granted granted Critical
Publication of CN103710463B publication Critical patent/CN103710463B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a special primer for detecting a strawberry mild yellow edge virus and an application thereof. The special primer for detecting the strawberry mild yellow edge virus is composed of a deoxyribonucleic acid (DNA) shown in a sequence 1 in a sequence table, a DNA shown in a sequence 2 in the sequence table, a DNA shown in a sequence 3 in the sequence table, and a DNA shown in a sequence 4 in the sequence table. The primer disclosed by the invention is utilized for detection, so that the method is rapid and sensitive in detection process, simple and convenient to operate, and free of other precious equipment and reagents, and is especially applicable to rapid detection in seedling breeding, detoxification cultivation and field investigation and grasping and application by basic technical personnel in production.

Description

The quick detection kit of strawberry light yellow edge virus and method
Technical field
The RT-LAMP that the present invention relates to strawberry light yellow edge virus detects primer sets, detection kit and method.
Background technology
Strawberry light yellow edge virus (Strawberry mild yellow edge virus, SMYEV) taxonomy is subordinate to bending Viraceae (Flexiviridae) potexvirus (Potexvirus), for the linear just ssRNA virus of unit molecule, long 5966bp.Virus particle bending, is about 470-580nm, and wide is 13nm.After SMYEV infects host plant, in the epidermis that can be present in host plant and mesophyll cell, propagate with persistent fashion mainly through multiple aphid, virus not reproducible in amboceptor, can not be transmitted by amboceptor offspring; Grafting can be propagated, and seed, contacts with each other and do not propagate between pollen and plant.Strawberry light yellow edge virus infects Chilean strawberry (Fragaria chiloensis) and pineapple strawberry (Fragaria nilgerrensis) is usually asymptomatic afterwards, and infecting wild strawberry (Fragaria vesca) Symptoms is leaflet depression, the decline of leaf margin chlorisis, plant growing way.Make strawberry downgrade a little when infecting separately, but can cause yellowing leaf or chlorosis during Combined Infection, plant is downgraded, and the irregular upper volume of leaf margin, under vein, curved or full leaf distortion, has a strong impact on photosynthesis of plant, causes the underproduction to reduce.
Strawberry light yellow edge virus is distributed more widely in each cultivation area of strawberry, endangers heavier.Due to reasons such as strawberry light yellow edge virus aphis propagations, virus disease control difficulty, therefore, sets up the detection technique of efficient and sensible, becomes the key solving the problems such as seedling detection, Forepart identification, for cultivated strawberry provides safeguard.The detection technique of strawberry light yellow edge virus comprises leaflet grafting, the serological method and reverse transcription-polymerase chain reaction (RT-PCR) etc. of plant indicator at present.Leaflet grafting, the serological method cycle is long, sensitivity is lower, comparatively time-consuming takes a lot of work, it is high that reverse transcription-polymerase chain reaction (RT-PCR) detects viral sensitivity, but need special instrument and reagent, detection time is also longer, is difficult to applying detection in agriculture production unit and technology popularization department.
It is easy that reverse transcription loop-mediated isothermal amplification technique detects anti-virus operation, do not need special instrument and reagent, simple to operate, can in rapid detection under constant temperature, do not need long temperature cycle, do not need expensive PCR instrument, especially reverse transcription and amplified reaction can carry out at a constant temperature simultaneously, greatly reduce detection time, and cost is lower.After having reacted, directly can be observed by fluorescent dye, decrease the time, not need electrophoresis and ultraviolet imagery to observe detected result.Reverse transcription loop-mediated isothermal amplification technique is compared with other method for detecting virus, quick, easy, sensitive, not yet has the application of reverse transcription loop-mediated isothermal amplification technique on strawberry light yellow edge virus detects at present.
