CN105543417A - Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) - Google Patents
Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) Download PDFInfo
- Publication number
- CN105543417A CN105543417A CN201610125355.2A CN201610125355A CN105543417A CN 105543417 A CN105543417 A CN 105543417A CN 201610125355 A CN201610125355 A CN 201610125355A CN 105543417 A CN105543417 A CN 105543417A
- Authority
- CN
- China
- Prior art keywords
- seqidno
- sequence
- leaf spot
- primer
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an RT-LAMP (reverse transcription-loop-mediated isothermal amplification) detection kit for an ACLSV (apple chlorotic leaf spot virus). The detection kit comprises a primer, a reaction buffer solution, AMV reverse transcriptase, Bst DNA polymerase and nucleic acid dye. The invention further discloses a method for detecting the ACLSV. The kit and the detection method have the advantages of rapidness, simplicity in operation, high sensitivity, high specificity and the like, are suitable for rapid diagnosis of grassroot laboratories, are easy to popularize and apply on a large scale and have broad market prospect and greater economic and social benefits.
Description
Technical field
The present invention relates to microorganism detection field, specifically, the present invention relates to a kind of apple chlorotic leaf spot virus detection kit and detection method.
Background technology
Malus Qiang Wei section Malus, perennial deciduous fruit tree, originates in Central Asia, the European southeast and western Xinjiang.Apple virus is the principal element causing apple fruit tree transmissible disease, mostly by the infection such as grafting, pruning.If virus accumulates all the year round in plant body, serious consequence will be caused.Because virus is obligatory parasitism, when its amount reproduction, fruit tree can be disturbed normally to breed metabolism, cause that tree body growing way weakens, blade atrophy turnup and deformed fruit, local flavor become bad, fruit tree is withered ahead of time, even has no harvest, and has a strong impact on the output of apple.Therefore, in early days Viral diagnosis is carried out to take prevention and control measure in time to apple fruit tree, extremely urgent.
Apple chlorotic leaf spot virus (Applechloroticleafspotvirus, ACLSV) be one of the main pathogenic agent of fruit tree transmissible disease, have another name called apple latent virus 1, belong to cilium Tobamovirus (Trichovirus), mainly infect apple, pears, tone fruit trees and Qiang Zao section fancy breed etc.By the fruit tree plant that apple chlorotic leaf spot virus infects, tree body growing way fails increasingly, blade there will be chlorisis look as yellow spotting or strip spot, crispaturas and diminish or to lateral bend, have a strong impact on the photosynthesis area of blade.
Apple chlorotic leaf spot virus is a kind of sense single stranded rna virus, and be the fibrous bar shaped of bending softness, without sheath, its bases longs is about 7.5kb, and nucleic acid molecular weight the chances are 2500kDa, coat protein is assembled by polypeptide, and molecular weight is about 22kDa.Detection at present to apple chlorotic leaf spot virus, adopts traditional visual inspection, serological method and molecular biology for detection, as RT-PCR more.But, traditional method length consuming time, sensitivity is not high, poor specificity, relatively high to the level requirement of testing staff; Serological method somewhat expensive, operation steps is many, consuming time longer, and may there is the impurity with antibody generation nonspecific reaction in sample, easily occurs false positive results, is therefore suitable only for primary dcreening operation; And the specificity of conventional RT-PCR and sensitivity are not high yet.In order to adapt to industry development demand, be necessary exploitation a kind of can more quickly and accurately to the method that apple chlorotic leaf spot virus detects.
Loop-mediated isothermal amplification technology (loop-mediatedisothermalamplification, LAMP) be that a kind of novel nucleic acid amplification method grown up in recent years is (see document NotomiT, OkayamaH, MasubuchiH, YonekawaT, WatanabeK, AminoN, HaseT.Loop-mediatedisothermalamplificationofDNA.NucleicA cidsRes.2000Jun15; 28 (12): E63).Compared with Standard PCR, LAMP is without the need to thermally denature, temperature cycle, the process such as electrophoresis and ultraviolet visualization of template, the nucleic acid amplification of a large amount of copy number can be realized in short period of time, and without the need to high-end plant and instrument, have high specificity, highly sensitive, be easy to interpretation, can the advantage such as qualitative, quantitative.
