CN104404173B - A kind of NASBA method for detecting tomato spotted wilf virus - Google Patents
A kind of NASBA method for detecting tomato spotted wilf virus Download PDFInfo
- Publication number
- CN104404173B CN104404173B CN201410798148.4A CN201410798148A CN104404173B CN 104404173 B CN104404173 B CN 104404173B CN 201410798148 A CN201410798148 A CN 201410798148A CN 104404173 B CN104404173 B CN 104404173B
- Authority
- CN
- China
- Prior art keywords
- nasba
- primer
- tswv
- virus
- tomato spotted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is an object of the invention to provide a kind of NASBA method for detecting tomato spotted wilf virus, the NASBA primer of used detection TSWV, its primer sequence respectively SEQ? ID? NO:1～2. Inventing and devise two specificity inner primers according to the N gene high conservative region of TSWV, this conserved genetic sequences is that to have the different strains of TSWV common, to ensure to detect the reliability of the TSWV of separate sources the level of strain. The present invention is applicable to TSWV is used for quickly detecting confirmation, can be widely applied to produce and the confirmation of this virus in the disease monitoring in environment, foreign trade.
Description
Technical field
The invention belongs to pathogenic detection technique field, be specifically related to a kind of NASBA method for detecting tomato spotted wilf virus.
Background technology
In recent years, tomato spotted wilf virus (Tomatospottedwiltvirus, TSWV) has been listed in one of ten maximum kind of plant viruses of world's harm with its host range and tremendous economic loss caused widely. In 60～eighties of 20th century, this virus was once very popular on American-European and African Nicotiana tabacum L. and Fructus Lycopersici esculenti, and annual sickness rate is 20%～50%, caused the loss of up to several 1,000,000,000 dollars. In Hawaii, America, Brazil, Italy and South Africa, at the popular of 80～nineties of 20th century, TSWV once caused that the crop such as Fructus Lycopersici esculenti, Caulis et Folium Lactucae sativae was close to total crop failure. In recent years, Tospovirus virus particularly TSWV, it has also become the whole world causes diversified economy crop and the important factor of the very big economic loss of ornamental plant.
The vegetable seeds such as Fructus Capsici that China plants at present, Bulbus Allii Cepae, Caulis et Folium Lactucae Sativae much come from all over the world, especially the basic dependence on import of tomato seeds, import country origin includes the states such as the U.S., Japan, Holland, Thailand, these importers have generation and the report of tomato spotted wilf virus at present, and TSWV virus was once intercepted and captured in 2012 in China port in inward seed. And typically via biological host, morphology tests, traditional TSWV detection and confirmation method judge whether plant has plant virus, these methods are time-consuming, complex operation, it is impossible to meet the needs of disease control.
Currently for the quarantine identification primary limitation of this virus at traditional sensing techniques such as electron microscopy, serological technique and RT-PCR, such as ELISA method, molecular hybridization, fluorescence quantifying PCR method, regular-PCR method etc., but in these methods, serology, hybridization technique detection sensitivity are low, complex operation step, the cycle is long; Electronic Speculum, Fluorescence PCR assay rely on large-scale instrument, and therefore a lot of laboratorys are unable to reach requirement in instrument configuration and power of test. Further, since tomato spotted wilf virus is single strand RNA virus, it is easy to degraded, the complexity of above method operation limits the detection to this disease and forecast with sensitivity. Although application round pcr detection is sensitive, but current detection practice have shown that detection false positive or false negative often occur.
Summary of the invention
It is an object of the invention to provide a kind of NASBA method for detecting TSWV, namely utilize and there is high sensitivity and the guiding of specific primer, in the reaction system formed containing t7 rna polymerase, RNAseH, reverse transcription AMV, NTP, dNTP and reaction buffer, realized the isothermal duplication of nucleotide sequence by In-vitro specificity enzymatic reaction homogeneous continuously, the tomato spotted wilf virus in sample is detected accurately.
Present invention firstly provides a kind of NASBA primer for detecting TSWV, its primer sequence respectively SEQIDNO:1～2.