Summary of the invention
The object of this invention is to provide the primer special that detects strawberry light yellow edge virus (Strawberry mild yellow edge virus) and high specificity, the rapid molecular detection kit of strawberry light yellow edge virus (Strawberry mild yellow edge virus) of highly sensitive, easy handling, reliable results and method.
The primer special of detection strawberry light yellow edge virus provided by the present invention (Strawberry mild yellow edge virus), is made up of DNA shown in the sequence 4 of DNA shown in the sequence 3 of DNA shown in the sequence 2 of DNA shown in the sequence 1 of sequence table, sequence table, sequence table and sequence table.
The present invention also provides a kind of test kit detecting strawberry light yellow edge virus (Strawberry mild yellow edge virus), comprises described primer special.
The application that primer special of the present invention detects in the test kit of strawberry light yellow edge virus (Strawberry mild yellow edge virus) in preparation also belongs to protection scope of the present invention
Above-mentioned primer special or the application of test kit in qualification strawberry light yellow edge virus (Strawberry mild yellow edge virus) virus disease are also protection scope of the present invention.
The present invention also protects a kind of method detecting strawberry light yellow edge virus (Strawberry mild yellow edge virus) or detect strawberry light yellow edge virus (Strawberry mild yellow edge virus) disease occurrence injury, comprises the steps:
(1) geneome RNA of biological specimen to be measured is extracted;
(2) with the geneome RNA of step (1) for template, carry out reverse transcription loop-mediated constant-temperature amplification with described primer special;
(3) whether contain careless strawberry light yellow edge virus (Strawberry mild yellow edge virus) according to the described biological specimen to be measured of amplified production qualification of step (2) or whether infect strawberry light yellow edge virus (Strawberry mild yellow edge virus) disease.
The response procedures of described reverse transcription loop-mediated constant-temperature amplification is: 60 DEG C 45 minutes, 80 DEG C 10 minutes.
In the reaction system of described reverse transcription loop-mediated constant-temperature amplification, shown in the sequence 4 of DNA and sequence table shown in the sequence 1 of sequence table, the concentration of DNA is 1.0 μMs, and shown in the sequence 3 of DNA and sequence table shown in the sequence 2 of sequence table, the concentration of DNA is 0.1 μM.
The system of described reverse transcription loop-mediated constant-temperature amplification comprises: DNA shown in the sequence 1 of 1.0 μMs of sequence tables, DNA shown in the sequence 4 of 1.0 μMs of sequence tables, DNA shown in the sequence 2 of 0.1 μM of sequence table, DNA shown in the sequence 3 of 0.1 μM of sequence table, 10 × Bst buffer, 4mM MgSO 4, 1.6mM dNTPs, 0.4M Betaine, 2mM DTT, 5U AMV Reverse Transcriptase, 25U RNase Inhibitor, 8U Bst DNA polymerase, DEPC ddH 2o, amplification system cumulative volume is 25 μ l.
The detection method of described reverse transcription loop-mediated constant-temperature amplification product has two kinds:
1. add 0.1 μ l fluorescence dye SYBR green I in amplified production, direct visual perception, dye has the sample of strawberry light yellow edge virus to have throw out to be formed and present yellow-green colour, and the sample infected without strawberry light yellow edge virus is transparent and be orange;
2. conventional electrophoretic and ultraviolet imagery method, infects and has the sample of strawberry light yellow edge virus can form Waterfall type band.
The present invention is based on reverse transcription loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) strawberry light yellow edge virus (Strawberry mild yellow edge virus) detection kit and method, this test kit devises four Auele Specific Primers according to the gene conserved regions of strawberry light yellow edge virus, can strawberry light yellow edge virus in specific detection sample.Utilize test kit of the present invention to detect, testing process is quick, sensitive, easy and simple to handle, does not need other expensive instruments and reagent, and when being particularly suitable for seedling breeding, virus-free culture, field investigation, rapid detection and production basic unit technician grasp application.