Reverse transcription-loop-mediated isothermal amplification technology (RT-LAMP) is the RNA detection technique set up based on LAMP, and its sensitivity is 100 times of conventional RT-PCR.RT-LAMP amplification principle is identical with LAMP, but adds reversed transcriptive enzyme in reaction system, and the LAMP of the reverse transcription of RNA and cDNA amplification step in same test tube is completed.
Summary of the invention
The object of the present invention is to provide a kind of apple chlorotic leaf spot virus detection kit and detection method.
In order to realize object of the present invention, in an aspect, the invention provides a kind of apple chlorotic leaf spot virus detection kit, it is characterized in that comprising 4 Auele Specific Primers: outer primer F3, its sequence is as shown in SEQIDNO:1; Outer primer B3, its sequence is as shown in SEQIDNO:2; Inner primer FIP, its sequence is as shown in SEQIDNO:3; Inner primer BIP, its sequence is as shown in SEQIDNO:4.Primer sequence is specific as follows:
Outer primer F3:ATGGAGGATCAGAAAGTGAT (SEQIDNO:1)
Outer primer B3:TGGTTGTAAAGAGGTTTGTGA (SEQIDNO:2)
Inner primer FIP:TGGGTCCGAAGATGTAGTCTTGA-GTCATACAATCTGAAGGAGGT (SEQIDNO:3)
Inner primer BIP:TCAGCAACATGACTTTCCGTCAG-CCTTTATACTTCAATTTCACCAAC (SEQIDNO:4).
The concentration of preferred described outer primer F3 and B3 is 5pmol/ μ l, and the concentration of described inner primer FIP and BIP is 40pmol/ μ l.
Further, test kit of the present invention can also comprise reaction buffer, AMV reversed transcriptive enzyme, BstDNA polysaccharase and nucleic acid dye, and wherein said reaction buffer is by 10mMdNTP, 10 × ThermoPol reaction buffer, 5mM trimethyl-glycine and 50mMMgSO
4composition.
Preferred described nucleic acid dye is SYBRGreenI.
Further, test kit of the present invention can also comprise RNA and extracts reagent and positive control and negative control.
In one aspect of the method, present invention also offers a kind of apple chlorotic leaf spot virus detection method, it utilizes RT-LAMP technology, comprises the following steps:
(1) testing sample RNA is extracted;
(2) primer is designed and synthesized;
(3) the RT-LAMP reaction system of 25 μ l is set up, it comprises outer primer F31 μ l, the outer primer B31 μ l of 5pmol/ μ l of 5pmol/ μ l, the inner primer FIP1 μ l of 40pmol/ μ l, the inner primer BIP1 μ l of 40pmol/ μ l, reaction buffer 2.5 μ l, 2UAMV reversed transcriptive enzyme 1 μ l, 8UBstDNA polysaccharase 1 μ l, template DNA 2 μ l, add water and be supplemented to 25 μ l, and using apple chlorotic leaf spot virus genomic dna as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(4) LAMP reaction: by PCR pipe in step (3) in 63 DEG C of isothermal reaction 60min;
(5) analysis judges reaction product result: in (4), add 1 μ l nucleic acid dye in gained reaction product, judge whether to there is apple chlorotic leaf spot virus according to the color of reaction solution.
In detection method of the present invention, the sequence of described outer primer F3 is as shown in SEQIDNO:1, and the sequence of outer primer B3 is as shown in SEQIDNO:2, and the sequence of inner primer FIP is as shown in SEQIDNO:3, and the sequence of inner primer BIP is as shown in SEQIDNO:4.
