CN103710463A - Rapid detection kit and method of strawberry mild yellow edge virus - Google Patents
Rapid detection kit and method of strawberry mild yellow edge virus Download PDFInfo
- Publication number
- CN103710463A CN103710463A CN201310731171.7A CN201310731171A CN103710463A CN 103710463 A CN103710463 A CN 103710463A CN 201310731171 A CN201310731171 A CN 201310731171A CN 103710463 A CN103710463 A CN 103710463A
- Authority
- CN
- China
- Prior art keywords
- sequence
- strawberry
- yellow edge
- virus
- edge virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a special primer for detecting a strawberry mild yellow edge virus and an application thereof. The special primer for detecting the strawberry mild yellow edge virus is composed of a deoxyribonucleic acid (DNA) shown in a sequence 1 in a sequence table, a DNA shown in a sequence 2 in the sequence table, a DNA shown in a sequence 3 in the sequence table, and a DNA shown in a sequence 4 in the sequence table. The primer disclosed by the invention is utilized for detection, so that the method is rapid and sensitive in detection process, simple and convenient to operate, and free of other precious equipment and reagents, and is especially applicable to rapid detection in seedling breeding, detoxification cultivation and field investigation and grasping and application by basic technical personnel in production.
Description
Technical field
The RT-LAMP that the present invention relates to strawberry light yellow edge virus detects primer sets, detection kit and method.
Background technology
Strawberry light yellow edge virus (Strawberry mild yellow edge virus, SMYEV) on taxonomy, be subordinate to crooked Viraceae (Flexiviridae) potexvirus (Potexvirus), for the linear just ssRNA virus of unit molecule, long 5966bp.Virus particle bending, is about 470-580nm, and wide is 13nm.SMYEV infects after host plant, can be present in the epidermis and mesophyll cell of host plant, mainly by multiple aphid, in persistence mode, propagates, and virus reproducible not in amboceptor, can not transmit by amboceptor offspring; Grafting can be propagated, and between seed, pollen and plant, is in contact with one another and does not propagate.Strawberry light yellow edge virus infects after Chilean strawberry (Fragaria chiloensis) and pineapple strawberry (Fragaria nilgerrensis) conventionally asymptomatic, and infecting wild strawberry (Fragaria vesca) Symptoms is leaflet depression, leaf margin chlorisis, the decline of plant growing way.While infecting separately, make strawberry downgrade a little, but can cause blade yellow or chlorosis during Combined Infection, plant is downgraded, the irregular upper volume of leaf margin, and under vein, curved or full leaf distortion, has a strong impact on photosynthesis of plant, causes the underproduction to reduce.
Strawberry light yellow edge virus is distributed more widely in each cultivation area of strawberry, endangers heavier.Due to reasons such as strawberry light yellow edge virus aphis propagations, virus disease control difficulty, therefore, sets up the detection technique of efficient and sensible, becomes the key of problems such as solving seedling detects, early stage evaluation, for cultivated strawberry provides safeguard.The detection technique of strawberry light yellow edge virus comprises leaflet grafting, serological method and the reverse transcription-polymerase chain reaction (RT-PCR) etc. of plant indicator at present.Leaflet grafting, serological method cycle are long, sensitivity is lower, time-consuming taking a lot of work comparatively, it is highly sensitive that reverse transcription-polymerase chain reaction (RT-PCR) detects virus, but need special instrument and reagent, detection time is also longer, in agriculture production unit and technology popularization department, is difficult to applying detection.
It is easy and simple to handle that reverse transcription loop-mediated isothermal amplification technique detects virus, do not need special instrument and reagent, simple to operate, can be in rapid detection under constant temperature, do not need long temperature cycle, do not need expensive PCR instrument, especially reverse transcription and amplified reaction under steady temperature, to carry out simultaneously, reduced detection time greatly, and cost is lower.After having reacted, by fluorescent dye, can directly observe, also reduce the time, not need electrophoresis and ultraviolet imagery to observe detected result.Reverse transcription loop-mediated isothermal amplification technique is compared with other method for detecting virus, quick, easy, sensitive, not yet has the application on strawberry light yellow edge virus detects by reverse transcription loop-mediated isothermal amplification technique at present.
Summary of the invention
The rapid molecular detection kit and the method that the object of this invention is to provide the strawberry light yellow edge virus (Strawberry mild yellow edge virus) that detects the primer special of strawberry light yellow edge virus (Strawberry mild yellow edge virus) and high specificity, highly sensitive, easy handling, reliable results.