Accompanying drawing explanation
Fig. 1 is SMYEV RT-LAMP each temperature of reaction amplified production electrophoresis detection; In Fig. 1, swimming lane M.DNA Marker AL2000; Swimming lane 1:60 DEG C; Swimming lane 2:61 DEG C; Swimming lane 3:62 DEG C; Swimming lane 4:63 DEG C; Swimming lane 5:64 DEG C; Swimming lane 6:65 DEG C.
Fig. 2 is SMYEV RT-LAMP differential responses time amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:30min; Swimming lane 2:45min; Swimming lane 3:60min; Swimming lane 4:75min.
Fig. 3 is SMYEV RT-LAMP primers F IP/BIP different final concentration amplified production electrophoresis detection; Wherein, swimming lane M.DNA Marker AL2000; Swimming lane 1:1.0 μM; Swimming lane 2:1.2 μM; Swimming lane 3:1.4 μM; Swimming lane 4:1.6 μM; Swimming lane 5:1.8 μM.
Fig. 4 is SMYEV RT-LAMP primers F 3/B3 different final concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:0.10 μM; Swimming lane 2:0.15 μM; Swimming lane 3:0.20 μM; Swimming lane 4:0.25 μM; Swimming lane 5:0.30 μM.
Fig. 5 is SMYEV RT-LAMP Mg 2+different final concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:2mM; Swimming lane 2:4mM; Swimming lane 3:6mM; Swimming lane 4:8mM; 5:10mM.
Fig. 6 is SMYEV RT-LAMP dNTPs different final concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:0.2mM; Swimming lane 2:0.4mM; Swimming lane 3.0.8mM; Swimming lane 4:1.2mM; Swimming lane 5:1.6mM; Swimming lane 6:2.0mM.
Fig. 7 is SMYEV RT-LAMP betaine different final concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:0.2M; Swimming lane 2:0.4M; Swimming lane 3:0.8M; Swimming lane 4:1.0M; Swimming lane 5:1.2M; Swimming lane 6:1.4M.
Fig. 8 is SMYEV RT-LAMP DTT concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:2.0mM; Swimming lane 2:2.4mM; Swimming lane 3:2.8mM; Swimming lane 4:3.2mM; Swimming lane 5:3.6mM; Swimming lane 6:4.0mM.
Fig. 9 is SMYEV RT-PCR sensitivity determination; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1: the RNA stoste of extraction does template; Swimming lane 2-8 is followed successively by RNA stoste dilution 10 1, 10 2, 10 3, 10 4, 10 5, 10 6with 10 7the diluent doubly obtained.
Figure 10 is SMYEV RT-LAMP sensitivity determination; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1: the RNA stoste of extraction does template; Swimming lane 2-8 is followed successively by RNA stoste dilution 10 1, 10 2, 10 3, 10 4, 10 5, 10 6with 10 7the diluent doubly obtained.
Figure 11 is the specific assay of SMYEV RT-LAMP; Wherein, (a) be LAMP product electrophoresis and gel imaging technology for detection; B () is detected for LAMP product adds SYBR green I; Swimming lane M:DNA Marker AL2000; Swimming lane 1: healthy plant sample RNA; Swimming lane 2-5 is followed successively by the Plant samples RNA containing SMoV, SVBV, SMYEV and SCV.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Test method in following embodiment, if no special instructions, is ordinary method.Experiment material used in following embodiment, if no special instructions, is routine biochemistry Reagent Company and purchases available.
Embodiment 1, strawberry light yellow edge virus (Strawberry mild yellow edge virus) reverse transcription loop-mediated primer and application thereof
One, the acquisition of strawberry light yellow edge virus (Strawberry mild yellow edge virus) reverse transcription loop-mediated primer
According to the cDNA sequence of strawberry light yellow edge virus (Strawberry mild yellow edge virus) RNA that the GenBank in U.S. NCBI issues, (sequence accession number is respectively AJ577339, AJ577359, D12515, D12517, EF143351, EU107085 and EU107086), strawberry light yellow edge virus (Strawberry mild yellow edge virus) coat protein gene 3 is found out after carrying out homology analysis by software DNAMAN7.0, end conserved sequence is as template, use online software Primer3Input(http: //bioinfo.ut.ee/primer3-0.4.0/primer3/) design RT-LAMP primer, and the primer of design is screened, sequence adjusts, checking, the LAMP primer that final acquisition one group of Sensitivity and Specificity is very high.Primer is synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd, and primer sequence is as following table 1;
Table 1SMYEV RT-LAMP detects primer sets
Primer Sequence 5 '-3 '
1 SMYEV-FIP Sequence 1 in CAGATCAGCGACAATTTGGACTCCTGAGGAACTTGCTGCT(sequence table)