NA-P1:5′-aattctaatacgactcactatagggagTGTCAGTGGCTCCAATCCTG-3′
NA-P2:5′-aattctaatacgactcactatagggagGCTTTGTTGACACAAGGCAAAG-3′。
The present invention also provides for a kind of test kit detecting TSWV, includes following component
1) NASBA amplification reaction solution A:
Every 25 μ L include 10 × AMVbuffer2.5 μ l, 6.25mmol/LNTPs3 μ L, 10mmol/LdNTPs1.5 μ L, 10 μm of ol/L primer NA-P1, NA-P2 each 0.5 μ L, distilled water 9ml;
Wherein 10 × AMVbuffer is Tris-HCL, 70mmol/LKCL, the 12mmol/LMgCL containing 40mmol/LPH8.52, the buffer of 5mmol/LDTT;
2) NASBA amplification reaction solution B:
Described NASBA amplification reaction solution B includes: 0.5URNaseH, 32UT7RNA polymerase, 6.4UAMV reverse transcription, 2 μ LDMSO, 0.1 μ L1mol/L dithiothreitol, DTT, 0.25 μ L10mg/mLBSA, 20URNA enzyme inhibitor,
Above-mentioned test kit is used for detecting TSWV, includes the steps:
1) extraction of sample RNA
A, take 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mLTrizolReagent, reverse mixing, 2 DEG C～8 DEG C, 12000g, centrifugal 10min;
B, take supernatant, 15 DEG C～30 DEG C, place 5min; Add 0.2mL chloroform, acutely shake (not vortex oscillation) with hands, about 15s, 15 DEG C～30 DEG C, place 2min～3min; 2 DEG C～8 DEG C, 12000g, centrifugal 15min;
C, draw the upper strata aqueous phase of 600 μ L, add 500 μ L isopropanol mixing supernatants, 15 DEG C～30 DEG C, place 10min; 2 DEG C～8 DEG C, 12000g, centrifugal 10min;
D, removal supernatant, add 1mL75% ethanol, washing in precipitation; 2 DEG C～8 DEG C, 7500g, centrifugal 5min;
E, removal supernatant, after precipitation natural drying, be dissolved in 30 μ L～50 μ L without, in the water of RNase, being template ribonucleic acid to be checked;
2) the NASBA amplification of TSWV is carried out
A, to add 3 μ L in the reaction tube equipped with 14 μ L loop-mediated isothermal amplification liquid A to be checked
A, in the reaction tube equipped with 14 μ L loop-mediated isothermal amplification liquid A, add 3 μ L template ribonucleic acids to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tube, it is rapidly added 4 μ L reactant liquor B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3) electrophoresis detection
Take 3g agarose, heat in 100mL electrophoretic buffer, fully dissolve, add ethidium bromide stock solution to final concentration of 0.5 μ g/mL, glue, electrophoresis tank adds electrophoretic buffer, makes liquid level just not have gel; 3 μ L～6 μ LPCR amplified productions are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result record is observed under Ultraviolet Detector. If amplified fragments is 235bp, illustrate that virus to be checked is TSWV, without 235bp amplified fragments occurs, then illustrate that virus to be checked is not TSWV.
The present invention devises two specificity inner primers according to the N gene high conservative region of TSWV, and this conserved genetic sequences is that to have the different strains of TSWV common, to ensure to detect the reliability of the TSWV of separate sources the level of strain. The present invention is applicable to TSWV is used for quickly detecting confirmation, can be widely applied to produce and the confirmation of this virus in the disease monitoring in environment, foreign trade.
Compared with prior art, the beneficial effect comprise that
First, convenience. This invention is when carrying out constant-temperature amplification, it is not necessary to expensive nucleic acid amplification reaction device, whole process carries out at 42 DEG C all the time, it is not necessary to thermal cycler, and only 1 common thermostat water bath just can complete.
Second, degree of accuracy is high. The period of this invention enzyme circular response is few, does not need high-temperature denatured step, relatively low relative to RT-PCR mismatch rate, is more suitable for detection and quantitative special RNA.
3rd, highly sensitive. This invention, compared with round pcr, can just amplify substantial amounts of genes of interest with less circulation, it is ensured that the hypersensitivity of detection.
