CN102776268A - Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature - Google Patents

Abstract

The invention discloses a kit and a method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at a constant temperature. The kit mainly comprises four primers, DNA polymerase, a reaction solution, a positive contrast and a negative contrast, wherein all the above-mentioned liquid are respectively disposed in a container; the kit also comprises a color-developing agent. The detection method is as follows: DNAs of a maize variety to be detected are extracted, the four specific primers and the DNA polymerase having strand displacement activity are used for amplification of a sample DNA template at a temperature of 63 to 65 DEG C, and amplification efficiency reaches 109 to 1010 copies in a short period of time; for identification of the maize variety to be detected, SYBR Green I is added and changes of colors are observed, or changes of turbidity of deposition in a reaction tube are observed by using a turbidity meter so as to determine whether amplification occurs or not, and then detection is carried out on the maize variety to be detected so as to determine whether the maize variety contains or is transgenic maize Mon89034 and a derivative variety thereof. The beneficial effects of speed, high efficiency, simple operation, high specificity, high sensitivity, easy identification, suitability for on-site detection and the like are obtained in the invention.

Description

Constant temperature gene amplification detects the test kit and the method for transgenic corns Mon89034 and derived varieties thereof

[technical field]

The invention belongs to technical field of molecular biology; The detection kit and the detection method thereof that relate to the transgenic plant product, specifically a kind of test kit and detection method thereof based on ring mediated isothermal gene amplification technology rapid detection transgenic corns Mon89034 and derived varieties thereof.

[background technology]

International Agricultural biotechnologies application service organizes " global biotechnology/genetically modified crops commercialized development situation in 2010 " report of delivering in the recent period to show; Because the huge benefits that genetically modified crops bring, nearly 100,000,000 person-times peasant made the plantation decision in past 15 years.Drop into the commercialization plantation over 15 years from genetically modified crops, global genetically modified crops cultivated area accumulative total is above 1,000,000,000 hectares.2010,1,540 ten thousand peasant plantings of 29 countries in the whole world totally 1.48 hundred million hectares genetically modified crops.From 1996 to 2010, the cultivated area of global genetically modified crops increased by 87 times.The national cultivated area of plantation genetically modified crops rank top ten has all surpassed 1,000,000 hectares first.These countries according to the big minispread of crops planting area are respectively: U.S.'s (6,680 ten thousand hectares), Brazil's (2,540 ten thousand hectares), Argentina (2,290 ten thousand hectares), India's (9,400,000 hectares), Canada's (8,800,000 hectares), China (3,500,000 hectares), Paraguay's (2,600,000 hectares), Pakistan (2,400,000 hectares), South Africa (2,200,000 hectares) and Uruguay's (1,100,000 hectares).At present, the genetically modified crops that countries in the world have been carried out field test surpass 5000 kinds, and ratifying commercial genetically modified crops has kind more than 160, comprises corn, soybean, rape, tomato, yam, pimento, pawpaw, beet, tobacco, paddy rice etc.

Transgenic corns accounts for more than 30% of whole world genetically modified crops cultivated area as one of topmost genetically modified crops in the world at present, is only second to genetically engineered soybean.. transgenic corns Mon89034 is a kind of expression cry1A.105 and the cry2Ab2 gene by the research and development of U.S. Monsanto Company; The transgenic corns strain that the lepidopterans insect is had resistance; Be authorized to be used for Canadian animal feed at present; Its representative seed is preserved in American type culture collection (ATCC), and preserving number is PTA-7455.On November 29th, 2010, a collection of 5.4 ten thousand tons transgenic corns from U.S.'s import is detected transgene component MON89034 with regard to Ceng Yinwei, and is made the decision of returning goods.

