The LAMP of transgenic corns EVENT98140 and derived varieties thereof detects primer sets, detection kit and detection method
Technical field
The invention belongs to technical field of molecular biology, relate to the detection method of transgenic plant kind, the LAMP that is specifically related to transgenic corns EVENT98140 and derived varieties thereof detects primer sets, detection kit and detection method.
Background technology
Transgenic corns accounts for more than 30% of whole world genetically modified crops cultivated area as one of topmost genetically modified crops in the world at present, is only second to genetically engineered soybean.
From world wide, the popularization of transgenic corns has brought huge social and economic benefit.Yet also there are many problems in transgenic corns when bringing huge society and economic benefit, mainly concentrate on the security of genetically modified food and to the security aspect of ecotope, comprise the risk to humans and animals health, to the risk of ecotope with agricultural, to the risk of nontarget organism.At first kind of risk, 1993, United Nations's Economic development and cooperative association (OECO) proposed " substantial equivalence " principle of food safety assessment.If product and the traditional product of accurate gene crops production have substantial equivalence, then can think safe.What propose the earliest genetically modified food is carried out identity management is European Union, and 1998, European Union signed first bill in the world, required transgenic product is carried out the label explanation; 1999, the non-transgenic product that requires to export to European Union must not contain 1% transgenic product pollution; 2002, minimum the limiting the quantity of that European Union will identify was reduced to 0.9%.Japan, Australia, different regulations have been done to the minimum content of transgene component by New Zealand, and thresholding does not wait from 1~5%.
China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001, announced agriculture genetically modified organism safety evaluation on January 5th, 2002, sign and three supporting management ways of import security management, determined the agriculture genetically modified organism catalogue of first enforcement identity management, and in formal enforcement on March 20 in 2002.
In order to make comprehensive evaluation to genetically modified crops and products thereof, except needing national governments and international body to formulate the Safety Assessment System and strict laws and regulations on the management of science, setting up effective method system detects also very important to genetically modified crops, this is the basis that genetically modified crops are carried out safety evaluation and implement supervision, also is the important leverage that International Agricultural Trade develops in a healthy way.
The detection of transgenic product requires method to want fast, accurately, and sensitivity, and must consider to adapt to the large sample amount, characteristics such as the target gene kind is many.Therefore, the detection of genetically modified crops mainly is whether test sample contains exogenous protein (gene expression product) and whether contain foreign gene (DNA) at present.Foreign protein can utilize methods such as enzyme-linked immunosorbent assay (ELISA) test strip detection based on immunity principle, Western hybridization to detect in the genetically modified crops, the main matrix that from testing sample, contains target protein according to the certain procedure extracting, utilize the characteristic of being combined with target protein (antigen) specificity, effect by coupling antibody and immune complex produces detectable signal, but this method requires the antibody of high quality high stability, otherwise because accuracy is not enough, can only be as the auxiliary detection means.The nucleic acid detection method of genetically modified crops mainly contains two kinds: making nucleic acid molecular hybridization technology (Sourthernblot), PCR detection technique.Wherein the PCR detection method is main, most accurately detects the method for genetically modified crops, comprises the qualitative PCR method, meets PCR method, nested PCR method, competitive quantifying PCR method, fluorescence quantifying PCR method etc.
What promote the use of both at home and abroad at present, is qualitative PCR and real-time quantitative PCR detection method: the ultimate principle of round pcr is similar to the natural reproduction process of DNA, and its specificity depends on the Oligonucleolide primers with the complementation of target sequence two ends.Effect by polysaccharase, in the external purpose fragment that increases specifically fast, amplification is to 1,000,000 times rapidly in several hours to make trace, specific purpose dna fragmentation, and amplified production is through agarose gel electrophoresis, be easy to behind the ethidium bromide staining observe, thereby have advantage such as rapid sensitive.Yet PCR method reaction system and operating process more complicated need the professional; Required PCR instrument price about 50,000 yuan, proliferation time 2~3 hours, the electrophoresis time of amplification needs about 1 hour; Electrophoresis common dyes EB is strong carcinogen, and strong toxicity is arranged, and is difficult to carry out on-the-spot the detection.So, in scientific research and production practice, all need a kind of fast and convenient, operation accurately, universal, safe and reliable and be applicable to the genetically modified crops detection method of execute-in-place easily.