4th, shorten the cycle. Owing to transcriptive process,reversed is directly merged in amplified reaction, PCR take around 20 take turns circulation could expand 106Times, and NASBA only need to circulate 4～5 and takes turns and can reach 106Times.
5th, reduce the prescription to plant RNA template. Due in cell wall rich in substantial amounts of polysaccharide, aldehydes matter, the extraction of plant virus RNA also exists the problems such as poor stability, repeatability is low, efficiency is low, in addition in extraction process RNA itself from signs of degradation, the content of viral RNA is often relatively low, and sensitivity and stability to detection method propose high requirement. Due to this invention for template be RNA, the product of reaction is also RNA, and the result of reaction is by the impact of DNA in environment. Even if there is external double-stranded DNA to pollute, but T7 promoter sequence is not possessed due to it, can not be amplified, secondly, this reaction only carries out under 42 DEG C of constant temperatures, do not need high-temperature denatured step, so NASBA reaction process will not be subject to the pollution of external double-stranded DNA, therefore relatively low for template purity and prescription.
Accompanying drawing illustrates:
Fig. 1 be the present invention to NASBA AFLP system in diseased plant sample: wherein M:ssRNALaddermarker; The susceptible material of 1:TSWV; 2: healthy Fructus Lycopersici esculenti.
Fig. 2 specific outcome figure: wherein M:ssRNALaddermarker; 1: tomato spotted wilf virus; 2: negative control; 3: nepovirus; 4: tomato black ring virus; 5: cucumber mosaic virus; 6: TOMV; 7: tomato yellow leaf curl virus.
Fig. 3 NASBA sensitivity technique collection of illustrative plates: wherein M:ssRNALaddermarker; 1～6:1.56 × 10-1、1.56×10-2、1.56×10-3、1.56×10-4、1.56×10-5、1.56×10-6The susceptible material total serum IgE of ng/ μ LTSWV.
Fig. 4 PCR sensitivity collection of illustrative plates: wherein M:DNAD2000marker; 1～6:1.56 × 10-1、1.56×10-2、1.56×10-3、1.56×10-4、1.56×10-5、1.56×10-6The susceptible material total serum IgE of ng/ μ LTSWV.
Fig. 5: actual sample detects: wherein M:ssRNALaddermarker; 1～9: actual sample.
Detailed description of the invention
NASBA (Nuleicandsequencebasedamplipicain, NASBA) namely " Nucleic acid sequence based amplification " detection technique is the isothermal amplification technology of a kind of classics, suitable in the amplification of singlestranded RNA RNA mono-step and detection, it is widely used to detection and the diagnosis of the mankind and animals and plants cause of disease. NASBA is guided by pair of primers, in the standard reaction system that the various reaction buffers used containing t7 rna polymerase, RNAseH, reverse transcription AMV, NTP, dNTP and needs form, realized the isothermal duplication of nucleotide sequence by In-vitro specificity enzymatic reaction homogeneous continuously.
The present invention is first depending on TSWV nucleocapsid protein (nucterotein, N) and designs specific primer; Extract the ribonucleic acid (RNA) of testing sample again, then carry out NASBA amplification with the specific primer of N gene respectively; With agarose gel electrophoresis, amplified production is detected, finally according to NASBA amplification judges whether contain TSWV in sample.
The material information that the embodiment of the present invention uses is as follows:
1, virus
Tomato spotted wilf virus picks up from the field plant fruit of the open plantation of Dongzhou Period in Chuxiong, nepovirus (Tobaccoringspotvirus, TRSV) import Japan Folium Stevlae Rebaudianae it is isolatable from, tomato black ring virus (Tomatoblackringvirus, TBRV) cucumber mosaic virus (Cuccumbermosaicvirus of Italy's cucumber seeds it is located away from, CMV) with TOMV (Tomatomosaicvirus, ToMV) tomato yellow leaf curl virus (Tomatoyellowcurlvirus of Chile's watermelon seed it is located away from, ToYCLV) tomato planting district, Qingdao it is located away from.
2, reagent
Reverse transcription polymerase AMV, RNaseH, RNaseinhibitor, t7 rna polymerase, dNTP, ssRNAmarker, rNTP are all purchased from NEWENGLANDBIOLAB company; Pcr amplification reagent, DNAmarker and etc. be all purchased from Beijing Tian Gen company.