See that from world wide the popularization of transgenic corns has brought huge social and economic benefit.Yet also there are many problems in transgenic corns when bringing huge society and economic benefit; Mainly concentrate on the security of genetically modified foodGMF and to the security aspect of ecotope; Comprise the healthy risk of humans and animals; To the risk of ecotope, to the risk of nontarget organism with agricultural.To first kind of risk, 1993, United Nations's Economic development and cooperative association (OECO) proposed " substantial equivalence property " principle of food safety assessment.If the product and the traditional product of accurate gene crops production have substantial equivalence property, then can think safe.What propose the earliest genetically modified foodGMF is carried out identity management is European Union, and 1998, European Union signed first bill in the world, required transgenic product is carried out the label explanation; 1999, the non-transgenic product that requires to export to European Union must not contain 1% transgenic product pollution; 2002, minimum the limiting the quantity of that European Union will identify was reduced to 0.9%.Japan, Australia, different regulations have been done to the minimum content of transgene component by nz, and thresholding does not wait from 1-5%.

China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001; Announced agriculture genetically modified organism safety evaluation on January 5th, 2002; Sign and three supporting management ways of import security management; Confirm first and implemented the agriculture genetically modified organism catalogue of identity management, and in formal enforcement on March 20 in 2002.

In order to make comprehensive evaluation to genetically modified crops and products thereof; Except needing national governments and international body to formulate the Safety Assessment System and strict laws and regulations on the management of science; Setting up effective method system detects also very important to genetically modified crops; This is that genetically modified crops are carried out safety evaluation and the basis of implementing supervision, also is the important leverage that International Agricultural Trade develops in a healthy way.

The detection of transgenic product requires method to want fast, accurately, and sensitivity, and must consider to adapt to the large sample amount, characteristics such as the target gene kind is many.Therefore, the detection of genetically modified crops mainly is whether test sample contains exogenous protein (gene expression product) and whether contain foreign gene (DNA) at present.Foreign protein can utilize methods such as enzyme-linked immunosorbent assay (ELISA) test strip detection based on immunity principle, Western hybridization to detect in the genetically modified crops; The main matrix that from testing sample, contains target protein according to the certain procedure extracting; Utilize and target protein (antigen) specificity bonded characteristic; Effect through coupling antibody and immune complex produces detectable signal; But this method requires the antibody of high quality high stability, otherwise because of accuracy is not enough, can only be as the auxiliary detection means.The nucleic acid detection method of genetically modified crops mainly contains two kinds: making nucleic acid molecular hybridization technology (Sourthernblot), PCR detection technique.Wherein the PCR detection method is main, most accurately detects the method for genetically modified crops, comprises the qualitative PCR method, meets PCR method, nested PCR method, competitive quantifying PCR method, fluorescence quantifying PCR method or the like.

At present, what promote the use of both at home and abroad is qualitative PCR and real-time quantitative PCR detection method: the ultimate principle of round pcr is similar to the natural reproduction process of DNA, and its specificity depends on and target sequence two ends complementary Oligonucleolide primers.Effect through polysaccharase; In the external purpose fragment that increases specifically fast, trace, specific purpose dna fragmentation were increased rapidly in several hours 1,000,000 times, amplified production is through agarose gel electrophoresis; Be easy to behind the ethidium bromide staining observe, thereby have advantage such as rapid sensitive.Yet PCR method reaction system and operating process more complicated need the professional; Required PCR appearance price is about 50,000 yuan, and proliferation time 2-3 hour, the electrophoresis time of amplification needed about 1 hour; Electrophoresis common dyes EB is a strong carcinogen, and strong toxicity is arranged, and is difficult to carry out on-the-spot the detection.So, in scientific research and production practice, all need a kind of fast and convenient, operation accurately, universal, safe and reliable and be applicable to the genetically modified crops detection method of execute-in-place easily.

Ring mediated isothermal gene amplification technology (Loop-Mediated Isothermal Amplification; Hereinafter to be referred as the LAMP method) be the gene amplification technology that Japanese Eiken Chemical developed before and after 2000; It has fast and convenient, operation accurately, popularize easily, safe and reliable advantage, the test kit that the LAMP method is applied to rapid detection transgenic corns Mon89034 and derived varieties thereof is not arranged at present as yet.