Ring mediated isothermal gene amplification technology (Loop-Mediated Isothermal Amplification, hereinafter to be referred as the LAMP method) be the gene amplification technology that Japanese Eiken Chemical developed before and after 2000, its have fast and convenient, operation accurately, popularize easily, safe and reliable advantage, the test kit that the LAMP method is applied to rapid detection transgenic corns EVENT98140 and derived varieties thereof is not arranged at present as yet.
Summary of the invention
One object of the present invention is to provide the LAMP of a kind of transgenic corns EVENT98140 and derived varieties thereof to detect primer sets.
The object of the present invention is to provide the LAMP detection kit of a kind of transgenic corns EVENT98140 and derived varieties thereof.
It is a kind of based on the transgenic corns EVENT98140 of above-mentioned detection primer sets and detection kit and the constant temperature gene amplification detection method of derived varieties thereof that another object of the present invention is to provide.
The technical solution adopted in the present invention is as follows:
The LAMP of transgenic corns EVENT98140 and derived varieties thereof detects primer sets, comprises outer primer 1, outer primer 2, inner primer 1 and inner primer 2, and its nucleotide sequence is as follows respectively:
Outer primer 1:GTCGTCGATGCATATGTGT(SEQ ID No:1);
Outer primer 2:AATTCTCGTACGTACAGCAC(SEQ ID No:2);
Inner primer 1:GTCATCCATGAGTCAACCGTGTTACCTGCTGCTGGCTTAT(SEQ ID No:3);
Inner primer 2:AGATAGTAGTAGCGGCTCGTCAAATAAGGTGGAATCAGTCGC(SEQ ID No:4).
The LAMP detection kit of transgenic corns EVENT98140 and derived varieties thereof comprises primer liquid, reaction solution, archaeal dna polymerase and contrast, it is characterized in that:
(1) primer liquid: contain above-mentioned primer sets, concentration is respectively 4~6 μ M outer primers, 1,4~6 μ M outer primers, 2,32~48 μ M inner primers, 1,32~48 μ M inner primers 2;
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 7~9:4~6:2;
(3) archaeal dna polymerase: concentration is 7~9U/ μ l;
(4) contrast: positive control is the DNA of transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene.
Preferably, contain 5 μ M outer primers, 1,5 μ M outer primers, 2,40 μ M inner primers, 1,40 μ M inner primers 2 in the described primer liquid.
Preferably, described archaeal dna polymerase is the Bst archaeal dna polymerase, and concentration is 8U/ μ l.
Preferably, in the described reaction solution, 10mM dNTP:10 * ThermoPol reaction buffer: 150mM MgSO4=8:5:2 volume ratio.
Can also contain developer in the LAMP detection kit of transgenic corns EVENT98140 of the present invention and derived varieties thereof, described developer is fluorescence dye SYBRGreen I.
Utilize above-described test kit to detect the method for transgenic corns EVENT98140 and derived varieties thereof, comprise the steps:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purification of samples DNA;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2~5 μ l to be checked use sterilization deionized water polishing to 25 μ l; In positive control when reaction, be set, substitute DNA to be checked with the DNA of transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63~65 ℃ of reaction 60~90min, and at 80 ℃ of lasting 2min;
(3) result judges: change to judge amplification by the turbidity that precipitates in the observing response pipe.
In test kit, contain under the situation of developer, in the product that (2) obtain, add 1~2 μ l developer, mixing, the result judges amplification according to colour developing.
