CN102634592A - LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof - Google Patents
LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof Download PDFInfo
- Publication number
- CN102634592A CN102634592A CN2012101288021A CN201210128802A CN102634592A CN 102634592 A CN102634592 A CN 102634592A CN 2012101288021 A CN2012101288021 A CN 2012101288021A CN 201210128802 A CN201210128802 A CN 201210128802A CN 102634592 A CN102634592 A CN 102634592A
- Authority
- CN
- China
- Prior art keywords
- dna
- reaction
- primer
- transgenic corns
- checked
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof. The detection primer group comprises four specific primers. The detection kit comprises a primer solution, a reaction solution, DNA (deoxyribonucleic acid) polymerase, controls and a color developing agent. The detection method is characterized by comprising the following steps: extracting the DNA of the maize variety to be detected, adopting the four specific primers and the DNA polymerase with strand displacement activity to amplify the sample DNA template at 63-65 DEG C, adding SYBRGreenI to observe color change or observing change of turbidity of the precipitates in a reaction tube with a turbidity meter to judge whether the sample DNA template is amplified and determining whether the maize variety to be detected contains or is the transgenic maize BT176 and derived varieties thereof, wherein the short-time amplification efficiency can reach 109-1010 copies. The detection primer group, kit and method disclosed by the invention have the advantages of quickness, efficiency, simpleness and convenience in operation and identification, high specificity, high sensitivity, suitability for field detection and the like and are suitable for popularization and application.
Description
Technical field
The invention belongs to technical field of molecular biology, relate to the detection method of transgenic plant kind, the LAMP that is specifically related to transgenic corns BT176 and derived varieties thereof detects primer sets, detection kit and detection method.
Background technology
International Agricultural biotechnologies application service organizes " global biotechnology/genetically modified crops commercialized development situation in 2010 " report of delivering in the recent period to show; Because the huge benefits that genetically modified crops bring, nearly 100,000,000 person-times peasant made the plantation decision in past 15 years.Drop into the commercialization plantation over 15 years from genetically modified crops, global genetically modified crops cultivated area accumulative total is above 1,000,000,000 hectares.2010,1,540 ten thousand peasant plantings of 29 countries in the whole world totally 1.48 hundred million hectares genetically modified crops.From 1996 to 2010, the cultivated area of global genetically modified crops increased by 87 times.The national cultivated area of plantation genetically modified crops rank top ten has all surpassed 1,000,000 hectares first.These countries according to the big minispread of crops planting area are respectively: U.S.'s (6,680 ten thousand hectares), Brazil's (2,540 ten thousand hectares), Argentina (2,290 ten thousand hectares), India's (9,400,000 hectares), Canada's (8,800,000 hectares), China (3,500,000 hectares), Paraguay's (2,600,000 hectares), Pakistan (2,400,000 hectares), South Africa (2,200,000 hectares) and Uruguay's (1,100,000 hectares).At present, the genetically modified crops that countries in the world have been carried out field test surpass 5000 kinds, and ratifying commercial genetically modified crops has kind more than 160, comprises corn, soybean, rape, tomato, yam, pimento, pawpaw, beet, tobacco, paddy rice etc.
Transgenic corns accounts for more than 30% of whole world genetically modified crops cultivated area as one of topmost genetically modified crops in the world at present, is only second to genetically engineered soybean.The BT176 corn is the transgenic corns kind of the pest-resistant and anti-careless ammonium phosphine weedicide of Syngenta Co.,Ltd's exploitation; From nineteen ninety-five since the U.S. permits unrestricted plantation first, the Bt176 corn is at many countries and regions establishing in large scale and as food and feed widespread use.Japan (1996), Canada (1996), Argentina and each member states of European Union (1997) also successively permit unrestricted plantation subsequently, and Bt176 maize planting area constantly enlarges.Simultaneously, the U.S. (1995), Canada (1995), Japan (1996) but and states such as Britain, Denmark, Holland, Switzerland and Argentina ratify the BT176 corn respectively as food or feed resource and list marketing.