2 SMYEV-F3 Sequence 2 in TCAAGTTGGTGACCCTTTCC(sequence table)
3 SMYEV-B3 Sequence 3 in CGAGGAACCAATGTCGTAGC(sequence table)
4 SMYEV-BIP Sequence 4 in GCTTTGTCGGGGATCCTGGGAAGGCTAAGTCGAAGAGACC(sequence table)
Two, the optimization of detection method:
The present invention is also optimized the various conditions of RT-LAMP detection method, the testing sample used in the method for reaction condition optimization takes from strawberry cultivating garden, area, ChangPing, Beijing City, field sample shows as plant and downgrades, the symptoms such as yellowing leaf and deformity, gather the blade having classical symptom, take about 0.2 gram of fresh blade, adopt plant RNA rapid extraction test kit (Ai Delai bio tech ltd, Beijing, article No.: RN09) extract RNA in testing sample, detect and the sequencing of PCR primer through RT-PCR, determine the sample containing strawberry light yellow edge virus, the RNA of extraction is placed in-80 DEG C save backup.
RT-LAMP reaction condition optimization concrete grammar is as described below:
1, the selection of optimum temperuture
The configuration of reaction soln in RT-LAMP test kit: 10 μMs of each 2.5 μ l of SMYEV-FIP and 10 μM SMYEV-BIP, 10 μMs of each 0.25 μ l(of SMYEV-F3 and 10 μM SMYEV-B3 are synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd), sky, 10 × Bst buffer2.5 μ l(Beijing bounties Gene science company, article No.: 004147), 50mM MgSO 42 μ l, 10mM dNTPs4 μ l(Beijing Ai Delai biotechnology company, article No.: 241639AH), 12.5M Betaine0.8 μ l(Shanghai Sheng Gong biotechnology company limited, article No.: BK185-100g), 0.2M DTT0.25 μ l(Shanghai Sheng Gong biotechnology company limited, article No.: D515939), 10U/ μ l AMV Reverse Transcriptase0.5 μ l(promega company, article No.: 0000033974), 40U/ μ l RNase Inhibitor0.625 μ l(Beijing hundred Tyke Bioisystech Co., Ltd, article No.: RP5601), sky, 8U Bst DNA polymerase1 μ l(Beijing bounties Gene science company, article No.: 004192), infect the RNA1 μ l extracted in the From Strawberry Leaves of strawberry light yellow edge virus, add DEPC ddH 2o(Solarbio company, article No.: R1600) to cumulative volume 25 μ l.
60,61,62,63,64,65 DEG C of totally 6 temperature of reaction gradients are set, select the suitableeest temperature.Detection system is the same, and temperature is different, and the differing temps lower reaction times is 45 minutes, 80 DEG C of heat shocks 10 hours.
Detected result: get 5 μ l RT-LAMP amplified productions and carry out 1% agarose gel electrophoresis.
All can form Waterfall type band under detected result display differing temps reaction conditions, the result difference between differing temps significantly (Fig. 1), does not therefore determine that wherein minimum temperature 60 C is detected temperatures.
2, the selection of optimum time
Select optimum temperuture 60 DEG C, arrange 30,45,60,75 minutes 4 different reaction times, 80 DEG C of heat shocks afterwards 10 minutes.All the other steps are with step 1.The detected result display differential responses time, detect electrophoresis strip with certain difference, after 45 minutes reaction times, Waterfall type band the brightest the most clear (Fig. 2), determines that the suitableeest detection time is 45 minutes.
3, the suitableeest primer concentration is selected
Primer SMYEV-FIP/SMYEV-BIP final concentration is arranged 5 different treatment such as 1.0,1.2,1.4,1.6,1.8 μMs, it is 0.1 μM that primer SMYEV-F3/SMYEV-B3 final concentration is fixed tentatively, other conditions are constant, with step 1, temperature of reaction is 60 DEG C, 45 minutes reaction times, 80 DEG C of heat shocks afterwards 10 minutes.Show through electrophoresis detection result, the different final concentrations of primer SMYEV-FIP/SMYEV-BIP to be measured all can form Waterfall type band clearly, the primer pair detected result of different concns does not affect (Fig. 3) significantly, therefore select wherein minimum primer concentration, namely SMYEV-FIP/SMYEV-BIP final concentration is 1.0 μMs.
SMYEV-F3/SMYEV-B3 final concentration is arranged 5 different treatment such as 0.1,0.15,0.2,0.25,0.3 μM, other conditions are constant, and with step 1, temperature of reaction is 60 DEG C, 45 minutes reaction times, 80 DEG C of heat shocks afterwards 10 minutes.Show through electrophoresis detection result, the different final concentrations of primer SMYEV-F3/SMYEV-B3 to be measured all can form Waterfall type band (Fig. 4) clearly, this different primers concentration measured on detected result to affect difference less, therefore, finally determine that the detectable level of primer SMYEV-F3/SMYEV-B3 is 0.1 μM.