[summary of the invention]

The object of the present invention is to provide a kind of constant temperature gene amplification to detect the test kit of transgenic corns Mon89034 and derived varieties thereof.

Another object of the present invention is to provide a kind of detection method that detects transgenic corns Mon89034 and derived varieties thereof based on the constant temperature gene amplification of mentioned reagent box.

Above-mentioned purpose of the present invention is achieved through following technical scheme:

Constant temperature gene amplification of the present invention detects the test kit of transgenic corns Mon89034 and derived varieties thereof mainly to be made up of four primers, archaeal dna polymerase, reaction solution, positive control, negative controls, and above liquid places container respectively.

The test kit that constant temperature gene amplification of the present invention detects transgenic corns Mon89034 and derived varieties thereof can also have developer.

Wherein: (1), according to the sequences Design of the foreign gene of transgenic corns Mon89034 and native gene junction 4 primers, use above-mentioned four primers, 6 zones of amplified target sequence, four primers are:

Outer primer 1:CTATGTAAGAGGTGTTTGAA is shown in SEQ ID No.1;

Outer primer 2:GTAAGATGTGAGTATGATCC is shown in SEQ ID No.2;

Inner primer 1:GTCCATCTATCAAATCAGCACCGTCTATCCACGGTCCGTGCGCACC is shown in SEQ IDNo.3;

Inner primer 2:GAACAACATCTCTGGAGTCGGTGAGTCCGGCGTACTGCGCCACC is shown in SEQ IDNo.4.

Above-mentioned primer can be synthetic according to process specifications through the high-throughput dna synthesizer, and through HPLC (high-pressure liquid phase method) purifying.

Primer mixed solution: synthetic primer dry powder is made into the mother liquor that concentration is 100 μ M respectively, gets outer primer 1, outer primer 2 each 1 μ l then, inner primer 1, inner primer 2 each 8 μ l, thorough mixing.

(2) a kind of have an active archaeal dna polymerase of strand displacement, and for example can adopt the Bst archaeal dna polymerase: concentration is 7-9U/ μ l, preferred 8U/ μ l;

(3) reaction solution: contain 10mM dNTP (triphosphoric acid dezyribonucleoside), 10 * ThermoPol reaction buffer (heat-resisting polymerase reaction buffer) reaction buffer, 150mM MgSO ₄The aqueous solution, three's volume ratio is 7-9: 4-6: 2, preferred 10mM dNTP/10 * ThermoPol reaction buffer/150mM MgSO ₄=8/5/2;

(4) positive control is that concentration is the DNA of 5% transgenic corns 89034 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene.

The e. coli plasmid dna that contains goal gene can adopt method well known to those skilled in the art to prepare plasmid and extract its DNA.

The test kit that constant temperature gene amplification of the present invention detects transgenic corns Mon89034 and derived varieties thereof can also have developer: optical dye SYBR Green I.

The present invention adopts the method for mentioned reagent box constant temperature gene amplification rapid detection transgenic corns MON89034 and derived varieties thereof, may further comprise the steps:

(1) the DNA extraction process of transgenic corns Mon89034 and derived prods thereof: adopt CTAB method (cetyl trimethylammonium bromide method) to extract purification of samples DNA;

(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer mixture 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l detects template DNA 2-5 μ l, uses sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is the DNA alternate template DNA of 5% transgenic corns 89034, when the negative control reaction is set, with the reaction mixture alternate template DNA that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63-65 ℃ of reaction 60-90min, and at 80 ℃ of lasting 2min;

(3) analysis and judgement reaction product result: reaction tubes is placed in the turbidimeter by step reaction in (2), and sedimentary turbidity changes and judges amplification in the observing response pipe, if deposition is then positive, it is then negative not have deposition.Its principle is to carry out through the amount of the white precipitate of assessment amplification by product magnesium pyrophosphate.It has high specificity, can just can whether judge amplification through the deposition turbidity in the turbidimeter detection reaction pipe.