See that from world wide the popularization of transgenic corns has brought huge social and economic benefit.Yet also there are many problems in transgenic corns when bringing huge society and economic benefit; Mainly concentrate on the security of genetically modified foodGMF and to the security aspect of ecotope; Comprise the healthy risk of humans and animals; To the risk of ecotope, to the risk of nontarget organism with agricultural.To first kind of risk, 1993, United Nations's Economic development and cooperative association (OECO) proposed " substantial equivalence property " principle of food safety assessment.If the product and the traditional product of accurate gene crops production have substantial equivalence property, then can think safe.What propose the earliest genetically modified foodGMF is carried out identity management is European Union, and 1998, European Union signed first bill in the world, required transgenic product is carried out the label explanation; 1999, the non-transgenic product that requires to export to European Union must not contain 1% transgenic product pollution; 2002, minimum the limiting the quantity of that European Union will identify was reduced to 0.9%.Japan, Australia, different regulations have been done to the minimum content of transgene component by nz, and thresholding does not wait from 1～5%.
China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001; Announced agriculture genetically modified organism safety evaluation on January 5th, 2002; Sign and three supporting management ways of import security management; Confirm first and implemented the agriculture genetically modified organism catalogue of identity management, and in formal enforcement on March 20 in 2002.
In order to make comprehensive evaluation to genetically modified crops and products thereof; Except needing national governments and international body to formulate the Safety Assessment System and strict laws and regulations on the management of science; Setting up effective method system detects also very important to genetically modified crops; This is that genetically modified crops are carried out safety evaluation and the basis of implementing supervision, also is the important leverage that International Agricultural Trade develops in a healthy way.
The detection of transgenic product requires method to want fast, accurately, and sensitivity, and must consider to adapt to the large sample amount, characteristics such as the target gene kind is many.Therefore, the detection of genetically modified crops mainly is whether test sample contains exogenous protein (gene expression product) and whether contain foreign gene (DNA) at present.Foreign protein can utilize methods such as enzyme-linked immunosorbent assay (ELISA) test strip detection based on immunity principle, Western hybridization to detect in the genetically modified crops; The main matrix that from testing sample, contains target protein according to the certain procedure extracting; Utilize and target protein (antigen) specificity bonded characteristic; Effect through coupling antibody and immune complex produces detectable signal; But this method requires the antibody of high quality high stability, otherwise because of accuracy is not enough, can only be as the auxiliary detection means.The nucleic acid detection method of genetically modified crops mainly contains two kinds: making nucleic acid molecular hybridization technology (Sourthernblot), PCR detection technique.Wherein the PCR detection method is main, most accurately detects the method for genetically modified crops, comprises the qualitative PCR method, meets PCR method, nested PCR method, competitive quantifying PCR method, fluorescence quantifying PCR method or the like.
At present, what promote the use of both at home and abroad is qualitative PCR and real-time quantitative PCR detection method: the ultimate principle of round pcr is similar to the natural reproduction process of DNA, and its specificity depends on and target sequence two ends complementary Oligonucleolide primers.Effect through polysaccharase; In the external purpose fragment that increases specifically fast, trace, specific purpose dna fragmentation were increased rapidly in several hours 1,000,000 times, amplified production is through agarose gel electrophoresis; Be easy to behind the ethidium bromide staining observe, thereby have advantage such as rapid sensitive.Yet PCR method reaction system and operating process more complicated need the professional; Required PCR appearance price about 50,000 yuan, proliferation time 2～3 hours, the electrophoresis time of amplification needs about 1 hour; Electrophoresis common dyes EB is a strong carcinogen, and strong toxicity is arranged, and is difficult to carry out on-the-spot the detection.So, in scientific research and production practice, all need a kind of fast and convenient, operation accurately, universal, safe and reliable and be applicable to the genetically modified crops detection method of execute-in-place easily.
Ring mediated isothermal gene amplification technology (Loop-Mediated Isothermal Amplification; Hereinafter to be referred as the LAMP method) be the gene amplification technology that Japanese Eiken Chemical developed before and after 2000; It has fast and convenient, operation accurately, popularize easily, safe and reliable advantage, the test kit that the LAMP method is applied to rapid detection transgenic corns BT176 and derived varieties thereof is not arranged at present as yet.
Summary of the invention
One object of the present invention is to provide the LAMP of a kind of transgenic corns BT176 and derived varieties thereof to detect primer sets.
Another object of the present invention is to provide the LAMP detection kit of a kind of transgenic corns BT176 and derived varieties thereof.
It is a kind of based on the transgenic corns BT176 of above-mentioned detection primer sets and detection kit and the constant temperature gene amplification detection method (LAMP) of derived varieties thereof that another object of the present invention is to provide.
