CN101363063B - Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR - Google Patents
Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR Download PDFInfo
- Publication number
- CN101363063B CN101363063B CN2007100755868A CN200710075586A CN101363063B CN 101363063 B CN101363063 B CN 101363063B CN 2007100755868 A CN2007100755868 A CN 2007100755868A CN 200710075586 A CN200710075586 A CN 200710075586A CN 101363063 B CN101363063 B CN 101363063B
- Authority
- CN
- China
- Prior art keywords
- type
- pcr
- probe
- primer
- influenza virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer, a probe and a detection kit containing the primer and the probe, which are used for detecting A type, B type and H5 subtype influenza viruses through triple fluorescence quantitative RT-PCR. The invention also discloses a method for executing fluorescence quantitative RT-PCR for A type, B type and H5 subtype influenza viruses by using the primer and the probe. The detection kit includes RT-PCR reaction buffer, Taq enzyme, inverse transcriptase, DEPC liquid, positive control and negative control. The process involves the steps of establishing a RT-PCR reaction system by using the primer and the probe, extracting DNA or RNA from a specimen to be detected, adding the extracted DNA or RNA into the aforesaid reaction system, setting reaction conditions, carrying out RT-PCR augmentation and fluorescence signal detection. The invention can identify A type, B type and H5 subtype influenza viruses in the detected specimen within 3-4 hours in a fast, exact, specific, safe, simple and convenient way. The invention also has the advantages of quantitative analysis, high sensitivity, being difficult to pollute and wide application scope.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of triple fluorescent quantitative RT-PCR technology and application thereof that can detect A type, Type B and H5 subtype influenza virus simultaneously.
Background technology
Avian influenza virus (AIV) is the poultry that caused by A type influenza virus and a kind of deadly infectious disease of wild fowl, brings about great losses to aviculture, and China Ministry of Agriculture and World Organization for Animal Health all are decided to be it category-A transmissible disease.Its pathological change of bird flu is different because of power, course of disease length and the fowl kind of infective virus strain virulence.Its clinical symptom because of the kind that infects fowl, age, sex, accompanying infection situation and infect strain the different symptoms that show such as virulence and other environment very inconsistent.Break out and the popular history in existing more than 100 year by now in Italy from bird flu in 1878.Bird flu has become the transmissible disease with important public health meaning, this disease not only has unexpected, the characteristics such as propagation is rapid, sickness rate is high, lethality rate height that take place, and avian influenza virus is the gene pool of nearly all A type influenza virus, and the popularity of its natural reservoir (of bird flu viruses) and heritable variation bring very big difficulty for the timely etiologic diagnosis and the prevention of bird flu.Since migratory bird migrate frequent day by day with international bird trade, make this disease be global distribution, cause enormous economic loss to aviculture.Thought avian influenza virus to crowd's had no pathogenicity, but " infected person all took place in the H5 in Hong Kong H5 avian influenza, H9 in 2000,2003 Dutch H7 to 2004 year Asia, even caused the personnel death, mortality ratio about about 30% in 1997 in the past.The SARS of its hazardness than 2003 also greatly, also is difficult to expect.Having caused for whole national economy and social development seriously influences.The diagnosis of bird flu for a long time depends on Pathogen Isolation and evaluation always.Bird flu agar diffusion (AGP), hemagglutination-inhibition test (HI), neuraminidase inhibition test (NI), indirect enzyme-linked immunosorbent assay serodiagnosis technology and the molecular diagnostic techniques of setting up in succession (RT-PCR) such as (ELAISA) do not satisfied the epidemiological surveillance of China's bird flu and respiratory tract disease and pressing for of field diagnostic and anti-system far away in recent years.