4, Mg 2+the determination of concentration
Mg is set 2+final concentration 2,4,6,8,5 different treatment such as 10mM, other conditions are constant, with step 1, temperature of reaction 60 DEG C, 45 minutes reaction times; 80 DEG C of heat shocks afterwards 10 minutes.The Mg of detected result display different concns 2+comparatively obvious on the difference of reaction result impact, Mg 2+waterfall type band (Fig. 5) clearly can be formed when final concentration is 4mM, therefore, when RT-LAMP detects, adopt Mg 2+final concentration is 4mM.
5, the determination of dNTPs concentration
Arrange dNTPs final concentration 0.2,0.4,0.8,1.2,1.6,6 different concns process such as 2.0mM, other conditions are constant, with step 1, temperature of reaction 60 DEG C, 45 minutes reaction times, 80 DEG C of heat shocks afterwards 10 minutes.The dNTPs of detected result display different concns is comparatively obvious on reaction result impact, and when adopting the dNTPs of 1.6mM and above concentration, Waterfall type band all clear (Fig. 6), therefore, when determining to detect, the suitableeest dNTPs final concentration is 1.6mM.
6, the determination of Betaine concentration
Arrange Betaine final concentration 0.2,0.4,0.8,1.0,1.2,6 different treatment such as 1.4M, other conditions are constant, with step 1, temperature of reaction 60 DEG C, 45 minutes reaction times, 80 DEG C of heat shocks afterwards 10 minutes.The generation of Betaine to reaction result of detected result display different concns has certain influence, when Betaine final concentration be 0.4M and above time, Waterfall type band is brighter and in significantly stepped (Fig. 7), therefore, when adopting RT-LAMP to detect, Betaine final concentration is 0.4M.
7, the determination of DTT concentration
Arrange DTT final concentration 2.0,2.4,2.8,3.2,3.6,6 different concns process such as 4.0mM, other conditions are constant, with step 1, temperature of reaction 60 DEG C, 45 minutes reaction times, 80 DEG C of heat shocks afterwards 10 minutes.It is not obvious on reaction result impact that detected result shows this different concns DTT measured, and the DTT of different concns all can form the clear band (Fig. 8) of Waterfall type, and therefore, when determining to detect, the suitableeest dNTPs final concentration is 2mM.
By above-mentioned screening experiment, finally determine, strawberry light yellow edge virus is based on the key step of the detection kit of reverse transcription loop-mediated isothermal amplification technique:
The RNA in testing sample is extracted in employing plant RNA rapid extraction test kit (Ai Delai bio tech ltd, Beijing, article No.: RN09);
The configuration of reaction soln in RT-LAMP test kit: 10 μMs of each 2.5 μ l of SMYEV-FIP and 10 μM SMYEV-BIP, 10 μMs of SMYEV-F3 and 10 μM SMYEV-B3 each 0.25 μ l, 10 × Bst buffer2.5 μ l, 50mM MgSO 42 μ l, 10mM dNTPs4 μ l, 12.5M Betaine0.8 μ l, 0.2M DTT0.25 μ l, 10U/ μ l AMV Reverse Transcriptase0.5 μ l, 40U/ μ l RNase Inhibitor0.625 μ l, 8U Bst DNA polymerase1 μ l, the RNA1 μ l extracted, adds DEPC ddH 2o to cumulative volume 25 μ l; 60 DEG C of isothermal reactions 45 minutes; Wherein, SMYEV-FIP is the DNA molecular shown in sequence in sequence table 1, SMYEV-BIP for the DNA molecular shown in sequence in sequence table 4, SMYEV-F3 be the DNA molecular of sequence 2 in sequence table; SMYEV-B3 is the DNA molecular of sequence 3 in sequence table.
Detected result: after adding 0.1 μ l fluorescence dye SYBR green I in amplified production, direct visual inspection detects, and dye has the sample of strawberry light yellow edge virus to present yellow-green colour, and the sample infected without strawberry light yellow edge virus is orange; Or adopt conventional electrophoretic and ultraviolet imagery method to detect, infect and have the sample of strawberry light yellow edge virus can form Waterfall type band.
Embodiment 2, test kit of the present invention and effect thereof are monitored
One, RT-LAMP method sensitivity technique:
The technical scheme of the optimum determined according to embodiment 1 carries out the mensuration of RT-LAMP and RT-PCR detection sensitivity, detection to as if above-mentioned reaction condition optimization process in the RNA that extracts in the From Strawberry Leaves of infection strawberry light yellow edge virus selected obtain RNA stoste.