The technical scheme that the present invention adopted is following:
The LAMP of transgenic corns BT176 and derived varieties thereof detects primer sets, comprises outer primer 1 and outer primer 2, inner primer 1 and inner primer 2, and its nucleotide sequence is as follows respectively:
Outer primer 1:TGGACTTCAGCCTGCCG (SEQ ID No:1);
Outer primer 2:GTGGGAGGGAGAACTCCG (SEQ ID No:2);
Inner primer 1:AGGCCATTGATGGCGTGCATTCCTGCCCGTCACCGA (SEQ ID No:3);
Inner primer 2:AAGCCTTGGCCGACCGTTTCTCTGGGCGTGGTATCGACTT (SEQ ID No:4).
The LAMP detection kit of transgenic corns BT176 and derived varieties thereof comprises following composition:
(1) primer liquid: contain above-mentioned primer sets, concentration is respectively 4～6 μ M outer primers, 1,4～6 μ M outer primers, 2,32～48 μ M inner primers, 1,32～48 μ M inner primers 2;
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 7～9:4～6:2;
(3) archaeal dna polymerase: concentration is 7～9U/ μ l;
(4) contrast: positive control is the DNA of transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene.
Preferably, contain 5 μ M outer primers, 1,5 μ M outer primers, 2,40 μ M inner primers, 1,40 μ M inner primers 2 in the said primer liquid.
Preferably, said archaeal dna polymerase is the Bst archaeal dna polymerase, and concentration is 8U/ μ l.
Preferably, in the said reaction solution, 10mM dNTP:10 * ThermoPol reaction buffer: the volume ratio of 150mM MgSO4 is 8:5:2.
Can also contain developer in the LAMP detection kit of transgenic corns BT176 of the present invention and derived varieties thereof, said developer is optical dye SYBRGreen I.
Utilize above-described LAMP detection kit to detect the method for transgenic corns BT176 and derived varieties thereof, comprise the steps:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purification of samples DNA;
(2) constant temperature gene amplification reaction: in the PCR pipe, prepare reaction system: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2～5 μ l to be checked use sterilization deionized water polishing to 25 μ l; In positive control when reaction, be set, substitute DNA to be checked with the DNA of transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3) result judges: change through sedimentary turbidity in the observing response pipe and judge amplification.
In test kit, contain under the situation of developer, in the product that (2) obtain, add 1～2 μ l developer, mixing, the result judges amplification according to colour developing.
Wherein, the method for CTAB method extraction transgenic corns BT176 DNA is:
(1) get the about 100mg of transgenic corns BT176, put into mortar, add a small amount of liquid nitrogen and grind rapidly, liquid nitrogen adds 3～4 times repeatedly, is milled to till the powder;
(2) add 1.5ml and be preheated to 65 ℃ CTAB and extract damping fluid, thorough mixing, suspension sample, 65 ℃ of child care 30min, during do not stop to put upside down mixing;
(3) the centrifugal 10min of about 12000g.Shift the new centrifuge tube of supernatant to, add the phenol of 1 times of volume: chloroform: primary isoamyl alcohol (25:24:1), thorough mixing, the centrifugal 15min of about 12000g.Shift in the new centrifuge tube of supernatant to;
(4) chloroform of 1 times of volume of adding: primary isoamyl alcohol (24:1), thorough mixing, the centrifugal 15min of about 12000g.Shift in the new centrifuge tube of supernatant to;
(5) the CTAB precipitation buffering liquid of 2 times of volumes of adding, room temperature leaves standstill child care 60min; The centrifugal 15min of 12000g abandons supernatant; Add 350 μ l sodium chloride solution dissolution precipitations; The centrifugal 10min of 12000g shifts the new centrifuge tube of supernatant to;
(6) add 0.6 times of volume Virahol, be inverted centrifuge tube and softly mix, room temperature is placed 20min, and the centrifugal 15min of 12000g abandons supernatant, adds 500 μ l70% ethanolic solns, and puts upside down centrifuge tube for several times, and the centrifugal 10min of 12000g abandons supernatant;
(7) the dry DNA deposition adds 100 μ lTE damping fluid dissolving DNAs.
The present invention is based on loop-mediated isothermal amplification technique (LAMP method); According to six isolated areas on four primers ability specific recognition target-gene sequences of target gene design; Start the endless chain replacement(metathesis)reaction; Start complementary strand in target DNA district synthetic, and the result goes round and begins again on same chain and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.Adopt 4 Auele Specific Primers and a kind of to have the active archaeal dna polymerase of strand displacement; At 63～65 ℃ nucleic acid is carried out amplified reaction; Reaction needs is carried out under constant temperature; Reaction times is according to the template DNA quality change, is generally 90min or still less, amplification efficiency can reach 10 in the short period of time of 60～90min
9～10
10Individual copy number.Add template DNA, behind 63～65 ℃ of reaction 60～90min, in 80 ℃ of preservation 2min, termination reaction.The advantage of this technology is not need thermal cycling, and because amplification is under constant temperature, to carry out, does not therefore need expensive instruments such as PCR appearance.In reaction, when nucleic acid is synthetic in a large number, Mg ionic bond the pyrophosphate ion of separating out from dNTP and the reaction soln, the white precipitate of generation by product magnesium pyrophosphate.