The real-time fluorescence quantitative PCR technology was released by U.S. Applied Biosystems company in 1996, it is the emerging technology that integrates pcr amplification technology, probe hybridization technology and FRET (fluorescence resonance energy transfer) spectroscopic techniques, this technology has realized the leap of PCR from qualitative to quantitative, American-European at present, some countries of Japan widespread use.The principle of fluorescent quantitative PCR technique is meant: add fluorophor in the PCR reaction system, utilize the fluorescent signal accumulation whole PCR process of monitoring in real time, the method for by typical curve unknown template being carried out quantitative analysis at last.This method is to be used in virus at present in the world to detect upward one of state-of-the-art detection method, has the incomparable advantage of common PCR amplification technique:
1, specificity height.The Taq enzyme just can start its 5 '-3 ' 5 prime excision enzyme activity of holding when probe and template matches to be measured because have only, the growth that fluorophor on the probe is cut down and produce fluorescence intensity, so fluorescent quantitative PCR technique has overcome the false positive problem that regular-PCR causes owing to non-specific amplification.
2, susceptibility height.The fluorescent PCR technology can detect the nucleic acid of utmost point low copy number, and early diagnosis is truly become a reality.
3, high-throughput, high-level efficiency.Can automatically finish the amplification and the detection of more or less a hundred sample synchronously in 1～2 hour, and favorable reproducibility as a result.
4, need not gel electrophoresis, adopt totally-enclosed reaction tubes and photoelectricity conducting system, no pipeline internal contamination.
5, can carry out quantitative analysis to the PCR product of DNA and RNA.
American-European in recent years, some countries of Japan also carry out the research of RT-PCR and multiple fluorescence quantitative PCR.Domesticly do not see that multiple fluorescence quantitative PCR detects the influenza virus bibliographical information.Domestic method for quick commonly used is conventional P CR or half-nest type-MPCR at present.There is certain defective in aforesaid method, and it is many and time-consuming to be prone to false positive, crossed contamination, operation steps as conventional P CR or half-nest type-MPCR technology.And that multiple fluorescence quantitative PCR has is simple to operate, can be quantitatively, pollute less, detection speed is fast, detects a plurality of different shaped and subtype influenza virus (A type, Type B, H5 hypotype and H9 hypotype) simultaneously.The minimum that detects virus is 10
-5Advantages such as TCID50 more and more are subjected to scholar's approval and research." multiple fluorescence quantitative PCR rapid detection influenza people (fowl) virus and accurate somatotype ", this research not only belongs to first at home, and also belongs to advanced level in the world.Aspect China's influenza quick diagnosis research, still rest in conventional P CR or the half-nest type-MPCR technology, this and China are extremely unbecoming as influenza multiplely, therefore, the research and development multiple fluorescence quantitative PCR detects the influenza virus technology, for the influenza virus quick diagnosis technology that makes China in line with international standards as soon as possible, adapt to the development of the society that advances fast now, guarantee that people's life security is significant with the interests of country.
Summary of the invention
Technical problem to be solved by this invention is: provide a kind of triple fluorescent quantitative RT-PCR to detect primer, probe, detection kit and the method for A type, Type B and H5 subtype influenza virus, allowing to detecting A type, Type B and H5 subtype influenza virus simultaneously, and simple to operate, can be quantitatively, pollute less, detection speed is fast.
In order to solve the problems of the technologies described above, the present invention by the following technical solutions:
Triple fluorescent quantitative RT-PCR of the present invention detects the primer and the probe of A type, Type B and H5 subtype influenza virus, and its DAN sequence is as follows:
A type upstream primer: 5 ' CAGAGACTTGAAGATGTTTTTGC,
Downstream primer: 5 ' CTACGCRGCAGTCCTCGCTC,
TaqMan probe: 5 ' FAM-CAAGACCAATCCTGTCACCTCTGA-BHQ1;
The Type B upstream primer: 5 ' AAATACGGTGGATTAAATAAAAGCAA,
Downstream primer: 5 ' CCAGCAATAGCTCCGAAGAAA,
TaqMan probe: 5 ' CY5-CACCCATATTGGGCAATTTCTATGGC-BHQ2;
H5 hypotype upstream primer: 5 ' CCTTTACGACAAGGTCCGACT,
Downstream primer: 5 ' CCACTTATTTCCTCTCTTTTTARTCTTGCTTC,
TaqMan probe: 5 ' ROX-ACGGAACGTATGACTACCCG-BHQ2.