Below in conjunction with embodiment, the present invention will be described in detail
Embodiment 1: the design of primer
According to the N full length gene sequence (KC294570.1 (Kunming separator) of TSWV in NCBI GenBank, HM581936.1 (Nanjing separator), JF730744.1 (Korea S's separator), HM180089 (Taiwan separator), HQ406984.1 (U.S.'s separator), KC494503.1 (New Zealand's separator), KM379142.1 (Turkey's separator), KF146703.1 (Venezuela's separator)), by the high conservative region of comparative analysis TSWVN gene under the premise of the degenerate and versatility that ensure amplification, design 5' end with T7 promoter sequence NASBA react primer (NA-P1 NA-P2, NA-P3 NA-P4), after having designed, primer is compared under the Primer-Blast module of data base checking. wherein NA-P3 the sequence of NA-P4 be respectively as follows: NA-P3:5 '-aattctaatacgactcactatagggagTCCTAAGGCTTCCCTGGTGT-3 ' and NA-P4:5 '-aatt-ctaatacgactcactatagggagGCTTGTCGAGGAAACTGGGA-3 '.
To in positive Fructus Lycopersici esculenti and negative Fructus Lycopersici esculenti detection, with NA-P1 NA-P2 for amplimer pair time, the amplified production of TSWV positive occurs in that the single band that expection is special in the position of RNAmarker about correspondence 235bp, and negative control is without band. And with NA-P3 NA-P4 amplimer pair time, positive occurs in that the biobelt including expection band, and negative control also occurs in that an amplified band, and the unexpected band of its size and positive is close. Confirming by order-checking, the product of this band is Fructus Lycopersici esculenti mitochondrial RNA (mt RNA) sequence, long for 312bp. Although this product than NA-P1 NAP2 larger, but very easily testing result is caused and obscures, be also easily caused the decline of amplification efficiency. Therefore, select primer pair NA-P1 NAP2 as the NASBA detection primer of the present invention.
The detection of embodiment 2:TSWV
1, the extraction of viral RNA
Take 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mLTrizolReagent, overturn mixing, 2 DEG C～8 DEG C, 12000g, centrifugal 10min.Take supernatant, 15 DEG C～30 DEG C, place 5min; Add 0.2mL chloroform, acutely shake (not vortex oscillation) with hands, about 15s. 15 DEG C～30 DEG C, place 2min～3min; 2 DEG C～8 DEG C, 12000g, centrifugal 15min. Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase. Add 500 μ L isopropanol mixing supernatants, 15 DEG C～30 DEG C, place 10min. 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Remove supernatant, precipitation adds 1mL75% ethanol, washing; 2 DEG C～8 DEG C, 7500g, centrifugal 5min. Remove supernatant, after precipitation natural drying, be dissolved in 30 μ L～50 μ L without, in the water of RNase, being template ribonucleic acid to be checked.
2, NASBA amplification system
A, in the reaction tube equipped with 14 μ L loop-mediated isothermal amplification liquid A, add 3 μ L template ribonucleic acids to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tube, it is rapidly added 4 μ L reactant liquor B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3, electrophoresis detection
Take 3g agarose, heat in 100mL electrophoretic buffer, fully dissolve, add ethidium bromide stock solution to final concentration of 0.5 μ g/mL, glue, electrophoresis tank adds electrophoretic buffer, makes liquid level just not have gel; 3 μ L～6 μ LPCR amplified productions are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result record is observed under Ultraviolet Detector. Expection product is sized to 235bp. See Fig. 1.
The present invention adopts NASBA to detect TSWV and completes following experiment:
(1) specificity experiments
1, extract the RNA of tomato spotted wilf virus, nepovirus, tomato black ring virus, cucumber mosaic virus and TOMV, tomato yellow leaf curl virus, use NASBA method to detect.