The primer special of detection strawberry light yellow edge virus provided by the present invention (Strawberry mild yellow edge virus), is comprised of DNA shown in the sequence 4 of DNA shown in the sequence 3 of DNA shown in the sequence 2 of DNA shown in the sequence 1 of sequence table, sequence table, sequence table and sequence table.
The present invention also provides the test kit of a kind of detection strawberry light yellow edge virus (Strawberry mild yellow edge virus), comprises described primer special.
The application of primer special of the present invention in the test kit of preparation detection strawberry light yellow edge virus (Strawberry mild yellow edge virus) also belongs to protection scope of the present invention
The application in identifying strawberry light yellow edge virus (Strawberry mild yellow edge virus) virus disease of above-mentioned primer special or test kit is also protection scope of the present invention.
The present invention also protects a kind of detection strawberry light yellow edge virus (Strawberry mild yellow edge virus) or detects the method that harm occurs strawberry light yellow edge virus (Strawberry mild yellow edge virus) disease, comprises the steps:
(1) extract the geneome RNA of biological specimen to be measured;
(2) take the geneome RNA of step (1) is template, with described primer special, carries out reverse transcription loop-mediated constant-temperature amplification;
(3) according to the amplified production of step (2), identify whether described biological specimen to be measured contains careless strawberry light yellow edge virus (Strawberry mild yellow edge virus) or whether infect strawberry light yellow edge virus (Strawberry mild yellow edge virus) disease.
The response procedures of described reverse transcription loop-mediated constant-temperature amplification is: 60 ℃ 45 minutes, 80 ℃ 10 minutes.
In the reaction system of described reverse transcription loop-mediated constant-temperature amplification, shown in the sequence 1 of sequence table, shown in the sequence 4 of DNA and sequence table, the concentration of DNA is 1.0 μ M, and shown in the sequence 2 of sequence table, shown in the sequence 3 of DNA and sequence table, the concentration of DNA is 0.1 μ M.
The system of described reverse transcription loop-mediated constant-temperature amplification comprises: DNA shown in the sequence 1 of 1.0 μ M sequence tables, DNA shown in the sequence 4 of 1.0 μ M sequence tables, DNA shown in the sequence 2 of 0.1 μ M sequence table, DNA shown in the sequence 3 of 0.1 μ M sequence table, 10 * Bst buffer, 4mM MgSO
4, 1.6mM dNTPs, 0.4M Betaine, 2mM DTT, 5U AMV Reverse Transcriptase, 25U RNase Inhibitor, 8U Bst DNA polymerase, DEPC ddH
2o, amplification system cumulative volume is 25 μ l.
The detection method of described reverse transcription loop-mediated constant-temperature amplification product has two kinds:
1. in amplified production, add 0.1 μ l fluorescence dye SYBR green I, naked eyes are directly observed, and dying has the sample of strawberry light yellow edge virus to have throw out to form and present yellow-green colour, and the sample that infects without strawberry light yellow edge virus is transparent and be orange;
2. conventional electrophoresis and ultraviolet imagery method, infect and have the sample of strawberry light yellow edge virus can form Waterfall type band.
The present invention is based on reverse transcription loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) strawberry light yellow edge virus (Strawberry mild yellow edge virus) detection kit and method, this test kit has designed four Auele Specific Primers according to the gene conservative region of strawberry light yellow edge virus, can specific detection sample in strawberry light yellow edge virus.Utilize test kit of the present invention to detect, testing process is quick, sensitive, easy and simple to handle, does not need other expensive instruments and reagent, and while being particularly suitable for seedling breeding, detoxification cultivation, field investigation, rapid detection and the technician of production basic unit grasp application.
Accompanying drawing explanation
Fig. 1 is each temperature of reaction amplified production electrophoresis detection of SMYEV RT-LAMP; In Fig. 1, swimming lane M.DNA Marker AL2000; Swimming lane 1:60 ℃; Swimming lane 2:61 ℃; Swimming lane 3:62 ℃; Swimming lane 4:63 ℃; Swimming lane 5:64 ℃; Swimming lane 6:65 ℃.
Fig. 2 is SMYEV RT-LAMP differential responses time amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:30min; Swimming lane 2:45min; Swimming lane 3:60min; Swimming lane 4:75min.
Fig. 3 is the different final concentration amplified production of SMYEV RT-LAMP primers F IP/BIP electrophoresis detection; Wherein, swimming lane M.DNA Marker AL2000; Swimming lane 1:1.0 μ M; Swimming lane 2:1.2 μ M; Swimming lane 3:1.4 μ M; Swimming lane 4:1.6 μ M; Swimming lane 5:1.8 μ M.