Triple fluorescent quantitative RT-PCR of the present invention detects the test kit of A type, Type B and H5 subtype influenza virus, comprises above-mentioned all primers and probe.
Further, above-mentioned triple fluorescent quantitative RT-PCR detects the test kit of A type, Type B and H5 subtype influenza virus, its primer and probe and buffer, MgCl
2Each 1mM of 5mM, dNTPs is loaded on and constitutes RT-PCR reaction buffer in the container, and the concentration of each primer is 5mM, and the concentration of A type probe is 250nM, and the concentration of the probe of Type B, H5 type is 200nM; Also comprise Taq enzyme, ThermoScript II, DEPC water, positive control and negative control.
Further, above-mentioned triple fluorescent quantitative RT-PCR detects the test kit of A type, Type B and H5 subtype influenza virus can make 48 person-portion test kits, and this 48 person-portion test kit contains:
RT-PCR reaction Buffer 1ml
Taq enzyme 12ul
ThermoScript II 12ul
DEPC water 1ml
Positive control 1ml
Negative control 1ml.
ThermoScript II in the mentioned reagent box is mouse source ThermoScript II (being M-MLV Rtase).DEPC water in the test kit also is diethyl pyrocarbonate water or diethylpyrocarbonate water, adopts general DEPC water in the industry, is to use the DEPC treated water.
Utilize above-mentioned primer and probe A type, Type B and H5 influenza virus to be carried out the method for fluorescence quantitative RT-RCR, process comprises utilizes described primer, probe to set up the RT-PCR reaction system, from sample to be measured, extract DNA or extract RNA, add in the previous reaction system, with on quantitative real time PCR Instrument, set reaction conditions, carry out RT-PCR amplification and fluorescent signal and measure, it is characterized in that:
(1) the 50 μ l RT-PCR reaction systems of utilizing described primer, probe to set up comprise:
10 times of reaction buffer 5 μ l, MgCl
25mM, each 1mM of dNTPs, RNA enzyme inhibitors (Rnaseinhibiter) 40U, ThermoScript II 25U, Taq enzyme 5U, A type influenza virus upstream and downstream each 0.5mM of primer, Type B influenza virus upstream and downstream each 0.5mM of primer, H5 subtype influenza virus upstream and downstream each 0.5mM of primer, A type probe 250nM, Type B probe 200nM, H5 type probe 200nM, A type, Type B, each 2 μ l of H5 hypotype template ribonucleic acid;
(2) described reaction conditions is: after 48 ℃ of reverse transcriptions in 30 minutes, 95 ℃ of warm starts in 10 minutes enter the circulation of 45 pcr amplifications then, and circulating temperature is controlled to be 95 ℃ of 60 ℃ of annealing after 15 seconds 1 minute.
Compared with prior art, the present invention has the following advantages:
1, adopt multiple fluorescence quantitative RT-PCR, simple to operate, can be quantitatively, pollute less, detection speed is fast, can detect A type, Type B, H5 subtype influenza virus simultaneously, detect viral minimum and reach 10
-5TCID50.
2, technique effect is good: the detection kit of setting up " multiple fluorescence quantitative RT-PCR technology rapid detection A type, Type B and H5 subtype influenza virus ", can be in 3-4 hour from detected sample, quick, accurate, special, safe, easy the A type that identifies influenza virus, Type B and H5 hypotype.The minimum that detects virus is respectively 2.56X10
-5, 5.0X10
-5, 1.49X10
-5Individual TCID50, but quantitative analysis, more highly sensitive, sensitive than nido RT-PCR, and be not easy to pollute, and conventional P CR or half-nest type-MPCR detect the minimum of virus and have only 0.01-0.1TCID50.
3, applied widely: very the detection and the discriminating that are applicable to present various Respirovirus disease and influenza, bird flu, also can detect simultaneously and pollute by avian influenza virus, and the viral level level is few, and general method is not easy detected bird product and work in-process.
Description of drawings
Fig. 1 is that A type, Type B H5 subtype influenza virus triple fluorescent RT-PCR detect figure;
Fig. 2 is A type, ten times of dilution standard graphic representations of Type B H5 subtype influenza virus triple fluorescent RT-PCR.