In test kit, contain under the situation of developer, in (2), obtain adding in the product 1-2 μ l developer, mixing, the following or visual inspection of uv lamp is if shows green is then positive, orange then negative.

The method that wherein conventional CTAB method is extracted transgenic corns Mon89034DNA is:

(1) get transgenic corns Mon89034, about 100mg puts into mortar, adds a small amount of liquid nitrogen and grinds rapidly.Liquid nitrogen adds 3-4 time repeatedly, is milled to till the powder.

(2) add 1.5ml and be preheated to 65 ℃ CTAB and extract damping fluid, thorough mixing, suspension sample, 65 ℃ of child care 30min, during do not stop to put upside down mixing;

(3) the centrifugal 10min of about 12000g.Shift the new centrifuge tube of supernatant to, add the phenol of 1 times of volume: chloroform: primary isoamyl alcohol (25: 24: 1), thorough mixing.The centrifugal 15min of about 12000g.Shift in the new centrifuge tube of supernatant to;

(4) chloroform of 1 times of volume of adding: primary isoamyl alcohol (24: 1), thorough mixing.The centrifugal 15min of about 12000g.Shift in the new centrifuge tube of supernatant to;

(5) the CTAB precipitation buffering liquid of 2 times of volumes of adding, room temperature leaves standstill child care 60min; The centrifugal 15min of 12000g abandons supernatant; Add 350 μ l sodium chloride solution dissolution precipitations; The centrifugal 10min of 12000g shifts the new centrifuge tube of supernatant to;

(6) add 0.6 times of volume Virahol, be inverted centrifuge tube and softly mix, room temperature is placed 20min, the centrifugal 15min of 12000g.Abandon supernatant.Add 500 μ l70% ethanolic solns, and put upside down centrifuge tube for several times.The centrifugal 10min of 12000g.Abandon supernatant;

(7) the dry DNA deposition adds 100 μ lTE damping fluid dissolving DNAs.

The present invention is based on loop-mediated isothermal amplification technique (LAMP method) is four primers according to the target gene design; Six isolated areas on the specific identification target-gene sequence; Start the endless chain replacement(metathesis)reaction; Start complementary strand in target DNA district synthetic, and the result goes round and begins again on same chain and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.Adopt 4 Auele Specific Primers and a kind of to have the active archaeal dna polymerase of strand displacement; At 63-65 ℃ nucleic acid is carried out amplified reaction; Reaction needs is carried out under constant temperature; Reaction times is according to the template DNA quality change, is generally 90min or still less, amplification efficiency can reach 10 in the short period of time of 60-90min ⁹-10 ¹⁰Individual copy number.Add template DNA, 63-65 ℃ after the 60-90min reaction, behind 80 ℃ of lasting 2min, stop.The advantage of this technology is not need thermal cycling, and because amplification is under constant temperature, to carry out, does not therefore need expensive instruments such as PCR appearance.In reaction, when nucleic acid is synthetic in a large number, Mg ionic bond the pyrophosphate ion of separating out from dNTP and the reaction soln, the white precipitate of generation by product magnesium pyrophosphate.

The present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, evaluation are easy, be fit to beneficial effect such as on-the-spot detection:

(1) rapidly and efficiently: whole amplification only can be accomplished with 60-90min, and amplification output can reach 10 ⁹-10 ¹⁰Individual copy;

(2) easy and simple to handle: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the loaded down with trivial details steps such as sex change of double-stranded DNA, only need a steady temperature appearance just to react and detect, condition is relatively gentleer;

(3) high specific: the present invention has designed four Auele Specific Primers according to the exogenous gene sequence of transgenic corns Mon89034:

Use above-mentioned four primers, therefore 6 zones of amplified target sequence have high degree of specificity;

(4) highly sensitive: the lowest detection limit can reach 10 copies;

Whether (5) evaluation is easy: can add SYBR Green I colour-change or exist magnesium pyrophosphate to precipitate whether judge amplification through observing, need not other any analytical procedures such as electrophoresis, suitable on-the-spot the detection.