Fig. 4 is the different final concentration amplified production of SMYEV RT-LAMP primers F 3/B3 electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:0.10 μ M; Swimming lane 2:0.15 μ M; Swimming lane 3:0.20 μ M; Swimming lane 4:0.25 μ M; Swimming lane 5:0.30 μ M.
Fig. 5 is SMYEV RT-LAMP Mg
2+different final concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:2mM; Swimming lane 2:4mM; Swimming lane 3:6mM; Swimming lane 4:8mM; 5:10mM.
Fig. 6 is the different final concentration amplified production of SMYEV RT-LAMP dNTPs electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:0.2mM; Swimming lane 2:0.4mM; Swimming lane 3.0.8mM; Swimming lane 4:1.2mM; Swimming lane 5:1.6mM; Swimming lane 6:2.0mM.
Fig. 7 is the different final concentration amplified production of SMYEV RT-LAMP betaine electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:0.2M; Swimming lane 2:0.4M; Swimming lane 3:0.8M; Swimming lane 4:1.0M; Swimming lane 5:1.2M; Swimming lane 6:1.4M.
Fig. 8 is SMYEV RT-LAMP DTT concentration amplified production electrophoresis detection; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1:2.0mM; Swimming lane 2:2.4mM; Swimming lane 3:2.8mM; Swimming lane 4:3.2mM; Swimming lane 5:3.6mM; Swimming lane 6:4.0mM.
Fig. 9 is SMYEV RT-PCR sensitivity determination; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1: the RNA stoste of extraction is done template; Swimming lane 2-8 is followed successively by RNA stoste dilution 10
1, 10
2, 10
3, 10
4, 10
5, 10
6with 10
7the diluent doubly obtaining.
Figure 10 is SMYEV RT-LAMP sensitivity determination; Wherein, swimming lane M:DNA Marker AL2000; Swimming lane 1: the RNA stoste of extraction is done template; Swimming lane 2-8 is followed successively by RNA stoste dilution 10
1, 10
2, 10
3, 10
4, 10
5, 10
6with 10
7the diluent doubly obtaining.
Figure 11 is the specific assay of SMYEV RT-LAMP; Wherein, (a) be electrophoresis and the gel imaging technology for detection of LAMP product; (b) for adding SYBR green I, LAMP product detects; Swimming lane M:DNA Marker AL2000; Swimming lane 1: healthy plant sample RNA; Swimming lane 2-5 is followed successively by containing SMoV, SVBV, the Plant samples RNA of SMYEV and SCV.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Test method in following embodiment, if no special instructions, is ordinary method.Experiment material used in following embodiment, if no special instructions, is routine biochemistry reagent company and purchases available.
One, the acquisition of the reverse transcription loop-mediated primer of strawberry light yellow edge virus (Strawberry mild yellow edge virus)
According to the cDNA sequence of strawberry light yellow edge virus (the Strawberry mild yellow edge virus) RNA of the GenBank issue in U.S. NCBI, (sequence accession number is respectively AJ577339, AJ577359, D12515, D12517, EF143351, EU107085 and EU107086), by software DNAMAN7.0, undertaken finding out strawberry light yellow edge virus (Strawberry mild yellow edge virus) coat protein gene 3 after homology analysis, end conserved sequence is as template, use online software Primer3Input(http: //bioinfo.ut.ee/primer3-0.4.0/primer3/) design RT-LAMP primer, and the primer of design is screened, sequence is adjusted, checking, final one group of susceptibility and the very high LAMP primer of specificity of obtaining.Primer is synthetic by Shanghai Sheng Gong Bioisystech Co., Ltd, and primer sequence is as following table 1;
Table 1SMYEV RT-LAMP detects primer sets
| ? | Primer | Sequence 5 '-3 ' |
| 1 | SMYEV-FIP | In CAGATCAGCGACAATTTGGACTCCTGAGGAACTTGCTGCT(sequence table, sequence 1) |
| 2 | SMYEV-F3 | In TCAAGTTGGTGACCCTTTCC(sequence table, sequence 2) |
| 3 | SMYEV-B3 | In CGAGGAACCAATGTCGTAGC(sequence table, sequence 3) |
| 4 | SMYEV-BIP | In GCTTTGTCGGGGATCCTGGGAAGGCTAAGTCGAAGAGACC(sequence table, sequence 4) |
Two, the optimization of detection method:
The present invention is also optimized the various conditions of RT-LAMP detection method, the testing sample using in the method for reaction condition optimization is taken from strawberry cultivating garden, area, ChangPing, Beijing City, field sample shows as plant and downgrades, the symptoms such as blade yellow and deformity, collection has the blade of classical symptom, take approximately 0.2 gram of fresh blade, adopt plant RNA rapid extraction test kit (Ai Delai bio tech ltd, Beijing, article No.: RN09) extract the RNA in testing sample, sequencing through RT-PCR detection and PCR product, determine the sample that contains strawberry light yellow edge virus, the RNA of extraction is placed in to-80 ℃ to be saved backup.