Wherein, the method for CTAB method extraction transgenic corns EVENT98140 DNA is:
(1) get the about 100mg of transgenic corns EVENT98140, put into mortar, add a small amount of liquid nitrogen and grind rapidly, liquid nitrogen adds 3~4 times repeatedly, is milled to till the powder;
(2) add 1.5ml and be preheated to 65 ℃ CTAB and extract damping fluid, fully mix, the suspension sample, 65 ℃ of child care 30min, during do not stop to put upside down mixing;
(3) the centrifugal 10min of about 12000g.Shift the new centrifuge tube of supernatant to, add the phenol of 1 times of volume: chloroform: primary isoamyl alcohol (25:24:1), fully mix the centrifugal 15min of about 12000g.Shift in the new centrifuge tube of supernatant to;
(4) chloroform of 1 times of volume of adding: primary isoamyl alcohol (24:1), fully mix the centrifugal 15min of about 12000g.Shift in the new centrifuge tube of supernatant to;
(5) the CTAB precipitation buffering liquid of 2 times of volumes of adding, room temperature leaves standstill child care 60min; The centrifugal 15min of 12000g abandons supernatant; Add 350 μ l sodium chloride solution dissolution precipitations; The centrifugal 10min of 12000g shifts the new centrifuge tube of supernatant to;
(6) add 0.6 times of volume Virahol, be inverted centrifuge tube and softly mix, room temperature is placed 20min, and the centrifugal 15min of 12000g abandons supernatant, adds 500 μ l70% ethanolic solns, and puts upside down centrifuge tube for several times, and the centrifugal 10min of 12000g abandons supernatant;
(7) the dry DNA precipitation adds 100 μ lTE damping fluid dissolving DNAs.
The present invention is based on loop-mediated isothermal amplification technique (LAMP method), according to six isolated areas on four primers energy specific recognition target-gene sequences of target gene design, start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and the result is at the go round and begin again stem-circular DNA mixture of the Cauliflower structure that is formed with a lot of rings of same chain.Adopt 4 Auele Specific Primers and a kind of archaeal dna polymerase with strand displacement activity, at 63~65 ℃ nucleic acid is carried out amplified reaction, reaction needs to carry out under constant temperature, reaction times is according to the template DNA quality change, be generally 90min or still less, amplification efficiency can reach 10 in the short period of time of 60~90min
9~10
10Individual copy number.Add template DNA, behind 63~65 ℃ of reaction 60~90min, in 80 ℃ of preservation 2min, termination reaction.The advantage of this technology is not need thermal cycling, and because amplification is to carry out under constant temperature, does not therefore need expensive instruments such as PCR instrument.In reaction, when nucleic acid is synthetic in a large number, Mg ionic bond the pyrophosphate ion of separating out from dNTP and the reaction soln, the white precipitate of generation by product magnesium pyrophosphate.
The present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, evaluation are easy, be fit to beneficial effect such as on-the-spot detection:
(1) rapidly and efficiently: whole amplification only can be finished with 60~90min, and amplification output can reach 10
9~10
10Individual copy;
(2) easy and simple to handle: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the loaded down with trivial details steps such as sex change of double-stranded DNA, only need a steady temperature instrument just to react and detect, condition is relatively gentleer;
(3) high specific: the present invention has designed four Auele Specific Primers according to foreign gene and the native gene junction of transgenic corns EVENT98140, use above-mentioned four primers, 6 zones of amplified target sequence, has very strong strain specificity, and it is highly stable, it is low to form the primer dimer probability, has guaranteed that successful reaction carries out;
(4) highly sensitive: the lowest detection limit can reach 10 copies;
Whether (5) evaluation is easy: can add SYBR Green I colour-change or exist magnesium pyrophosphate to precipitate whether to judge amplification by observing, need not other any analytical procedures such as electrophoresis, be fit to the scene and detect.