Embodiment
Below by specific embodiment the present invention is carried out more detailed description.
A, principle summary:
Adopt the A.B and the H5 hypotype Taqman probe of different fluorophor marks, after increasing, can utilize the multi-channel detection function of hyperchannel quantitative fluorescent PCR instrument, simultaneously three kinds of viruses are carried out the fluorescent signal Collection and analysis through triple PCR.
B, enforcement details:
1, material:
A type, Type B and H5 subtype influenza virus are preserved by this laboratory culture; RNA extracts test kit available from ROCHE company; One Step Real-time RT-PCR is available from the precious biotech firm in Dalian; Primer and corresponding TaqMan probe design by the inventor, and synthetic by Shanghai Bo Ya company; Quantitative real time PCR Instrument is the MX4000 type of Stratagene company.
2, method:
2.1 utilize Primer Express software to design primer and corresponding TaqMan probe thereof respectively at A type, Type B and H5 subtype influenza virus conserved sequence.Concrete dna sequence dna is as follows:
A type upstream primer: 5 ' CAGAGACTTGAAGATGTTTTTGC,
Downstream primer: 5 ' CTACGCRGCAGTCCTCGCTC,
The TaqMan probe: 5 ' FAM-CAAGACCAATCCTGTCACCTCTGA-BHQ1,
Amplified fragments size 154bp;
The Type B upstream primer: 5 ' AAATACGGTGGATTAAATAAAAGCAA,
Downstream primer: 5 ' CCAGCAATAGCTCCGAAGAAA,
The TaqMan probe: 5 ' CY5-CACCCATATTGGGCAATTTCTATGGC-BHQ2,
Amplified fragments size 170bp;
H5 hypotype upstream primer: 5 ' CCTTTACGACAAGGTCCGACT,
Downstream primer: 5 ' CCACTTATTTCCTCTCTTTTTARTCTTGCTTC,
The TaqMan probe: 5 ' ROX-ACGGAACGTATGACTACCCG-BHQ2,
Amplified fragments size 174bp.
2.2 A type, Type B and H5 hypotype fluorescence quantitative RT-RCR reaction conditions (primer, probe, enzyme, dNTP, Mg
2+) foundation and optimization.
2.2.1 get each 200 μ l of A type, Type B and H5 subtype influenza virus-culturing fluid, extract total RNA respectively with the RNA extraction test kit of ROCHE company, dissolve with 50 μ l Elution Buffer.
2.2.2 get the precious One Step Real-time RT-PCR of the biotech firm test kit in Dalian, 50 μ l reaction systems comprise:
10 times of reaction buffer 5 μ l, MgCl
25mM, each 1mM of dNTPs (dNTPs has comprised four kinds of components, and every kind of component concentrations is 1mM), RNA enzyme inhibitors (Rnase inhibiter) 40U, M-MLV Rtase25U, Taq enzyme 5U, A type influenza virus upstream and downstream each 0.5mM of primer, Type B influenza virus upstream and downstream each 0.5mM of primer, H5 subtype influenza virus upstream and downstream each 0.5mM of primer, A type probe 250nM, Type B probe 200nM, H5 type probe 200nM, A type, Type B, each 2 μ l of H5 hypotype template ribonucleic acid.
2.2.3 FQ-PCR reaction conditions: after 48 ℃ of reverse transcriptions in 30 minutes, 95 ℃ of warm starts in 10 minutes enter the circulation of 45 pcr amplifications then, and circulating temperature is controlled to be 95 ℃ of 60 ℃ of annealing after 15 seconds 1 minute.
2.2.4 the foundation of sensitivity analysis and typical curve
Get the influenza of suitable titre and get A type, Type B and H5 subtype virus nutrient solution extracting RNA, then RNA is carried out 10 times of gradient dilutions, high dilution is 10
-6Each concentration gradient RNA carries out the fluorescence RT-PCR reaction simultaneously, calculates typical curve by quantitative real time PCR Instrument.