Below in conjunction with embodiment the present invention is described in further detail, but embodiment of the present invention is not limited thereto.

The process for extracting of the template DNA of transgenic corns Mon89034 and derived varieties thereof adopts conventional CTAB method.

[embodiment]

Embodiment 1 contains the test kit and the detection method thereof of developer:

Test kit by following formulation constant temperature gene amplification rapid detection transgenic corns Mon89034 and derived varieties thereof:

(1) primer mixed solution: synthetic primer dry powder is made into the mother liquor that concentration is 100 μ M respectively, gets outer primer 1, outer primer 2 each 1 μ l then, inner primer 1, inner primer 2 each 8 μ l, thorough mixing, wherein primer sequence is respectively:

Outer primer 1:CTATGTAAGAGGTGTTTGAA; Shown in SEQ ID No.1;

Outer primer 2:GTAAGATGTGAGTATGATCC; Shown in SEQ ID No.2;

Inner primer 1:GTCCATCTATCAAATCAGCACCGTCTATCCACGGTCCGTGCGCACC; Shown in SEQ IDNo.3;

Inner primer 2:GAACAACATCTCTGGAGTCGGTGAGTCCGGCGTACTGCGCCACC; Shown in SEQ IDNo.4;

(2) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l;

(3) reaction solution: 10mM dNTP/10 * ThermoPol reaction buffer/150mM MgSO ₄=8/5/2;

(4) developer: optical dye 1 * SYBR Green I;

(5) positive control is that concentration is the DNA of 5% transgenic corns 89034, or with the e. coli plasmid dna alternate template DNA that contains goal gene; Negative control is not for containing the reaction mixture of goal gene.

Certain corn variety is detected by following method with above-mentioned test kit:

(1) dna profiling set-up procedure: adopt conventional CTAB method, extract the template DNA of transgenic corns Mon89034 and derived varieties thereof;

(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer mixture 1 μ l, reaction solution 12.5 μ l, the Bst archaeal dna polymerase, 1 μ l, template DNA 2 μ l use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is the DNA alternate template DNA of 5% transgenic corns 89034, or with the e. coli plasmid dna alternate template DNA that contains goal gene; When the negative control reaction is set, with the reaction mixture alternate template DNA that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;

(3) analysis and judgement reaction product result: in (2), obtain adding in the product 1 μ l developer, mixing, visual inspection.The pipe of no amplified reaction presents yellow, has the pipe of amplification reflection to become green.

In the present embodiment, it is green that PCR pipe shows, and shows to contain in the corn seed to be checked or be transgenic corns Mon89034 and derived varieties thereof all, contains transgenic corns Mon89034 composition.

Embodiment 2 does not contain the test kit and the detection method thereof of developer:

The developer of test kit in lacking embodiment 1, all the other are with embodiment 1.

Detection method is except that analysis and judgement reaction product result step, and all the other are with embodiment 1, and analysis and judgement result's method is:

Reaction tubes is placed in the turbidimeter by step reaction in (2), and sedimentary turbidity changes and judges amplification in the observing response pipe, if deposition is then positive, it is then negative not have deposition.

In the present embodiment, deposition appears in PCR pipe, shows to contain in the corn seed to be checked or be transgenic corns Mon89034 and derived varieties thereof all, contains transgenic corns Mon89034 composition.