RT-LAMP reaction condition optimization concrete grammar is as described below:
1, the selection of optimum temperuture
The configuration of reaction soln in RT-LAMP test kit: each 2.5 μ l of 10 μ M SMYEV-FIP and 10 μ M SMYEV-BIP, each 0.25 μ l(of 10 μ M SMYEV-F3 and 10 μ M SMYEV-B3 is synthetic by Shanghai Sheng Gong Bioisystech Co., Ltd), sky, 10 * Bst buffer2.5 μ l(Beijing bounties Gene science company, article No.: 004147), 50mM MgSO
42 μ l, 10mM dNTPs4 μ l(Beijing Ai Delai biotechnology company, article No.: 241639AH), 12.5M Betaine0.8 μ l(Shanghai Sheng Gong biotechnology company limited, article No.: BK185-100g), 0.2M DTT0.25 μ l(Shanghai Sheng Gong biotechnology company limited, article No.: D515939), 10U/ μ l AMV Reverse Transcriptase0.5 μ l(promega company, article No.: 0000033974), 40U/ μ l RNase Inhibitor0.625 μ l(Beijing hundred Tyke Bioisystech Co., Ltd, article No.: RP5601), sky, 8U Bst DNA polymerase1 μ l(Beijing bounties Gene science company, article No.: 004192), infect the RNA1 μ l extracting in the From Strawberry Leaves of strawberry light yellow edge virus, add DEPC ddH
2o(Solarbio company, article No.: R1600) to cumulative volume 25 μ l.
60,61,62,63,64,65 ℃ of totally 6 temperature of reaction gradients are set, select the suitableeest temperature.Detection system is the same, and temperature is different, and the lower reaction times of differing temps is 45 minutes, 80 ℃ of heat shocks 10 hours.
Detected result: get 5 μ l RT-LAMP amplified productions and carry out 1% agarose gel electrophoresis.
Detected result shows under differing temps reaction conditions all can form Waterfall type band, and the result difference between differing temps is remarkable (Fig. 1) not, therefore determines that wherein minimum temperature 60 C is detected temperatures.
2, the selection of optimum time
Select 60 ℃ of optimum temperutures, 30,45,60,75 minutes 4 different reaction times were set, 80 ℃ of heat shocks afterwards 10 minutes.All the other steps are with step 1.Detected result shows the differential responses time, detects electrophoresis strip with certain difference, and after 45 minutes reaction times, Waterfall type band the brightest the most clear (Fig. 2), determines that be 45 minutes detection time the suitableeest.
3, select the suitableeest primer concentration
Primer SMYEV-FIP/SMYEV-BIP final concentration is arranged to 5 different treatment such as 1.0,1.2,1.4,1.6,1.8 μ M, it is 0.1 μ M that primer SMYEV-F3/SMYEV-B3 final concentration is fixed tentatively, other conditions are constant, with step 1, temperature of reaction is 60 ℃, 45 minutes reaction times, 80 ℃ of heat shocks afterwards 10 minutes.Through electrophoresis detection result, show, the different final concentrations of primer SMYEV-FIP/SMYEV-BIP to be measured all can form Waterfall type band clearly, the primer pair detected result of different concns is significant impact (Fig. 3) not, therefore select wherein minimum primer concentration, SMYEV-FIP/SMYEV-BIP final concentration is 1.0 μ M.
SMYEV-F3/SMYEV-B3 final concentration is arranged to 5 different treatment such as 0.1,0.15,0.2,0.25,0.3 μ M, other conditions are constant, and with step 1, temperature of reaction is 60 ℃, 45 minutes reaction times, 80 ℃ of heat shocks afterwards 10 minutes.Through electrophoresis detection result, show, the different final concentrations of primer SMYEV-F3/SMYEV-B3 to be measured all can form Waterfall type band (Fig. 4) clearly, the different primers concentration of this mensuration on detected result to affect difference less, therefore, finally the detectable level of definite primer SMYEV-F3/SMYEV-B3 is 0.1 μ M.
4, Mg
2+determining of concentration
Mg is set
2+5 different treatment such as final concentration 2,4,6,8,10mM, other conditions are constant, with step 1,60 ℃ of temperature of reaction, 45 minutes reaction times; 80 ℃ of heat shocks afterwards 10 minutes.Detected result shows the Mg of different concns
2+difference on reaction result impact is more obvious, Mg
2+when final concentration is 4mM, can form Waterfall type band (Fig. 5) clearly, therefore, RT-LAMP adopts Mg while detecting
2+final concentration is 4mM.