10 are obtained after same RNA stoste is carried out 10 times of gradient dilutions 1, 10 2, 10 3, 10 4, 10 5, 10 6with 10 7the doubly diluent of dilution, carries out RT-LAMP and RT-PCR amplification respectively using different diluent as template.
RT-PCR amplified reaction mainly contains two steps, and the first step is reverse transcription reaction: 10 μMs of pd (N) 90.5 μ l(Takara company, article No.: D3802), 10 μMs of Oligo dT 180.5 μ l(Takara company, article No.: D511), 10mM dNTP0.5 μ l, RNA10 μ l, adds DEPC ddH 2o(Solarbio company, article No.: R1600) to cumulative volume 15 μ l, 65 DEG C 5 minutes, ice bath 5 minutes; Add 5 × RT Buffer4 μ l(Promega company subsequently, article No.: M531A23713934), Go Script tMreverse Transcriptase0.5 μ l(Promega company, article No.: A501c0000048754), Recombinant RNasin rrinbonuclease Inhibitor(Promega company, article No.: N251A0000053050) 0.5 μ l, 37 DEG C of reverse transcriptions 2.5 hours, 72 DEG C 15 minutes.Second step is pcr amplification reaction, adopts the primer YT1/Y2(YT1CCGCTGCAGTTGTAGGGTA of the reports such as Thompson in 2004; Y2CATGGCACTCATTGGAGCTGGG), synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd, the fragment that positive can amplify is 861bp.PCR reaction system is Ai Delai bio tech ltd, 2 × Taq PCR Mix12.5 μ l(Beijing, article No.: 242128AX), 10 μMs of primer YT11 μ l, 10 μMs of primer Y21 μ l, get cDNA template 2 μ l, add DEPC ddH 2o to cumulative volume 25 μ l.Response procedures: 94 DEG C 2 minutes, 94 DEG C 30 seconds, 60 DEG C 40 seconds, 72 DEG C 60 seconds, 35 circulations, 72 DEG C extend 5 minutes.
Result shows, RNA stoste, 10 1, 10 2after doubly the diluent of dilution carries out RT-PCR reaction, significant band can be detected, 10 3doubly the diluent of dilution is as the reactant of template, and the electrophoresis detection band of RT-PCR product is unintelligible, and especially 10 4, 10 5, 10 6with 10 7the diluent doubly diluted is as the reactant of template, and electrophoresis detection does not have bands visible (Fig. 9).And when carrying out RT-LAMP detection, RNA stoste, 10 1, 10 2, 10 3, 10 4with 10 5after doubly the diluent of dilution carries out RT-LAMP detection as template, all can see significantly, band (Figure 10) clearly.Therefore, the sensitivity that the SMYEV in RT-LAMP detection From Strawberry Leaves sample detects than RT-PCR method is at least high more than 100 times, and RT-LAMP saves time than RT-PCR, is very beneficial for the detection application of strawberry light yellow edge virus.
Carry out repeating experiment for three times, result is consistent.
Two, RT-LAMP method specific detection:
Select and infect strawberry light yellow edge virus (Strawberry mild yellow edge virus, SMYEV) RNA extracted in the RNA extracted in From Strawberry Leaves and healthy strawberry blade is as negative control and respectively containing strawberry veinbanding virus (Strawberry vein banding virus, SVBV), Strawberry mottle virus (Strawberry mottle virus, SMoV), strawberry crinkle virus (Strawberry crinkle virus, etc. SCV) RNA of the important virus of 3 kinds of other strawberries carries out the specific detection (being collected in strawberry cultivating garden, Beijing containing different strawberry viral sample) of RT-LAMP detection system of the present invention.Note: wherein strawberry veinbanding virus belongs to Caulimovirus is DNA virus, but there is precursor RNA in the vegetable cell infecting virus, and RT-PCR can be utilized to carry out detecting (Yang Hong first-class report in 2007).
Detection system adopts the RT-LAMP detection system after optimizing, and adds each 1 μ l of RNA extracted in the RNA of three kinds of other viruses and healthy strawberry blade.Other reagent type, consumption and reaction conditions etc. all with optimize after test kit of the present invention consistent.Test-results display only has the RNA of SMYEV can amplify Waterfall type band, and this RT-LAMP detection system has good specificity (in Figure 11 a).And will respectively add 0.1 μ l SYBR green I(Solarbio company in reaction product, article No.: SR4110), can be observed visually dye have the sample of strawberry light yellow edge virus have throw out formed and present yellow-green colour, other sample standard deviations be orange (in Figure 11 b).