Description of drawings
Fig. 1 is the detected result figure (1-4: sample to be checked of embodiment 1; 5: positive control; 6: negative control);
Fig. 2 is the detected result figure (1,2: sample to be checked of embodiment 2; 3: negative control, 4: positive control);
Fig. 3 is that (1-6 is followed successively by: 0.5%, 0.1%, 005%, 0.01%, 0.005% sample DNA 5%,, 7: negative control: 8: positive control) for the detected result figure of embodiment 3;
Fig. 4 is that (1-20 is followed successively by: transgenic corns EVENT98140, BT176, BT11,59122, MON810, MON88017, MON89034, MON863, GA21, MIR604 for the detected result figure of embodiment 4, genetically engineered soybean MON89788, transgenic paddy rice BT63, transgenosis potato EH92-527-1, transgene rape T45, transgene cotton GHB614, non-transgenic corn, paddy rice, wheat, rape, cotton).
Embodiment
The present invention is further illustrated below in conjunction with embodiment, but be not limited thereto.
Above-described embodiment is preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
If no special instructions, " % " in following examples all refers to mass percent.
Embodiment 1 contains test kit and the detection method thereof of developer:
The LAMP detection kit of transgenic corns EVENT98140 and derived varieties thereof comprises primer liquid, reaction solution, archaeal dna polymerase, contrast and developer:
(1) primer liquid: containing 2, four primers of 5 μ M outer primers, 1,5 μ M outer primer 2,40 μ M inner primers, 1,40 μ M inner primers is:
Outer primer 1:GTCGTCGATGCATATGTGT(SEQ ID No:1)
Outer primer 2:AATTCTCGTACGTACAGCAC(SEQ ID No:2)
Inner primer 1:GTCATCCATGAGTCAACCGTGTTACCTGCTGCTGGCTTAT(SEQ ID No:3)
Inner primer 2:AGATAGTAGTAGCGGCTCGTCAAATAAGGTGGAATCAGTCGC(SEQ ID No:4)
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 8:5:2;
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l;
(4) contrast: positive control is that concentration is the DNA of 5% transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene;
(5) developer: fluorescence dye 1 * SYBR Green I.
By the following method corn variety to be measured is detected with above-mentioned test kit:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purifying testing sample DNA;
(2) constant temperature gene amplification reaction: prepare reaction system at 200 μ l PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2 μ l to be checked use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and is that the DNA of 5% transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene substitute DNA to be checked with concentration, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3) result judges: add 2 μ l developers in above-mentioned reaction tubes, mixing is if shows green is then positive, orange then negative.
In the present embodiment, negative control manifests orange, the positive control shows green, testing sample 1,2 PCR pipe show green (managing 1,2 among Fig. 1), show and contain in the corn seed sample 1 to be measured, 2 or all be transgenic corns EVENT98140 and derived varieties thereof, contain transgenic corns EVENT98140 composition, testing sample 3,4 PCR pipe show orange (managing 3,4 among Fig. 1), show that then testing sample 3,4 does not contain transgenic corns EVENT98140 composition.
Primer DP098-f6 (forward) with reference to detection EVENT98140 among the GMOD: GTGTGTATGTCTCTTTGCTTGGTCTT(SEQ ID No:5), DP098-r2 (reverse): GATTGTCGTTTCCCGCCTTC(SEQ ID No:6), with probe DP098-p5:-FAM – CTCTATCGATCCCCCTCTTTGATAGTTTAAACT – TAMRA(SEQ ID No:7) carry out the quantitative fluorescent PCR check, assay is consistent with above-mentioned LAMP methods and results.
Embodiment 2 does not contain test kit and the detection method thereof of developer:
The developer in the test kit in lacking embodiment 1, all the other are with embodiment 1.