Preferred described reaction buffer is by 10mMdNTP, 10 × ThermoPol reaction buffer, 5mM trimethyl-glycine and 50mMMgSO
4composition.
Preferred described nucleic acid dye is SYBRGreenI, if reaction solution color is orange, represents that result is negative, not containing ACLSV in testing sample; If reaction solution color is green, represent that result is positive, containing ACLSV in testing sample.
Apple chlorotic leaf spot virus detection kit of the present invention and detection method utilize RT-LAMP technology, design 4 Auele Specific Primers for ACLSV conservative region, and it identifies 6 specific regions of ACLSV, specificity and sensitivity higher.Reaction is carried out under isothermal (63 DEG C) condition, do not need the instrument of the costlinesses such as circulating instrument, one step completes reverse transcription and amplification step, and false positive rate is low, quick, efficient, and gets final product result of determination by visual color change, without the need to the step such as electrophoresis and ultraviolet visualization, identify easy, more traditional detection method advantage is remarkable, is applicable to the quick diagnosis of laboratories, be easy to apply on a large scale, there are wide market outlook and larger economical, societal benefits.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
Embodiment 1 apple chlorotic leaf spot virus specific detection
The preparation of 1.1 reagent
Primer is synthesized by TIANGEN Biotech (Beijing) Co., Ltd.; QIAampRNAMiniKit is purchased from Qiagen; BstDNA polysaccharase and 10 × ThermoPol reaction buffer are purchased from NEB; AMV reversed transcriptive enzyme is purchased from Promega company; SYBRGreenI is purchased from Invitrogen; All the other PCR reagent and the reagent needed for preparation CTAB extraction buffer are purchased from Sigma.
Meanwhile, required reagent in preparation following RT-LAMP reaction:
Reaction buffer, according to following formulated: 10mMdNTP, 10 × ThermoPol reaction buffer, 5mM trimethyl-glycine, 50mMMgSO
4;
Primer: outer primer F3, its sequence is as shown in SEQIDNO:l; Outer primer B3, its sequence is as shown in SEQIDNO:2; Inner primer FIP, its sequence is as shown in SEQIDNO:3, and inner primer BIP, its sequence is as shown in SEQIDNO:4.Wherein the concentration of outer primer F3 and outer primer B3 is 5pmol/ μ l, and the concentration of inner primer FIP and inner primer BIP is 40pmol/ μ l.
The AMV reversed transcriptive enzyme of 2U;
The BstDNA polysaccharase of 8U;
Nucleic acid dye: 1000 × SYBRGreenI;
Positive control: apple chlorotic leaf spot virus genomic dna;
Negative control: 100mMTris-HCl (pH8.0) and 50mMEDTA.
1.2RT-LAMP detect
Testing sample comprise pick up from Agricultural University Of Hebei's living collection with flower leaf paresthesia and adopt serological method determine to infect apple chlorotic leaf spot virus 4 strain fruit tree edible tender branch and infect apple mosaic virus, apple stem grooving virus, apple stem pitting virus each 1 strain of indoor tissue cultured seedling.
According to following steps, apple chlorotic leaf spot virus is detected:
(1) QIAampRNAMiniKit is utilized to extract testing sample RNA;
(2) LAMP reaction system is set up: in PCR pipe, prepare 25 μ l reaction systems, wherein four kinds of each 1 μ l of primer, reaction buffer 2.5 μ l, 2UAMV reversed transcriptive enzyme 1 μ l, 8UBstDNA polysaccharase 1 μ l, step (1) gained template DNA 2 μ l, add water and be supplemented to 25 μ l, and using apple chlorotic leaf spot virus genomic dna as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(3) LAMP reaction: by PCR pipe in step (2) in 63 DEG C of isothermal reaction 60min;
(4) analysis judges reaction product result: in (3), add 1 μ l1000 × SYBRGreenI in gained reaction product, if reaction solution color is orange, represents that result is negative; If reaction solution color is green, represent that result is positive.