The comparison of embodiment 3PCR reaction and detection method sensitivity of the present invention:

Test kit by following formulation constant temperature gene amplification rapid detection transgenic corns Mon89034 and derived varieties thereof:

(1) primer mixed solution: synthetic primer dry powder is made into the mother liquor that concentration is 100 μ M respectively, gets outer primer 1, outer primer 2 each 1 μ l then, inner primer 1, inner primer 2 each 8 μ l, thorough mixing, wherein primer sequence is respectively:

Outer primer 1:CTATGTAAGAGGTGTTTGAA; Shown in SEQ ID No.1;

Outer primer 2:GTAAGATGTGAGTATGATCC; Shown in SEQ ID No.2;

Inner primer 1:GTCCATCTATCAAATCAGCACCGTCTATCCACGGTCCGTGCGCACC; Shown in SEQ IDNo.3;

Inner primer 2:GAACAACATCTCTGGAGTCGGTGAGTCCGGCGTACTGCGCCACC; Shown in SEQ IDNo.4;

(2) archaeal dna polymerase: the Bst archaeal dna polymerase, also can adopt other archaeal dna polymerases, concentration is 8U/ μ l;

(3) reaction solution: 10mM dNTP/10 * ThermoPol reaction buffer/150mM MgSO ₄=8/5/2;

(4) developer: optical dye 1 * SYBR Green I;

(5) positive control is that concentration is the DNA of 5% transgenic corns 89034, and negative control is not for containing the reaction mixture of goal gene.

Transgenic corns Mon89034 and derived varieties thereof are detected by following method with above-mentioned test kit:

(1) dna profiling set-up procedure: the DNA of the DNA5%, 0.5%, 0.1%, 0.05%, 0.01% that adopts the CTAB method to extract purifying to contain transgenic corns Mon89034 composition, 0.05% sample;

(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer mixture 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, template DNA 5 μ l use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is the DNA alternate template DNA of 5% transgenic corns 89034, when the negative control reaction is set, with the reaction mixture alternate template DNA that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 65 ℃ of reaction 90min, and at 80 ℃ of lasting 2min;

(3) analysis and judgement reaction product result: reaction tubes is placed in the turbidimeter by step reaction in (2), and sedimentary turbidity changes and judges amplification in the observing response pipe, if deposition is then positive, it is then negative not have deposition.Positive control, 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% deposition all occurs and is shown as positive findings, and negative control does not have deposition and produces.Also can in (2), obtain adding in the product 1 μ l developer, mixing, visual inspection.The pipe of no amplified reaction presents yellow, has the pipe of amplification reflection to become green.

In the present embodiment, positive control, 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% deposition all occurs and is shown as positive findings, and the PCR pipe shows green; The negative control pipe presents yellow.

(4) PCR reaction primer adopts the outer primer 1 and outer primer 2 in present method reaction.The PCR reaction is 25 μ l systems, 10 * PCR Buffer (PCR reaction buffer, Promega company), 2.5 μ l; 10mM dNTPs (Promega company) 0.5 μ l, the respectively corresponding outer primer 1 of upstream and downstream primer and outer primer 2, each 0.5 μ l; Taq enzyme (5U/ μ l; Promega company) 0.5 μ l, dna profiling 1 μ l mends to 25 μ l with the sterilization deionized water.Response procedures is 95 ℃ of preparatory sex change 5min, 95 ℃ of sex change 30s, and 58 ℃ of annealing 30s, 72 ℃ are extended 30s, and 72 ℃ are extended 7min.The PCR product is got 10 μ l and 2% agarose gel electrophoresis, 40min under the 100V voltage, and through gel imaging analysis appearance observations. corresponding band is respectively: M, DL600DNAMa rker (dna molecular amount standard); 1, positive control; 2,5%; 3,0.5%; 4,0.1%; 5,0.05%; 6,0.01%; 7,0.005%; 8, negative control.Wherein the sensitivity of PCR method is 0.05%, and 6,7 are shown as negative findings.

Can find out relatively that by two kinds of methods the result of the sensitivity of test kit of the present invention can reach 0.005% concentration, and the sensitivity of PCR method is 0.05%, and 0.01% or below be shown as negative findings; Through comparison, test kit of the present invention and method sensitivity can detect the more sample of low levels apparently higher than the susceptibility of PCR method.

The foregoing description is a preferred implementation of the present invention; But embodiment of the present invention is not restricted to the described embodiments; Other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; All should be the substitute mode of equivalence, be included within protection scope of the present invention.