2, the extraction of viral RNA
Take 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mLTrizolReagent, overturn mixing, 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Take supernatant, 15 DEG C～30 DEG C, place 5min; Add 0.2mL chloroform, acutely shake (not vortex oscillation) with hands, about 15s. 15 DEG C～30 DEG C, place 2min～3min; 2 DEG C～8 DEG C, 12000g, centrifugal 15min. Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase. Add 500 μ L isopropanol mixing supernatants, 15 DEG C～30 DEG C, place 10min. 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Remove supernatant, precipitation adds 1mL75% ethanol, washing; 2 DEG C～8 DEG C, 7500g, centrifugal 5min. Remove supernatant, after precipitation natural drying, be dissolved in 30 μ L～50 μ L without, in the water of RNase, being template ribonucleic acid to be checked.
3, amplified reaction
A, in the reaction tube equipped with 14 μ L loop-mediated isothermal amplification liquid A, add 3 μ L template ribonucleic acids to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tube, it is rapidly added 4 μ L reactant liquor B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
4, NASBA product electrophoresis detection
Take 3g agarose, heat in 100mL electrophoretic buffer, fully dissolve, add ethidium bromide stock solution to final concentration of 0.5 μ g/mL, glue, electrophoresis tank adds electrophoretic buffer, makes liquid level just not have gel;3 μ L～6 μ LPCR amplified productions are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result record is observed under Ultraviolet Detector. Electrophoresis result shows, using NASBA method to carry out the RNA of detection tomato spotted wilf virus, nepovirus, tomato black ring virus, cucumber mosaic virus and TOMV, tomato yellow leaf curl virus, only tomato spotted wilf virus obtains the amplified production (see Fig. 2) of expection 235bp.
(2) sensitivity control experiment
1, with DEPC water, TSWV viral RNA template liquid is done downwards 10 times of gradient dilutions, be followed successively by 1.56 × 10-1、1.56×10-2、1.56×10-3、1.56×10-4、1.56×10-5、1.56×10-6Ng/ μ L, respectively taking 2 μ L is that template carries out NASBA and RT-PCR amplified reaction respectively. NASBA primer selection NA-P1 and NA-P2, and PCR primer sequence (5 '-3 ') it is respectively as follows: P1:TGTCAGTGGCTCCAATCCTG and P2:GCTTTGTTGACACAAGGCAAAG
2, the extraction of viral RNA
Take 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mLTrizolReagent, overturn mixing, 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Take supernatant, 15 DEG C～30 DEG C, place 5min; Add 0.2mL chloroform, acutely shake (not vortex oscillation) with hands, about 15s. 15 DEG C～30 DEG C, place 2min～3min; 2 DEG C～8 DEG C, 12000g, centrifugal 15min. Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase. Add 500 μ L isopropanol mixing supernatants, 15 DEG C～30 DEG C, place 10min. 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Remove supernatant, precipitation adds 1mL75% ethanol, washing; 2 DEG C～8 DEG C, 7500g, centrifugal 5min. Remove supernatant, after precipitation natural drying, be dissolved in 30 μ L～50 μ L without, in the water of RNase, being template ribonucleic acid to be checked.
3, NASBA amplified reaction
A, in the reaction tube equipped with 14 μ L loop-mediated isothermal amplification liquid A, add 3 μ L template ribonucleic acids to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tube, it is rapidly added 4 μ L reactant liquor B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
4, RT-PCR amplified reaction
RT-PCR amplification system illustrates configuration with reference to the Quant One step RT-PCR test kit of TIANGEN company, and reaction condition is 50 DEG C of reverse transcription 30min; 94 DEG C of denaturation 2min; 94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, circular response 35 times; 65 DEG C extend 10min.
5, NASBA product electrophoresis detection
Take 3g agarose, heat in 100mL electrophoretic buffer, fully dissolve, add ethidium bromide stock solution to final concentration of 0.5 μ g/mL, glue, electrophoresis tank adds electrophoretic buffer, makes liquid level just not have gel; 3 μ L～6 μ LPCR amplified productions are mixed with appropriate sample loading buffer respectively, point sample; 9V/cm constant voltage electrophoresis, until bromophenol blue indicator migrates in the middle part of gel; Electrophoresis result record is observed under Ultraviolet Detector. NASBA product is identified: electrophoresis result shows, the primer detection tomato spotted wilf virus of the present invention can obtain 10-4The template (see Fig. 3) of extension rate, can reach fg level level, uses RT-PCR method can obtain 10-3Extension rate (Fig. 4), only pg level level.