The present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, evaluation are easy, be fit to beneficial effect such as on-the-spot detection:
(1) rapidly and efficiently: whole amplification only can be accomplished with 60～90min, and amplification output can reach 10
9～10
10Individual copy;
(2) easy and simple to handle: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the loaded down with trivial details steps such as sex change of double-stranded DNA, only need a steady temperature appearance just to react and detect, condition is relatively gentleer;
(3) high specific: the present invention has designed four Auele Specific Primers according to foreign gene and the native gene junction of transgenic corns BT176; Use above-mentioned four primers; 6 zones of amplified target sequence have very strong strain specificity, and highly stable; It is low to form the primer dimer probability, has guaranteed that successful reaction carries out;
(4) highly sensitive: the lowest detection limit can reach 10 copies;
Whether (5) evaluation is easy: can add SYBR Green I colour-change or exist magnesium pyrophosphate to precipitate whether judge amplification through observing, need not other any analytical procedures such as electrophoresis, suitable on-the-spot the detection.
Description of drawings
Fig. 1 is the detected result figure (1-4: sample to be checked of embodiment 1; 5: positive control; 6: negative control);
Fig. 2 is the detected result figure (1,2: sample to be checked of embodiment 2; 3: negative control, 4: positive control);
Fig. 3 is that (1-6 is followed successively by: 0.5%, 0.1%, 005%, 0.01%, 0.005% sample DNA 5%,, 7: negative control: 8: positive control) for the detected result figure of embodiment 3;
Fig. 4 is that (1-20 is followed successively by: transgenic corns BT176, BT11, Event98140,59122, MON810, MON88017, MON89034, MON863, GA21, MIR604 for the detected result figure of embodiment 4; Genetically engineered soybean MON89788; Transgenic paddy rice BT63, transgenic potato EH92-527-1, transgene rape T45; Transgene cotton GHB614, non-transgenic corn, paddy rice, wheat, rape, cotton).
Embodiment
Below in conjunction with embodiment the present invention is further described, but is not limited thereto.
The foregoing description is a preferred implementation of the present invention; But embodiment of the present invention is not restricted to the described embodiments; Other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; All should be the substitute mode of equivalence, be included within protection scope of the present invention.
As do not have specified otherwise, " % " in following examples all refers to mass percent.
Embodiment 1 contains the test kit and the detection method of developer:
The LAMP detection kit of transgenic corns BT176 and derived varieties thereof comprises primer liquid, reaction solution, archaeal dna polymerase, contrast and developer:
(1) primer liquid: containing 2, four primers of 5 μ M outer primers, 1,5 μ M outer primer 2,40 μ M inner primers, 1,40 μ M inner primers is:
Outer primer 1:TGGACTTCAGCCTGCCG (SEQ ID No.1)
Outer primer 2:GTGGGAGGGAGAACTCCG (SEQ ID No.2)
Inner primer 1:AGGCCATTGATGGCGTGCATTCCTGCCCGTCACCGA (SEQ ID No.3)
Inner primer 2:AAGCCTTGGCCGACCGTTTCTCTGGGCGTGGTATCGACTT (SEQ ID No.4)
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 8:5:2;
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l;
(4) contrast: positive control is that concentration is the DNA of 5% transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene;
(5) developer: optical dye 1 * SYBR Green I.
Corn variety seeds to be measured is detected by following method with above-mentioned test kit:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purifying testing sample DNA;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2 μ l to be checked use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is that the DNA of 5% transgenic corns BT176 or the e. coli plasmid dna that contains goal gene substitute DNA to be checked, when the negative control reaction is set, substitutes DNA to be checked with the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3) result judges: in above-mentioned reaction tubes, add 2 μ l developers, mixing is if shows green is then positive, orange then negative.