Claims (9)

1. detect the primer special of strawberry light yellow edge virus (Strawberry mild yellow edge virus), be made up of DNA shown in the sequence 4 of DNA shown in the sequence 3 of DNA shown in the sequence 2 of DNA shown in the sequence 1 of sequence table, sequence table, sequence table and sequence table.
2. detect a test kit for strawberry light yellow edge virus (Strawberry mild yellow edge virus), comprise primer special according to claim 1.
3. primer special described in claim 1 detects the application in the test kit of strawberry light yellow edge virus (Strawberry mild yellow edge virus) in preparation.
4. the application of test kit described in primer special described in claim 1 or claim 2 in qualification strawberry light yellow edge virus (Strawberry mild yellow edge virus) virus disease.
5. detect a method for strawberry light yellow edge virus (Strawberry mild yellow edge virus) or the infection of detection strawberry light yellow edge virus (Strawberry mild yellow edge virus) virus disease, comprise the steps:
(1) geneome RNA of biological specimen to be measured is extracted;
(2) with the geneome RNA of step (1) for template, carry out reverse transcription loop-mediated constant-temperature amplification with primer special according to claim 1;
(3) whether contain strawberry light yellow edge virus (Strawberry mild yellow edge virus) according to the described biological specimen to be measured of amplified production qualification of step (2) or whether infect strawberry light yellow edge virus (Strawberry mild yellow edge virus) disease.
6. method as claimed in claim 5, is characterized in that: the response procedures of described reverse transcription loop-mediated constant-temperature amplification is: 60 DEG C 45 minutes, 80 DEG C 10 minutes.
7. the method as described in claim 5 or 6, it is characterized in that: in the reaction system of described reverse transcription loop-mediated constant-temperature amplification, shown in the sequence 4 of DNA and sequence table shown in the sequence 1 of sequence table, the concentration of DNA is 1.0 μMs, and shown in the sequence 3 of DNA and sequence table shown in the sequence 2 of sequence table, the concentration of DNA is 0.1 μM.
8. method according to claim 7, it is characterized in that: the system of described loop-mediated isothermal amplification comprises: DNA shown in the sequence 1 of 1.0 μMs of sequence tables, DNA shown in the sequence 4 of 1.0 μMs of sequence tables, DNA shown in the sequence 2 of 0.1 μM of sequence table, DNA shown in the sequence 3 of 0.1 μM of sequence table, 10 × Bst buffer, 4mM MgSO 4, 1.6mM dNTPs, 0.4M Betaine, 2mM DTT, 5U AMV Reverse Transcriptase, 25U RNase Inhibitor, 8U Bst DNA polymerase, DEPC ddH 2o, amplification system cumulative volume is 25 μ l.
9. method according to claim 8, is characterized in that: the detection method of described reverse transcription loop-mediated constant-temperature amplification product is following 1) or 2) described in method:
1) add 0.1 μ l fluorescence dye SYBR green I in amplified production, direct visual perception, dye has the sample of strawberry light yellow edge virus to have throw out to be formed and present yellow-green colour, and the sample infected without strawberry light yellow edge virus is transparent and be orange;
2) conventional electrophoretic and ultraviolet imagery method, infects and has the sample of strawberry light yellow edge virus can form Waterfall type band.
CN201310731171.7A 2013-12-26 2013-12-26 Rapid detection kit and method of strawberry mild yellow edge virus Active CN103710463B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310731171.7A CN103710463B (en) 2013-12-26 2013-12-26 Rapid detection kit and method of strawberry mild yellow edge virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310731171.7A CN103710463B (en) 2013-12-26 2013-12-26 Rapid detection kit and method of strawberry mild yellow edge virus