Claims (6)

1. a constant temperature gene amplification detects the test kit of transgenic corns Mon89034 and derived varieties thereof, mainly is made up of four primers, archaeal dna polymerase, reaction solution, positive control, negative controls, and above liquid places container respectively, wherein:

(1) primer mixed solution: synthetic primer dry powder is made into the mother liquor that concentration is 100 μ M respectively, gets outer primer 1, outer primer 2 each 1 μ l then, inner primer 1, inner primer 2 each 8 μ l, thorough mixing, four primers are:

Outer primer 1:CTATGTAAGAGGTGTTTGAA is shown in SEQ ID No.1;

Outer primer 2:GTAAGATGTGAGTATGATCC is shown in SEQ ID No.2;

Inner primer 1:GTCCATCTATCAAATCAGCACCGTCTATCCACGGTCCGTGCGCACC is shown in SEQ IDNo.3;

Inner primer 2:GAACAACATCTCTGGAGTCGGTGAGTCCGGCGTACTGCGCCACC is shown in SEQ IDNo.4;

(2) archaeal dna polymerase: concentration is 7-9U/ μ l;

(3) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, 150mM MgS0 ₄The aqueous solution, three's volume ratio is 7-9: 4-6: 2;

(4) positive control is that concentration is the DNA of 5% transgenic corns 89034 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene.

2. a kind of constant temperature gene amplification according to claim 1 detects the test kit of transgenic corns Mon89034 and derived varieties thereof, it is characterized in that:

(1) archaeal dna polymerase: be the Bst archaeal dna polymerase, concentration is 8U/ μ l;

(2) reaction solution: be 10mM dNTP/10 * ThermoPol reaction buffer/150mM MgSO ₄=8/5/2 volume ratio.

3. the described test kit of claim 1 detects the method for transgenic corns MON89034 and derived varieties thereof, it is characterized in that, may further comprise the steps:

(1) the DNA extraction process of transgenic corns Mon89034 and derived prods thereof: adopt the CTAB method to extract purification of samples DNA;

(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer mixture 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, template DNA 2-5 μ l uses sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is the DNA of 5% transgenic corns 89034 or the e. coli plasmid dna alternate template DNA that contains goal gene, when the negative control reaction is set, with the reaction mixture alternate template DNA that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63-65 ℃ of reaction 60-90min, and at 80 ℃ of lasting 2min;

(3) analysis and judgement reaction product result: reaction tubes is placed in the turbidimeter by step reaction in (2), and sedimentary turbidity changes and judges amplification in the observing response pipe, if deposition is then positive, it is then negative not have deposition.

4. a kind of constant temperature gene amplification as claimed in claim 1 detects the test kit of transgenic corns Mon89034 and derived varieties thereof, also has developer: optical dye SYBR Green I.

5. a kind of constant temperature gene amplification according to claim 4 detects the test kit of transgenic corns Mon89034 and derived varieties thereof, it is characterized in that:

(1) archaeal dna polymerase: be the Bst archaeal dna polymerase, concentration is 8U/ μ l;

(2) reaction solution: be 10mM dNTP/10 * ThermoPol reaction buffer/150mM MgSO ₄=8/5/2 volume ratio.

6. the described test kit of claim 4 detects the method for transgenic corns MON89034 and derived varieties thereof, it is characterized in that, may further comprise the steps:

(1) the DNA extraction process of transgenic corns Mon89034 and derived prods thereof: adopt the CTAB method to extract purification of samples DNA;

(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer mixture 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, template DNA 2-5 μ l uses sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is the DNA of 5% transgenic corns 89034 or the e. coli plasmid dna alternate template DNA that contains goal gene, when the negative control reaction is set, with the reaction mixture alternate template DNA that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63-65 ℃ of reaction 60-90min, and at 80 ℃ of lasting 2min;

(3) analysis and judgement reaction product result: in (2), obtain adding in the product 1-2 μ l developer, mixing is if shows green is then positive, orange then negative.