5, dNTPs concentration determines
6 different concns such as dNTPs final concentration 0.2,0.4,0.8,1.2,1.6,2.0mM are set and process, other conditions are constant, with step 1, and 60 ℃ of temperature of reaction, 45 minutes reaction times, 80 ℃ of heat shocks afterwards 10 minutes.Detected result shows that the dNTPs of different concns is more obvious on reaction result impact, and when adopting the dNTPs of 1.6mM and above concentration, Waterfall type band is clear (Fig. 6) all, therefore, determines that while detecting, the suitableeest dNTPs final concentration is 1.6mM.
6, Betaine concentration determines
6 different treatment such as Betaine final concentration 0.2,0.4,0.8,1.0,1.2,1.4M are set, and other conditions are constant, with step 1, and 60 ℃ of temperature of reaction, 45 minutes reaction times, 80 ℃ of heat shocks afterwards 10 minutes.Detected result shows that the Betaine of different concns has certain influence to the generation of reaction result, when Betaine final concentration is 0.4M and when above, Waterfall type band is brighter and be significantly stepped (Fig. 7), and therefore, while adopting RT-LAMP to detect, Betaine final concentration is 0.4M.
7, DTT concentration determines
6 different concns such as DTT final concentration 2.0,2.4,2.8,3.2,3.6,4.0mM are set and process, other conditions are constant, with step 1, and 60 ℃ of temperature of reaction, 45 minutes reaction times, 80 ℃ of heat shocks afterwards 10 minutes.Detected result shows that the different concns DTT of this mensuration is not obvious on reaction result impact, and the DTT of different concns all can form the clear band (Fig. 8) of Waterfall type, therefore, determines that while detecting, the suitableeest dNTPs final concentration is 2mM.
By above-mentioned screening experiment, finally determine the key step of the detection kit of strawberry light yellow edge virus based on reverse transcription loop-mediated isothermal amplification technique:
Adopt plant RNA rapid extraction test kit (Ai Delai bio tech ltd, Beijing, article No.: RN09) extract the RNA in testing sample;
The configuration of reaction soln in RT-LAMP test kit: each 2.5 μ l of 10 μ M SMYEV-FIP and 10 μ M SMYEV-BIP, each 0.25 μ l of 10 μ M SMYEV-F3 and 10 μ M SMYEV-B3,10 * Bst buffer2.5 μ l, 50mM MgSO
42 μ l, 10mM dNTPs4 μ l, 12.5M Betaine0.8 μ l, 0.2M DTT0.25 μ l, 10U/ μ l AMV Reverse Transcriptase0.5 μ l, 40U/ μ l RNase Inhibitor0.625 μ l, 8U Bst DNA polymerase1 μ l, the RNA1 μ l extracting, adds DEPC ddH
2o is to cumulative volume 25 μ l; 60 ℃ of isothermal reactions 45 minutes; Wherein, SMYEV-FIP is the DNA molecular shown in sequence 1 in sequence table, and SMYEV-BIP is the DNA molecular shown in sequence 4 in sequence table, and SMYEV-F3 is the DNA molecular of sequence 2 in sequence table; SMYEV-B3 is the DNA molecular of sequence 3 in sequence table.
Detected result: add in amplified production after 0.1 μ l fluorescence dye SYBR green I, directly visual inspection detects, and dyes and has the sample of strawberry light yellow edge virus can present yellow-green colour, and the sample infecting without strawberry light yellow edge virus is orange; Or adopt conventional electrophoresis and ultraviolet imagery method to detect, infect and have the sample of strawberry light yellow edge virus can form Waterfall type band.
One, the sensitivity of RT-LAMP method detects:
The optimum technical scheme of determining according to embodiment 1 is carried out the mensuration of RT-LAMP and RT-PCR detection sensitivity, detection to as if above-mentioned reaction condition optimization process in the RNA that extracts in the From Strawberry Leaves of the infection strawberry light yellow edge virus selected obtain RNA stoste.
Same RNA stoste is carried out obtaining 10 after 10 times of gradient dilutions
1, 10
2, 10
3, 10
4, 10
5, 10
6with 10
7the diluent doubly diluting, the different diluent of usining is respectively carried out RT-LAMP and RT-PCR amplification as template.