1.3 detected result
Determine to infect in 4 strain fruit tree edible tender branch of apple chlorotic leaf spot virus and the PCR pipe of positive control and all present green, and other 3 kinds of common viruses infecting apple fruit tree: the colour developing result of apple mosaic virus, apple stem grooving virus, apple stem pitting virus and negative control is orange, shows that primer has very strong specificity for apple chlorotic leaf spot virus.
Embodiment 2 apple chlorotic leaf spot virus sensitivity technique
2.1RT-LAMP sensitivity technique
Extract the RNA of 4 strain branches according to the step (1) of embodiment 1, and be diluted to 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg totally 7 gradients with 10 times of concentration series dilution methods.
RT-LAMP reaction system and reaction conditions and interpretation of result are with step (2)-(4) of embodiment 1.
2.2 detected result
Except DNA concentration be 100fg PCR pipe display orange except, all present green in the PCR pipe of all the other concentration, show that the lowest detection limit of detection method of the present invention reaches 1pgDNA, sensitivity is very high.
Claims (8)
1. an apple chlorotic leaf spot virus detection kit, it is characterized in that comprising 4 Auele Specific Primers: outer primer F3, its sequence is as shown in SEQIDNO:1; Outer primer B3, its sequence is as shown in SEQIDNO:2; Inner primer FIP, its sequence is as shown in SEQIDNO:3; Inner primer BIP, its sequence is as shown in SEQIDNO:4.
2. test kit according to claim 1, it comprises reaction buffer, AMV reversed transcriptive enzyme, BstDNA polysaccharase and nucleic acid dye further.
3. test kit according to claim 2, wherein said reaction buffer is by 10mMdNTP, 10 × ThermoPol reaction buffer, 5mM trimethyl-glycine and 50mMMgSO
4composition.
4. test kit according to claim 2, wherein said nucleic acid dye is SYBRGreenI.
5. test kit according to claim 1 and 2, it comprises RNA further and extracts reagent and positive control and negative control.
6. an apple chlorotic leaf spot virus detection method, it comprises the following steps:
(1) testing sample RNA is extracted;
(2) primer is designed and synthesized;
(3) the RT-LAMP reaction system of 25 μ l is set up, it comprises outer primer F31 μ l, the outer primer B31 μ l of 5pmol/ μ l of 5pmol/ μ l, the inner primer FIP1 μ l of 40pmol/ μ l, the inner primer BIP1 μ l of 40pmol/ μ l, reaction buffer 2.5 μ l, 2UAMV reversed transcriptive enzyme 1 μ l, 8UBstDNA polysaccharase 1 μ l, template DNA 2 μ l, add water and be supplemented to 25 μ l, and using apple chlorotic leaf spot virus genomic dna as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(4) LAMP reaction: by PCR pipe in step (3) in 63 DEG C of isothermal reaction 60min;
(5) analysis judges reaction product result: in (4), add 1 μ l nucleic acid dye in gained reaction product, judge whether to there is apple chlorotic leaf spot virus according to the color of reaction solution.
7. detection method according to claim 6, the sequence of wherein said outer primer F3 is as shown in SEQIDNO:1, the sequence of outer primer B3 is as shown in SEQIDNO:2, and the sequence of inner primer FIP is as shown in SEQIDNO:3, and the sequence of inner primer BIP is as shown in SEQIDNO:4.