Publications (2)

Publication Number Publication Date
CN103710463A CN103710463A (en) 2014-04-09
CN103710463B true CN103710463B (en) 2015-05-20

Family

ID=50403813

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310731171.7A Active CN103710463B (en) 2013-12-26 2013-12-26 Rapid detection kit and method of strawberry mild yellow edge virus

Country Status (1)

Country Link
CN (1) CN103710463B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104032036B (en) * 2014-06-20 2016-01-06 北京农学院 The quick detection kit of strawberry crinkle virus and method
CN104480222A (en) * 2014-12-16 2015-04-01 四川农业大学 Method for detecting pathogen of regenerated strawberry seedling detoxified by cryotherapy
JP6436598B1 (en) * 2017-12-22 2018-12-12 国立大学法人宇都宮大学 Primer set for specifically amplifying nucleic acid derived from strawberry pathogenic virus and method for detecting strawberry pathogenic virus
CN114280292A (en) * 2021-03-29 2022-04-05 北京市植物保护站 Strawberry light yellow-edge virus colloidal gold test strip and preparation method and application thereof
CN118345193A (en) * 2024-01-04 2024-07-16 湖北省农业科学院经济作物研究所 Detection method and application of strawberry hairy virus 3

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103088160B (en) * 2013-01-14 2014-10-29 宁波检验检疫科学技术研究院 Method for detecting RT-LAMP of strawberry latent ringspot virus

Also Published As

Publication number Publication date
CN103710463A (en) 2014-04-09

Similar Documents

Publication Publication Date Title
CN103667525B (en) Fast detection kit and method of strawberry mottle virus
CN103710463B (en) Rapid detection kit and method of strawberry mild yellow edge virus
Magome et al. Single-strand conformation polymorphism analysis of apple stem grooving capillovirus sequence variants
CN103667526B (en) Rapid detection kit and method for strawberry mottle virus
CN108330201A (en) Identify molecular labeling and its application of Tomato Mosaic Virus resistant gene
CN109762939A (en) For detecting the primer and probe and kit of mandarin fish rhabdovirus
CN104178585A (en) Potato virus detection primers and potato virus detection method
CN104032036B (en) The quick detection kit of strawberry crinkle virus and method
AU2020103706A4 (en) Ssr molecular marker primer related to walnut black spot disease and application thereof
CN111690759B (en) Specific primer, kit and method for detecting RPA of citrus canker pathogen
CN112251535B (en) KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof
CN110241245A (en) Detect KASP primer and its application of cucumber bacterial angular leaf spot gene
CN110184387A (en) For detecting the RT-LAMP detection primer and its application, detection reagent and detection method of ANSSV
CN103498010B (en) Primer and kit for rapidly detecting tomato chlorosis virus (ToCV) and application thereof
CN104195269B (en) A kind of method detecting tomato spotted wilf virus
CN111690777B (en) Specific primer, kit and method for RT-RPA detection of citrus leaf mottle virus
Dietzgen et al. Genetic variability of Tomato spotted wilt virus in Australia and validation of real time RT‐PCR for its detection in single and bulked leaf samples
CN116287439A (en) RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer and kit for hippeastrum chlorosis virus, and application and method thereof
CN109943666A (en) A kind of the multiple PCR primer group and its application of the main virus of detection tomato
CN110804674B (en) Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit
CN108018377B (en) RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer group, kit and method for Luo lake virus
CN111041121A (en) Real-time fluorescent PCR (polymerase chain reaction) detection kit for silver fir and products thereof and application
CN109295256A (en) The real-time fluorescence quantitative RT-PCR detection method and kit of Grapevine virus A
CN109609683A (en) A kind of LAMP detection primer detecting colletotrichum gloeosporioides Penz in olive tissue
CN116004902B (en) Primer group for detecting pathogenic bacteria of root rot of pseudo-ginseng, namely fusarium solani

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C41 Transfer of patent application or patent right or utility model
TR01 Transfer of patent right

Effective date of registration: 20170215

Address after: 100085 Beijing city Haidian District Qinghe anningzhuang Road No. 18 Building No. 4 room 218

Patentee after: Jinhe Agricultural Biotechnology Co. Ltd. (Beijing)

Address before: 102206 Beijing Changping District city Huilongguan Town Road No. 7

Patentee before: Beijing University of Agriculture