RT-PCR amplified reaction mainly contains two steps, and the first step is reverse transcription reaction: 10 μ M pd (N)
90.5μ l(Takara company, article No.: D3802), 10 μ M Oligo dT
180.5μ l(Takara company, article No.: D511), and 10mM dNTP0.5 μ l, RNA10 μ l, adds DEPC ddH
2o(Solarbio company, article No.: R1600) to cumulative volume 15 μ l, 65 ℃ 5 minutes, ice bath 5 minutes; Add subsequently 5 * RT Buffer4 μ l(Promega company, article No.: M531A23713934), Go Script
tMreverse Transcriptase0.5 μ l(Promega company, article No.: A501c0000048754), Recombinant RNasin
rrinbonuclease Inhibitor(Promega company, article No.: N251A0000053050) 0.5 μ l, 37 ℃ of reverse transcriptions 2.5 hours, 72 ℃ 15 minutes.Second step is pcr amplification reaction, adopts the primer YT1/Y2(YT1CCGCTGCAGTTGTAGGGTA of the reports such as Thompson in 2004; Y2CATGGCACTCATTGGAGCTGGG), synthetic by Shanghai Sheng Gong Bioisystech Co., Ltd, the fragment that positive can amplify is 861bp.PCR reaction system is Ai Delai bio tech ltd, 2 * Taq PCR Mix12.5 μ l(Beijing, article No.: 242128AX), 10 μ M primer YT11 μ l, 10 μ M primer Y21 μ l, get cDNA template 2 μ l, add DEPC ddH
2o is to cumulative volume 25 μ l.Response procedures: 94 ℃ 2 minutes, 94 ℃ 30 seconds, 60 ℃ 40 seconds, 72 ℃ 60 seconds, 35 circulations, 72 ℃ are extended 5 minutes.
Result shows, RNA stoste, 10
1, 10
2doubly the diluent of dilution carries out, after RT-PCR reaction, significant band can being detected, 10
3doubly the diluent of dilution is as the reactant of template, and the electrophoresis detection band of RT-PCR product is unintelligible, and especially 10
4, 10
5, 10
6with 10
7doubly the diluent of dilution is as the reactant of template, and electrophoresis detection does not have bands visible (Fig. 9).And carry out RT-LAMP while detecting, RNA stoste, 10
1, 10
2, 10
3, 10
4with 10
5doubly the diluent of dilution carries out after RT-LAMP detection as template, all can see significantly, band (Figure 10) clearly.Therefore, it is at least high more than 100 times that RT-LAMP detects the sensitivity that the SMYEV in From Strawberry Leaves sample detects than RT-PCR method, and RT-LAMP saves time than RT-PCR, is very beneficial for the detection application of strawberry light yellow edge virus.
Carry out repeating for three times experiment, result is consistent.
Two, RT-LAMP method specific detection:
Select and infect strawberry light yellow edge virus (Strawberry mild yellow edge virus, SMYEV) RNA extracting in the RNA extracting in From Strawberry Leaves and healthy strawberry blade is as negative control and contain respectively strawberry veinbanding virus (Strawberry vein banding virus, SVBV), Strawberry mottle virus (Strawberry mottle virus, SMoV), strawberry crinkle virus (Strawberry crinkle virus, SCV) etc. the RNA of the important virus of 3 kinds of other strawberries carries out the specific detection (contain different strawberry viral sample and be collected in strawberry cultivating garden, Beijing) of RT-LAMP detection system of the present invention.Note: wherein strawberry veinbanding virus belongs to Caulimovirus, is DNA virus, but has precursor RNA in infecting viral vegetable cell, can utilize RT-PCR to detect (the first-class report of Yang Hong in 2007).
Detection system adopts the RT-LAMP detection system after optimizing, and adds each the 1 μ l of RNA extracting in three kinds of other viral RNA and healthy strawberry blade.Other reagent type, consumption and reaction conditions etc. are all consistent with the test kit of the present invention after optimization.Test-results shows only to have the RNA of SMYEV can amplify Waterfall type band, and this RT-LAMP detection system has good specificity (in Figure 11 a).And 0.1 μ l SYBR green I(Solarbio company will respectively be added in reaction product, article No.: SR4110), can be observed visually to dye has the sample of strawberry light yellow edge virus to have throw out form and present yellow-green colour, and other sample standard deviations are orange (b in Figure 11).
Claims (9)
1. detect the primer special of strawberry light yellow edge virus (Strawberry mild yellow edge virus), by DNA shown in the sequence 4 of DNA shown in the sequence 3 of DNA shown in the sequence 2 of DNA shown in the sequence 1 of sequence table, sequence table, sequence table and sequence table, formed.