8. apple chlorotic leaf spot virus RT-LAMP detection method according to claim 6, wherein said reaction buffer is by 10mMdNTP, 10 × ThermoPol reaction buffer, 5mM trimethyl-glycine and 50mMMgSO
4composition.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610528143.9A CN106119414A (en) | 2016-03-07 | 2016-03-07 | A kind of apple chlorotic leaf spot virus detection kit and detection method |
| CN201610125355.2A CN105543417A (en) | 2016-03-07 | 2016-03-07 | Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610125355.2A CN105543417A (en) | 2016-03-07 | 2016-03-07 | Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610528143.9A Division CN106119414A (en) | 2016-03-07 | 2016-03-07 | A kind of apple chlorotic leaf spot virus detection kit and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105543417A true CN105543417A (en) | 2016-05-04 |
Family
ID=55822974
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610528143.9A Withdrawn CN106119414A (en) | 2016-03-07 | 2016-03-07 | A kind of apple chlorotic leaf spot virus detection kit and detection method |
| CN201610125355.2A Pending CN105543417A (en) | 2016-03-07 | 2016-03-07 | Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610528143.9A Withdrawn CN106119414A (en) | 2016-03-07 | 2016-03-07 | A kind of apple chlorotic leaf spot virus detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN106119414A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184387A (en) * | 2019-05-10 | 2019-08-30 | 中国热带农业科学院热带生物技术研究所 | For detecting the RT-LAMP detection primer and its application, detection reagent and detection method of ANSSV |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634608B (en) * | 2012-04-18 | 2015-04-08 | 西北农林科技大学 | Method for detecting apple viruses by adopting reverse transcription loop-mediated isothermal amplification technology |
-
2016
- 2016-03-07 CN CN201610528143.9A patent/CN106119414A/en not_active Withdrawn
- 2016-03-07 CN CN201610125355.2A patent/CN105543417A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184387A (en) * | 2019-05-10 | 2019-08-30 | 中国热带农业科学院热带生物技术研究所 | For detecting the RT-LAMP detection primer and its application, detection reagent and detection method of ANSSV |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106119414A (en) | 2016-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108559783B (en) | RPA primer, kit and detection method for detecting four common root-knot nematodes | |
| CN110066880A (en) | A kind of method of four large Chinese carp fish product of fast qualitative detection | |
| CN103710463B (en) | Rapid detection kit and method of strawberry mild yellow edge virus | |
| Dietzgen et al. | Genetic variability of Tomato spotted wilt virus in Australia and validation of real time RT‐PCR for its detection in single and bulked leaf samples | |
| CN105543417A (en) | Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) | |
| Finetti-Sialer et al. | Isolate-specific detection of Grapevine fanleaf virus from Xiphinema index through DNA-based molecular probes | |
| CN102796825A (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| CN109943666A (en) | A kind of the multiple PCR primer group and its application of the main virus of detection tomato | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN106011277B (en) | A kind of primer pair, kit and the detection method of quick detection coffee rust | |
| CN112048573B (en) | RPA primer and kit for detecting cotton leaf curl virus, and detection method and application thereof | |
| CN111118224B (en) | Detection method for apple mosaic disease | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN109468392B (en) | Real-time fluorescence PCR detection method for Ericerus citriodora, and primer and probe for detection | |
| CN105567876A (en) | PLRV (Potato Leafroll Virus) RT-LAMP (Reverse Transcriptase Loop-Mediated Isothermal Amplification) detection kit and PLRV RT-LAMP detection method | |
| CN106191302A (en) | A kind of tomato yellow leaf curl virus LAMP detection kit and detection method | |
| CN106755541B (en) | Molecular marker, primer and probe for identifying lyophyllum decastes | |
| KR101750837B1 (en) | Primer set for multiple detection MNSV, SqMV, WMV, and CABYV and method for detecting said viruses using the same | |
| CN114703313B (en) | Wild rice black powder fungus typing identification method and application thereof | |
| CN103114135A (en) | Fluorescent PCR (polymerase chain reaction) quick detection primer and kit for citrus canker pathogenic bacteria | |
| CN105861745B (en) | A kind of virus detection kit and detection method | |
| KR20130032922A (en) | Genetic markers for detecting quarantine plant viruses and methods for detecting by using thereof | |
| CN106636449A (en) | Molecular marker, primer and probe for identifying lentaria patouillardii edible mushrooms | |
| KR100615615B1 (en) | Specific Primers for detection of Potato virus M | |
| KR100615619B1 (en) | Specific Primers for detection of Potato virus S |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160504 |