2.2.5 specificity check: get adenovirus, respiratory syncytial virus, chlamydozoan, mycoplasma nutrient solution 200 μ l extract RNA and DNA respectively, carry out Real-time RT-PCR check by the 2.2.2 reaction system.
2.2.6 the research and development of test kit and popularization: with corresponding primer, probe, enzyme, dNTP, Mg in the reaction system
2+Deng mixing in proportion respectively and pack, and carry out pilot scale and popularization at associated mechanisms.
3, result:
3.1 get A type, Type B and H5 subtype influenza virus triple fluorescent RT-PCR detection sensitivity and typical curve
According to influenza strain A, B and H5 TCID
50The titration results of method is got 2.56,5.0 and 1.49 TICD respectively
50Viral RNA, ten times of gradient dilutions respectively, greatest dilution is respectively 2.56X10
-5, 5.0X10
-5, 1.49X10
-5Identical extent of dilution A, B and H5 viral RNA are mixed in the same triple response system pipe of adding, and the fluorescence RT-PCR reaction result is seen Fig. 1 and Fig. 2.As can see from Figure 1 in same detection reaction system success detected FAM, CY5, three positive fluorescent signals of ROX illustrate three kinds of different influenza virus As, the RNA of B and H5 is detected in system simultaneously.The three pairs of primers in the system and the viral RNA to separately of probe specificity have carried out good pcr amplification, do not find tangible interference phenomenon each other.As can be seen from the figure, FAM, CY5, the fluorescent value of three fluorescence curves of ROX is all different, and this may be because the difference of three kinds of fluorophors itself causes.And the equal difference to some extent of the CT value of three curves, this may differ relevant with the rna contents that three kinds of viruses add, and also may cause in the inconsistent institute of the reaction efficiency under the identical conditions with these three kinds of primers.
Respectively with the TCID of A type, Type B and H5 subtype influenza virus
50Concentration is X-coordinate, is the ordinate zou mapping with RT-PCT round-robin CT value separately, can obtain three typical curves that triple fluorescent RT-PCR reaction pair A type, Type B virus carry out relative quantification, sees Fig. 2.Wherein the slope of A type typical curve is-3.062, and amplification efficiency is 112.1%, and relation conefficient is 1.000; The slope of Type B typical curve is-3.142, and amplification efficiency is 108.1%, and relation conefficient is 0.998, and wherein the slope of H5 hypotype typical curve is-3.238, and amplification efficiency is 103.6%, and relation conefficient is 0.999.Article three, the coefficient R of typical curve is all greater than 0.998, slope all between 3.0-3.6, and amplification efficiency also between 90%-110% the linear relationship of the whole amplified reaction of explanation fairly good, it is also quite abundant to increase.This triple response system quite stable is described, can carries out qualitative and detection by quantitative to A type, Type B and H5 subtype influenza virus fast and accurately.
3.2 for using adenovirus, respiratory syncytial virus, chlamydozoan in the check that mycoplasma carries out, does not all have positive reaction, illustrates that this multiple reaction check system has good specificity.
3.3 with corresponding primer, probe, enzyme, dNTP, Mg in the above-mentioned reaction system
2+Deng mixing (soon can blended composition all be pre-mixed) and packing respectively in proportion, make commercial test kit, this test kit is 48 person-portion test kits, the formation of test kit sees the following form:
| Component | Specification |
| RT-PCR reacts Buffer | 1ml |
| The Taq enzyme | 12ul |
| ThermoScript II | 12ul |
| DEPC water | 1ml |
| Positive control | 1ml |
| Negative control | 1ml |
| Process specifications | 1 |
RT-PCR reaction Buffer wherein contains: 10 * buffer, MgCl
25mM, each 1mM of dNTPs, A type upstream and downstream each 5mM of primer, Type B upstream and downstream each 5mM of primer, H5 hypotype upstream and downstream each 5mM of primer, A type probe 250nM, Type B, each 250nM of H5 type probe.
Above-mentioned 48 person-portion test kits are an embodiment, can make the test kit of other specification in the practical application in the ratio in the above-mentioned reaction system, as 100 person-portion test kits etc.