By the following method corn variety to be measured is detected with above-mentioned test kit:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purifying testing sample DNA;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2 μ l to be checked use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and is that the DNA of 5% transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene substitute DNA to be checked with concentration, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3) result judges: reaction tubes is placed in the turbidimeter by step reaction in (2), and the turbidity of precipitation changes to judge amplification in the observing response pipe, if precipitation is then positive, it is then negative not have precipitation.
In the present embodiment, negative control does not have precipitation, and positive control produces precipitation, and precipitation (Fig. 2 pipe 1) appears in the PCR pipe of sample 1 to be checked, show and contain in the corn seed sample 1 to be checked or be transgenic corns EVENT98140 and derived varieties thereof all, contain transgenic corns EVENT98140 composition.Precipitation (Fig. 2 pipe 2) does not appear in the PCR pipe of sample 2 to be checked, shows not contain transgenic corns EVENT98140 composition in the sample 2 to be checked.
Primer DP098-f6 (forward) with reference to detection EVENT98140 among the GMOD: GTGTGTATGTCTCTTTGCTTGGTCTT(SEQ ID No:5), DP098-r2 (reverse): GATTGTCGTTTCCCGCCTTC(SEQ ID No:6), with probe DP098-p5:-FAM – CTCTATCGATCCCCCTCTTTGATAGTTTAAACT – TAMRA(SEQ ID No:7) carry out the quantitative fluorescent PCR check, assay is consistent with above-mentioned LAMP methods and results.
The comparison of embodiment 3 PCR reaction and detection method sensitivity of the present invention:
LAMP detection kit by following formulation transgenic corns EVENT98140 and derived varieties thereof:
(1) primer liquid: containing 2, four primers of 5 μ M outer primers, 1,5 μ M outer primer 2,40 μ M inner primers, 1,40 μ M inner primers is:
Outer primer 1:GTCGTCGATGCATATGTGT(SEQ ID No:1)
Outer primer 2:AATTCTCGTACGTACAGCAC(SEQ ID No:2)
Inner primer 1:GTCATCCATGAGTCAACCGTGTTACCTGCTGCTGGCTTAT(SEQ ID No:3)
Inner primer 2:AGATAGTAGTAGCGGCTCGTCAAATAAGGTGGAATCAGTCGC(SEQ ID No:4)
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 8:5:2;
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l;
(4) contrast: positive control is that concentration is the DNA of 5% transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene;
(5) developer: fluorescence dye 1 * SYBR Green I.
By the following method the corn variety to be measured that is defined as transgenic corns EVENT98140 is detected with above-mentioned test kit:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purifying testing sample DNA, be diluted to 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% sample DNA respectively;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2 μ l to be checked use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and is that the DNA of 5% transgenic corns EVENT98140 or the e. coli plasmid dna that contains goal gene substitute DNA to be checked with concentration, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3) result judges: reaction tubes is placed in the turbidimeter by step reaction in (2), and the turbidity of precipitation changes to judge amplification in the observing response pipe, if precipitation then has amplification, does not have precipitation and does not then have amplification.Also can in (2), obtain adding in the product 1 μ l developer, mixing, visual inspection.The pipe of no amplified reaction presents yellow, has the pipe of amplification reflection to become green.
In the present embodiment, positive control, 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% precipitation all occurs and has been shown as amplification, and negative control does not have precipitation and is shown as the nothing amplification; After adding developer, positive control, 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% PCR pipe show green, and the negative control pipe presents yellow (see figure 3).