2. detect a test kit for strawberry light yellow edge virus (Strawberry mild yellow edge virus), comprise primer special claimed in claim 1.
3. the application of primer special in the test kit of preparation detection strawberry light yellow edge virus (Strawberry mild yellow edge virus) described in claim 1.
4. the application of test kit in identifying strawberry light yellow edge virus (Strawberry mild yellow edge virus) virus disease described in primer special or claim 2 described in claim 1.
5. detect strawberry light yellow edge virus (Strawberry mild yellow edge virus) or detect the method that strawberry light yellow edge virus (Strawberry mild yellow edge virus) virus disease infects, comprising the steps:
(1) extract the geneome RNA of biological specimen to be measured;
(2) take the geneome RNA of step (1) is template, with primer special claimed in claim 1, carries out reverse transcription loop-mediated constant-temperature amplification;
(3) according to the amplified production of step (2), identify whether described biological specimen to be measured contains strawberry light yellow edge virus (Strawberry mild yellow edge virus) or whether infect strawberry light yellow edge virus (Strawberry mild yellow edge virus) disease.
6. method as claimed in claim 5, is characterized in that: the response procedures of described reverse transcription loop-mediated constant-temperature amplification is: 620 ℃ 45 minutes, 80 ℃ 10 minutes.
7. the method as described in claim 5 or 6, it is characterized in that: in the reaction system of described reverse transcription loop-mediated constant-temperature amplification, shown in the sequence 1 of sequence table, shown in the sequence 4 of DNA and sequence table, the concentration of DNA is 1.0 μ M, and shown in the sequence 2 of sequence table, shown in the sequence 3 of DNA and sequence table, the concentration of DNA is 0.1 μ M.
8. method according to claim 7, it is characterized in that: the system of described loop-mediated isothermal amplification comprises: DNA shown in the sequence 1 of 1.0 μ M sequence tables, DNA shown in the sequence 4 of 1.0 μ M sequence tables, DNA shown in the sequence 2 of 0.1 μ M sequence table, DNA shown in the sequence 3 of 0.1 μ M sequence table, 10 * Bst buffer, 4mM MgSO
4, 1.6mM dNTPs, 0.4M Betaine, 2mM DTT, 5U AMV Reverse Transcriptase, 25U RNase Inhibitor, 8U Bst DNA polymerase, DEPC ddH
2o, amplification system cumulative volume is 25 μ l.
9. method according to claim 8, is characterized in that: the detection method of described reverse transcription loop-mediated constant-temperature amplification product is following 1) or 2) described method:
1) in amplified production, add 0.1 μ l fluorescence dye SYBR green I, naked eyes are directly observed, and dying has the sample of strawberry light yellow edge virus to have throw out to form and present yellow-green colour, and the sample that infects without strawberry light yellow edge virus is transparent and be orange;
2) conventional electrophoresis and ultraviolet imagery method, infect and have the sample of strawberry light yellow edge virus can form Waterfall type band.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310731171.7A CN103710463B (en) | 2013-12-26 | 2013-12-26 | Rapid detection kit and method of strawberry mild yellow edge virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310731171.7A CN103710463B (en) | 2013-12-26 | 2013-12-26 | Rapid detection kit and method of strawberry mild yellow edge virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710463A true CN103710463A (en) | 2014-04-09 |
| CN103710463B CN103710463B (en) | 2015-05-20 |
Family
ID=50403813
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310731171.7A Active CN103710463B (en) | 2013-12-26 | 2013-12-26 | Rapid detection kit and method of strawberry mild yellow edge virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710463B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104032036A (en) * | 2014-06-20 | 2014-09-10 | 北京农学院 | Quick detection kit and method for strawberry crinkle virus (SCV) |
| CN104480222A (en) * | 2014-12-16 | 2015-04-01 | 四川农业大学 | Method for detecting pathogen of regenerated strawberry seedling detoxified by cryotherapy |
| JP6436598B1 (en) * | 2017-12-22 | 2018-12-12 | 国立大学法人宇都宮大学 | Primer set for specifically amplifying nucleic acid derived from strawberry pathogenic virus and method for detecting strawberry pathogenic virus |
| CN114280292A (en) * | 2021-03-29 | 2022-04-05 | 北京市植物保护站 | Strawberry light yellow-edge virus colloidal gold test strip and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088160A (en) * | 2013-01-14 | 2013-05-08 | 宁波检验检疫科学技术研究院 | Method for detecting RT-LAMP of strawberry latent ringspot virus |