ThermoScript II in the present embodiment adopts M-MLV Rtase (being mouse source ThermoScript II), also can adopt AMVRtase (being the avian myeloblastic leukosis virus ThermoScript II).
The nucleotides sequence tabulation
＜110〉Wu Chunli, Cheng Xiaowen
＜120〉triple fluorescent quantitative RT-PCR detects primer, probe, test kit and the method for A, B and H5 subtype influenza virus
<160>9
<170>PatentIn?version?3.3
<210>1
<211>23
<212>DNA
<213>Homo?sapiens
<400>1
<210>2
<211>20
<212>DNA
<213>Homo?sapiens
<400>2
<210>3
<211>24
<212>DNA
<213>Homo?sapiens
<400>3
<210>4
<211>26
<212>DNA
<213>Homo?sapiens
<400>4
<210>5
<211>21
<212>DNA
<213>Homo?sapiens
<400>5
<210>6
<211>26
<212>DNA
<213>Homo?sapiens
<400>6
<210>7
<211>21
<212>DNA
<213>Homo?sapiens
<400>7
<210>8
<211>32
<212>DNA
<213>Homo?sapiens
<400>8
<210>9
<211>20
<212>DNA
<213>Homo?sapiens
<400>9
Claims (5)
1. triple fluorescent quantitative RT-PCR detects the primer and the probe of A type, Type B and H5 subtype influenza virus, and its DAN sequence is as follows:
A type upstream primer: 5 ' CAGAGACTTGAAGATGTTTTTGC,
Downstream primer: 5 ' CTACGCRGCAGTCCTCGCTC,
TaqMan probe: 5 ' FAM-CAAGACCAATCCTGTCACCTCTGA-BHQ1;
The Type B upstream primer: 5 ' AAATACGGTGGATTAAATAAAAGCAA,
Downstream primer: 5 ' CCAGCAATAGCTCCGAAGAAA,
TaqMan probe: 5 ' CY5-CACCCATATTGGGCAATTTCTATGGC-BHQ2;
H5 hypotype upstream primer: 5 ' CCTTTACGACAAGGTCCGACT,
Downstream primer: 5 ' CCACTTATTTCCTCTCTTTTTARTCTTGCTTC,
TaqMan probe: 5 ' ROX-ACGGAACGTATGACTACCCG-BHQ2.
2. triple fluorescent quantitative RT-PCR detects the test kit of A type, Type B and H5 subtype influenza virus, it is characterized in that: comprise described all primers of claim 1 and probe.
3. triple fluorescent quantitative RT-PCR according to claim 2 detects the test kit of A type, Type B and H5 subtype influenza virus, it is characterized in that: all primers and probe and buffer, MgCl
2Each 1mM of 5mM, dNTPs is loaded on and constitutes RT-PCR reaction buffer in the container, and the concentration of each primer is 5mM, and the concentration of A type probe is 250nM, and the concentration of the probe of Type B, H5 type is 200nM; Also comprise Taq enzyme, ThermoScript II, DEPC water, positive control and negative control.
4. triple fluorescent quantitative RT-PCR according to claim 3 detects the test kit of A type, Type B and H5 subtype influenza virus, and it is characterized in that: this test kit is 48 person-portion test kits, and it contains:
RT-PCR reaction Buffer 1ml
Taq enzyme 12ul
ThermoScript II 12ul
DEPC water 1ml
Positive control 1ml
Negative control 1ml.