Embodiment 3: actual sample detection and contrast experiment
By from Yunnan, Shandong, Deng Di field, Sichuan gather the sick sample with typical TSWV symptom and laboratory sample retention, be respectively adopted NASBA, RT-PCR and detect, compare the effect of two kinds of methods, to assess the reliability of NASBA method further.
1, actual sample NASBA detection
1) extraction of viral RNA
Take 0.1g sample, add liquid nitrogen and be ground into powder, abrasive material is moved into rapidly in 1.5mL centrifuge tube, add 1mLTrizolReagent, overturn mixing, 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Take supernatant, 15 DEG C～30 DEG C, place 5min; Add 0.2mL chloroform, acutely shake (not vortex oscillation) with hands, about 15s. 15 DEG C～30 DEG C, place 2min～3min; 2 DEG C～8 DEG C, 12000g, centrifugal 15min. Careful absorption is about the upper strata aqueous phase of 600 μ L, not disturbance mesophase spherule and lower floor's phase. Add 500 μ L isopropanol mixing supernatants, 15 DEG C～30 DEG C, place 10min. 2 DEG C～8 DEG C, 12000g, centrifugal 10min. Remove supernatant, precipitation adds 1mL75% ethanol, washing; 2 DEG C～8 DEG C, 7500g, centrifugal 5min. Remove supernatant, after precipitation natural drying, be dissolved in 30 μ L～50 μ L without, in the water of RNase, being template ribonucleic acid to be checked.
2) amplified reaction
A, in the reaction tube equipped with 14 μ L loop-mediated isothermal amplification liquid A, add 3 μ L template ribonucleic acids to be checked,
B, on DNA cloning instrument or water-bath 65 DEG C temperature bath 5min, proceed to immediately 41 DEG C temperature bath 5min;
C. in reaction tube, it is rapidly added 4 μ L reactant liquor B;
D. in 41 DEG C of incubation 2h;
E. metal bath is transferred to 4 DEG C of stopped reactions, takes out after 3min;
3) NASBA product is identified
Observing electrophoresis result record under Ultraviolet Detector, electrophoresis result shows, in 9 parts of samples, 3 parts of samples are positive, and other samples are negative (see Fig. 5).
2, pcr amplification
1) method: conventional RT-PCR reaction condition is 50 DEG C of reverse transcription 30min; 94 DEG C of denaturation 2min; 94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s, circular response 35 times; 65 DEG C extend 10min.
2) agarose gel electrophoresis result: in 9 parts of samples, 3 parts is positive, and all the other are 6 parts.
Conclusion: utilize above-mentioned NASBA and PCR method simultaneously to detect actual sample, the coincidence rate 100% of two kinds of methods, but NASBA is lower to equipment requirements, and convenience is higher.
Claims (4)
1. the NASBA amplimer pair detecting tomato spotted wilf virus, it is characterised in that the forward primer of described primer pair, downstream primer sequence respectively SEQIDNO:1～2.
2. the application of tomato spotted wilf virus in detection plant sample of the primer pair described in claim 1.
3. detect a NASBA amplification kit for tomato spotted wilf virus, including following component:
1) NASBA amplification reaction solution A:
Every 25 μ L include 10 × AMVbuffer2.5 μ l, 6.25mmol/LNTPs3 μ L, 10mmol/LdNTPs1.5 μ L, 10 μm of ol/L primer NA-P1, NA-P2 each 0.5 μ L, distilled water 9ml; Wherein primer NA-P1, NA-P2 is the forward primer described in claim 1, downstream primer;
Wherein 10 × AMVbuffer is Tris-HCL, 70mmol/LKCL, the 12mmol/LMgCL containing 40mmol/LPH8.52, the buffer of 5mmol/LDTT;
2) NASBA amplification reaction solution B:
Described NASBA amplification reaction solution B includes: 0.5URNaseH, 32UT7RNA polymerase, 6.4UAMV reverse transcription, 2 μ LDMSO, 0.1 μ L1mol/L dithiothreitol, DTT, 0.25 μ L10mg/mLBSA, 20URNA enzyme inhibitor.