-
2013
- 2013-12-26 CN CN201310731171.7A patent/CN103710463B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088160A (en) * | 2013-01-14 | 2013-05-08 | 宁波检验检疫科学技术研究院 | Method for detecting RT-LAMP of strawberry latent ringspot virus |
Non-Patent Citations (2)
| Title |
|---|
| 北海三共等: "《RT-LAMPによるイチゴマイルドイエローエッジウイルス（SVBV）及びイチゴベインバンディングウイルス（SMYEV）の検出》", 《日本植物病理学会报》, vol. 74, no. 3, 25 August 2008 (2008-08-25), pages 1 * |
| 杨洪一: "《草莓轻型黄边病毒的RT-PCR检测及其3’端序列分析》", 《园艺学报》, vol. 32, no. 3, 31 December 2005 (2005-12-31), pages 403 - 407 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104032036A (en) * | 2014-06-20 | 2014-09-10 | 北京农学院 | Quick detection kit and method for strawberry crinkle virus (SCV) |
| CN104032036B (en) * | 2014-06-20 | 2016-01-06 | 北京农学院 | The quick detection kit of strawberry crinkle virus and method |
| CN104480222A (en) * | 2014-12-16 | 2015-04-01 | 四川农业大学 | Method for detecting pathogen of regenerated strawberry seedling detoxified by cryotherapy |
| JP6436598B1 (en) * | 2017-12-22 | 2018-12-12 | 国立大学法人宇都宮大学 | Primer set for specifically amplifying nucleic acid derived from strawberry pathogenic virus and method for detecting strawberry pathogenic virus |
| CN114280292A (en) * | 2021-03-29 | 2022-04-05 | 北京市植物保护站 | Strawberry light yellow-edge virus colloidal gold test strip and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710463B (en) | 2015-05-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667525B (en) | Fast detection kit and method of strawberry mottle virus | |
| CN103710463B (en) | Rapid detection kit and method of strawberry mild yellow edge virus | |
| CN108018378A (en) | A kind of Luohu virus Taq-man fluorescence probe quantitative PCRs detection kit and detection method | |
| CN103667526B (en) | Rapid detection kit and method for strawberry mottle virus | |
| CN109762939A (en) | For detecting the primer and probe and kit of mandarin fish rhabdovirus | |
| CN108330201A (en) | Identify molecular labeling and its application of Tomato Mosaic Virus resistant gene | |
| CN101363063B (en) | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR | |
| CN112280879A (en) | RPA primer and kit for rapidly detecting citrus yellow shoot Asian species, detection method and application thereof | |
| CN103074447A (en) | Establishment of PCR-HRM analysis method for rapid differential diagnosis of different serotypes of avian leukemia viruses | |
| AU2020103706A4 (en) | Ssr molecular marker primer related to walnut black spot disease and application thereof | |
| CN111690777B (en) | Specific primer, kit and method for RT-RPA detection of citrus leaf mottle virus | |
| CN103498010B (en) | Primer and kit for rapidly detecting tomato chlorosis virus (ToCV) and application thereof | |
| Dietzgen et al. | Genetic variability of Tomato spotted wilt virus in Australia and validation of real time RT‐PCR for its detection in single and bulked leaf samples | |
| CN102002537B (en) | Reagent assisting in identifying sowbane mosaic virus (SoMV) and application thereof | |
| CN111690759A (en) | Specific primer, kit and method for detecting RPA of citrus canker pathogen | |
| CN109943666A (en) | A kind of the multiple PCR primer group and its application of the main virus of detection tomato | |
| CN114231603B (en) | Primer, reagent, identification method and kit for identifying paeonia boita | |
| CN104032036B (en) | The quick detection kit of strawberry crinkle virus and method | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN109468392B (en) | Real-time fluorescence PCR detection method for Ericerus citriodora, and primer and probe for detection | |
| CN111041121A (en) | Real-time fluorescent PCR (polymerase chain reaction) detection kit for silver fir and products thereof and application | |
| CN101812540B (en) | Real-time fluorescent quantitative RT-PCR method for detecting garden balsam necrotic spot virus, primer, probe and kit thereof | |
| CN109295256A (en) | The real-time fluorescence quantitative RT-PCR detection method and kit of Grapevine virus A | |
| CN107435064B (en) | qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting harmful golden algae in chlorella culture | |
| CN114921567B (en) | RPA primer, probe, kit and detection method for detecting pratylenchus coffei |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20170215 Address after: 100085 Beijing city Haidian District Qinghe anningzhuang Road No. 18 Building No. 4 room 218 Patentee after: Jinhe Agricultural Biotechnology Co. Ltd. (Beijing) Address before: 102206 Beijing Changping District city Huilongguan Town Road No. 7 Patentee before: Beijing University of Agriculture |