PCR reaction primer adopts outer primer 1 and the outer primer 2 in present method reaction.The PCR reaction is 25 μ l systems, 10 * PCR Buffer(PCR reaction buffer, Promega company) 2.5 μ l, 10mM dNTPs (Promega company) 0.5 μ l, the upstream and downstream primer is corresponding outer primer 1 and outer primer 2 respectively, each 0.5 μ l, Taq enzyme (5U/ μ l, Promega company) 0.5 μ l, dna profiling 1 μ l mends to 25 μ l with the sterilization deionized water.Response procedures is 95 ℃ of pre-sex change 5min, 95 ℃ of sex change 30s, and 58 ℃ of annealing 30s, 72 ℃ are extended 30s, and 72 ℃ are extended 7min.The PCR product is got 10 μ l and 2% agarose gel electrophoresis, 40min under the 100V voltage, and by gel imaging analysis instrument observations, corresponding band is respectively: M, DL600 DNA Marker(DNA molecular weight standard, the maximum DNA fragment is 600 base pairs); 1, positive control; 2,5%; 3,0.5%; 4,0.1%; 5,0.05%; 6,0.01%; 7,0.005%; 8, negative control.Wherein the sensitivity of PCR method is 0.05%, and 6,7 are shown as negative findings.
More as can be seen, the result of the sensitivity of test kit of the present invention can reach 0.005% concentration by two kinds of methods, and the sensitivity of PCR method is 0.05%, and 0.01% or below be shown as negative findings; Through comparison, test kit of the present invention and method sensitivity can detect the more sample of low levels apparently higher than the susceptibility of PCR method.
The experiment of embodiment 4 specificitys
With the authentication method of embodiment 1 respectively to the transgenic corns EVENT98140 of separation and purification, BT176, BT11,59122, MON810, MON88017, MON89034, MON863, GA21, MIR604, genetically engineered soybean MON89788, transgenic paddy rice BT63, transgenosis potato EH92-527-1, transgene rape T45, transgene cotton GHB614, the non-transgenic corn, paddy rice, wheat, rape, cotton is identified, simultaneously with reference to the primer DP098-f6 (forward) that detects EVENT98140 among the GMOD: GTGTGTATGTCTCTTTGCTTGGTCTT(SEQ ID No:5), DP098-r2 (reverse): GATTGTCGTTTCCCGCCTTC(SEQ ID No:6) and probe DP098-p5:-FAM – CTCTATCGATCCCCCTCTTTGATAGTTTAAACT – TAMRA(SEQ ID No:7) carry out quantitative fluorescent PCR check.
Qualification result shows: transgenic corns BT176, BT11,59122, MON810, MON88017, MON89034, MON863, GA21, MIR604, genetically engineered soybean MON89788, transgenic paddy rice BT63, transgenosis potato EH92-527-1, transgene rape T45, transgene cotton GHB614, non-transgenic corn, paddy rice, wheat, rape, cotton reaction tubes are orange, namely do not have amplification; The reaction tubes of transgenic corns EVENT98140 is green, and the amplification (see figure 4) is namely arranged.This result is consistent with the fluorescence quantitative PCR detection result among the GMOD, demonstrates good specificity.
<110〉Guangzhou enlightening Australia bio tech ltd
<120〉LAMP of transgenic corns EVENT98140 and derived varieties thereof detects primer sets, detection kit and detection
Method
<130>
<150> CN201210012313.X
<151> 2012-01-16
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213〉artificial primer
<400> 1
gtcgtcgatg catatgtgt 19
<210> 2
<211> 20
<212> DNA
<213〉artificial primer
<400> 2
aattctcgta cgtacagcac 20
<210> 3
<211> 40
<212> DNA
<213〉artificial primer
<400> 3
gtcatccatg agtcaaccgt gttacctgct gctggcttat 40
<210> 4
<211> 42
<212> DNA
<213〉artificial primer
<400> 4
agatagtagt agcggctcgt caaataaggt ggaatcagtc gc 42
<210> 5
<211> 26
<212> DNA
<213〉artificial primer
<400> 5
gtgtgtatgt ctctttgctt ggtctt 26
<210> 6
<211> 20
<212> DNA
<213〉artificial primer
<400> 6
gattgtcgtt tcccgccttc 20
<210> 7
<211> 33
<212> DNA
<213〉artificial primer
<400> 7
ctctatcgat ccccctcttt gatagtttaa act 33