4. the application of tomato spotted wilf virus in detection plant sample of the test kit described in claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410798148.4A CN104404173B (en) | 2014-12-21 | 2014-12-21 | A kind of NASBA method for detecting tomato spotted wilf virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410798148.4A CN104404173B (en) | 2014-12-21 | 2014-12-21 | A kind of NASBA method for detecting tomato spotted wilf virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404173A CN104404173A (en) | 2015-03-11 |
| CN104404173B true CN104404173B (en) | 2016-06-15 |
Family
ID=52641836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410798148.4A Expired - Fee Related CN104404173B (en) | 2014-12-21 | 2014-12-21 | A kind of NASBA method for detecting tomato spotted wilf virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404173B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499390B (en) * | 2019-09-29 | 2023-03-10 | 云南省烟草农业科学研究院 | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof |
| CN112625141A (en) * | 2020-12-28 | 2021-04-09 | 昆明海关技术中心 | Protein standard substance of tomato spotted wilt virus and application thereof |
| CN115820930A (en) * | 2022-09-26 | 2023-03-21 | 云南省农业科学院生物技术与种质资源研究所 | RT-qPCR detection method for single tomato seed carrying tomato spotted wilt virus TSWV and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120193A (en) * | 2014-07-01 | 2014-10-29 | 中国农业科学院蔬菜花卉研究所 | Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus |
-
2014
- 2014-12-21 CN CN201410798148.4A patent/CN104404173B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404173A (en) | 2015-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146811B (en) | Method to detect dendroctonus valens and detection kit | |
| CN104404173B (en) | A kind of NASBA method for detecting tomato spotted wilf virus | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN103276101B (en) | Method for detecting tomato transgenic component by using quadruple fluorescent quantitation | |
| CN102586473A (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN105567874A (en) | Porcine delta coronavirus fluorogenic quantitative PCR detection kit and non-diagnostic detection method | |
| CN103937908B (en) | The real-time fluorescence quantitative PCR detection method of sweet potato chlorotic stunt virus West Africa strain and application | |
| CN103834735B (en) | Nucleotide sequence and molecular probe for identifying dendrobium officinale and applications of molecular probe | |
| CN110093437A (en) | The fluorescence PCR detection reagent and method of golden larch | |
| CN104450975A (en) | RT-HDA primer, kit and method for detecting tomato spotted wilt virus | |
| CN105274258A (en) | Primer composition for detecting pepper mottle potyvirus as well as application of primer composition, kit consisting of primer composition and application of kit | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN104498632A (en) | Method for detecting tomato spotted wilf virus based on loop-mediated isothermal amplification technology | |
| CN104450972B (en) | NASBA primer, test kit and the method for detection Fructus Mali pumilae rust fruit virus | |
| CN104498633B (en) | NASBA primer, test kit and the method for detection Peach latent mosaic viroid | |
| CN105420359A (en) | LAMP primer group for Lectin detection and gene isothermal amplification method | |
| CN101792814A (en) | PCR method for detecting specificity of transformant of transgenic pest-resistant cotton GK12 | |
| CN104894280A (en) | Primer, kit and method for detecting transgenic maize NOS terminator | |
| CN104513867A (en) | Primer set, reagent kit and method for detecting hop stunt viroid based on loop-mediated isothermal amplification technology | |
| CN104561386A (en) | Real-time fluorescent quantitative PCR detection method for apple stem grooving virus | |
| CN104450952B (en) | The quick detection primer of flavobacterium columnare and detection method | |
| CN103642939A (en) | Method for detecting multiple trace targets based on long probe | |
| CN104450973B (en) | For detecting NASBA amplimer, test kit and the detection method of hop stunt viroid | |
| CN108998559A (en) | Identify SNP marker, ApoE gene method and the application of Corydalis remota | |
| CN102367489B (en) | Primer for detecting freesia mosaic virus (FreMV) and detection method of freesia mosaic virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 266002 Shandong province Qingdao city qutangxia Road No. 70 Patentee after: Qingdao Customs Technology Center Address before: 266002 Shandong province Qingdao city qutangxia Road No. 70 Patentee before: Inspection and Quarantine Technology Center of Shandong entry exit inspection and Quarantine Bureau |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160615 Termination date: 20211221 |