5. according to the test kit of claim 3 or 4 described triple fluorescent quantitative RT-PCRs detection A types, Type B and H5 subtype influenza virus, it is characterized in that: described ThermoScript II is a mouse source ThermoScript II.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100755868A CN101363063B (en) | 2007-08-10 | 2007-08-10 | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100755868A CN101363063B (en) | 2007-08-10 | 2007-08-10 | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101363063A CN101363063A (en) | 2009-02-11 |
| CN101363063B true CN101363063B (en) | 2011-03-09 |
Family
ID=40389665
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100755868A Expired - Fee Related CN101363063B (en) | 2007-08-10 | 2007-08-10 | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101363063B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942524B (en) * | 2009-07-08 | 2012-10-03 | 中国科学院广州生物医药与健康研究院 | Combined nucleic acid real-time fluorescent detection method for influenza A H1N1 virus and influenza A virus and kit |
| CN101712999B (en) * | 2009-12-04 | 2012-05-23 | 深圳市疾病预防控制中心 | Dual real-time fluorescent RT-PC detection kit for subtypes of flu viruses N1 and N2 |
| CN102108418B (en) * | 2009-12-25 | 2012-10-03 | 中国科学院广州生物医药与健康研究院 | Loop-mediated isothermal amplification detection method and kit for H1N1 influenza A viruses |
| CN101798602B (en) * | 2010-03-18 | 2012-04-25 | 山东出入境检验检疫局检验检疫技术中心 | Composite kit for detecting avian influenzas and Newcastle disease viruses and detection method |
| CN101942525B (en) * | 2010-05-06 | 2013-06-05 | 广州市华南医学病毒学研究所 | One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit |
| CN102337351B (en) * | 2010-07-16 | 2014-04-02 | 中山大学达安基因股份有限公司 | Typing detection kit for influenza virus |
| CN104846121A (en) * | 2015-04-18 | 2015-08-19 | 湖北创瑞生物科技有限公司 | Virus triple fluorescence quantitative RT-PCR detection method and virus triple fluorescence quantitative RT-PCR detection kit |
-
2007
- 2007-08-10 CN CN2007100755868A patent/CN101363063B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| Payungporn S等.《Single step multiplex real-time RT-PCR for H5N1 influenza A virus detection》.《J Virol Methods》.2005,第131卷(第2期),143-147. * |
| 程小雯等.《荧光定量RT_PCR快速检测A_B型流感病毒的研究》.《中国热带医学》.2005,第5卷(第9期),1782-85. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101363063A (en) | 2009-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101363063B (en) | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR | |
| CN101818207B (en) | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus | |
| CN103397107B (en) | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN104032034A (en) | Method for simultaneously detecting influenza A virus, influenza B virus and influenza C virus and kit | |
| CN104046704A (en) | Dual fluorescence quantitative method for quickly identifying type 1 and type 3 duck hepatitis A viruses | |
| CN105907893A (en) | Fluorogenic quantitative PCR detection reagent and preparation method and application thereof | |
| CN102559935A (en) | M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus | |
| CN102337351A (en) | Typing detection kit for influenza virus | |
| CN103993101A (en) | Method and kit for simultaneous detection of human coronavirus 229E, OC43 and NL63 | |
| CN104017901B (en) | A kind of method and test kit simultaneously detecting people A type, Type B respiratory syncytial virus and human metapneumovirus | |
| CN103305634A (en) | Isothermal amplication rapid detection method of H7N9 avian influenza virus | |
| CN104498629A (en) | Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV) | |
| CN109762939A (en) | For detecting the primer and probe and kit of mandarin fish rhabdovirus | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN104498627A (en) | One-step process real-time fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for H3N8 subtype avian influenza virus (AIV) | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN102286639A (en) | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit | |
| CN1865937A (en) | Real-time fluorescent quantitative detection method for simultaneous detection of A-type and B-type influenza virus and kit therefor | |
| CN104099430A (en) | Ring mediate isothermal amplification kit for diagnosing H7N9 hypotype avian influenza virus and application method thereof | |
| CN102071263A (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection method for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN104561383A (en) | Influenza A virus and B virus joint detection primer, probe, kit and application | |
| CN102586487B (en) | Double fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for duck hepatitis virus I and Muscovy duck parvovirus | |
| CN102994650B (en) | Multi-gene detection method of encephalitis viruses based on capillary electrophoresis | |
| CN112195278A (en) | Six respiratory tract virus nucleic acid detection kit and use method thereof | |
| CN105525038A (en) | Newcastle disease virus strong/weak virulent one-step real-time fluorescence RT-PCR detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110309 Termination date: 20130810 |