In the present embodiment, negative control manifests orange, the positive control shows green; The PCR of testing sample 1,2 pipe shows green (managing 1,2 among Fig. 1), shows to contain in the corn seed sample 1,2 to be measured or all be transgenic corns BT176 and derived varieties thereof; Contain transgenic corns BT176 composition; The PCR pipe of testing sample 3,4 shows orange (managing 3,4 among Fig. 1), shows not contain transgenic corns BT176 composition in the testing sample 3,4.
With reference to the primer Bt176 F:GGCCGTGAACGAGCTGTT (SEQ ID No.5) among the EU Reference Laboratory for GM Food and Feed; Bt176 R:GGGAAGAAGCCTACATGTTTTCTAA (SEQ ID No.6) and probe Bt176 Probe:FAM-AGCAACCAGATCGGCCGACACC-TAMRA (SEQ ID No.7) carry out the quantitative fluorescent PCR check, and assay and above-mentioned LAMP methods and results are consistent.
The developer in the test kit in lacking embodiment 1, all the other are with embodiment 1.
Corn variety to be measured is detected by following method with above-mentioned test kit:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purifying testing sample DNA;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2 μ l to be checked use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is that the DNA of 5% transgenic corns BT176 or the e. coli plasmid dna that contains goal gene substitute DNA to be checked, when the negative control reaction is set, substitutes DNA to be checked with the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3) result judges: reaction tubes is placed in the turbidimeter by step reaction in (2), and sedimentary turbidity changes and judges amplification in the observing response pipe, if deposition is then positive, it is then negative not have deposition.
In the present embodiment; Negative control does not have deposition, and positive control produces deposition, and deposition (Fig. 2 pipe 1) appears in the PCR pipe of testing sample 1; Show and contain in the corn seed sample 1 to be checked or be transgenic corns BT176 and derived varieties thereof all, contain transgenic corns BT176 composition.Deposition (Fig. 2 pipe 2) does not appear in the PCR pipe of testing sample 2, shows not contain transgenic corns BT176 composition in the sample 2 to be checked.
With reference to the primer Bt176 F:GGCCGTGAACGAGCTGTT (SEQ ID No.5) among the EU Reference Laboratory for GM Food and Feed; Bt176 R:GGGAAGAAGCCTACATGTTTTCTAA (SEQ ID No.6) and probe Bt176 Probe:FAM-AGCAACCAGATCGGCCGACACC-TAMRA (SEQ ID No.7) carry out the quantitative fluorescent PCR check, and assay and above-mentioned LAMP methods and results are consistent.
The comparison of embodiment 3 PCR reaction and detection method sensitivity of the present invention:
LAMP detection kit by following formulation transgenic corns BT176 and derived varieties thereof:
(1) primer liquid: containing 2, four primers of 5 μ M outer primers, 1,5 μ M outer primer 2,40 μ M inner primers, 1,40 μ M inner primers is:
Outer primer 1:TGGACTTCAGCCTGCCG (SEQ ID No:1)
Outer primer 2:GTGGGAGGGAGAACTCCG (SEQ ID No:2)
Inner primer 1:AGGCCATTGATGGCGTGCATTCCTGCCCGTCACCGA (SEQ ID No:3)
Inner primer 2:AAGCCTTGGCCGACCGTTTCTCTGGGCGTGGTATCGACTT (SEQ ID No:4)
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 8:5:2;
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l;
(4) contrast: positive control is that concentration is the DNA of 5% transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene;
(5) developer: optical dye 1 * SYBR Green I.
The testing sample of confirming as transgenic corns BT176 is detected by following method with above-mentioned test kit:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purifying testing sample DNA, be diluted to 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% sample DNA respectively;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2 μ l to be checked use sterilization deionized water polishing to 25 μ l; Positive control when reaction is set, and using concentration is that the DNA of 5% transgenic corns BT176 or the e. coli plasmid dna that contains goal gene substitute DNA to be checked, when the negative control reaction is set, substitutes DNA to be checked with the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3) result judges: reaction tubes is placed in the turbidimeter by step reaction in (2), and sedimentary turbidity changes and judges amplification in the observing response pipe, if deposition then has amplification, does not have deposition and does not then have amplification.Also can in (2), obtain adding in the product 1 μ l developer, mixing, visual inspection.The pipe of no amplified reaction presents yellow, has the pipe of amplified reaction to become green.
In the present embodiment, positive control, 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% deposition all occurs and has been shown as amplification, and negative control does not have deposition, does not promptly have amplification; After adding developer, positive control, 5%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005% PCR pipe show green, and the negative control pipe presents yellow (see figure 3).
PCR reaction primer adopts outer primer 1 and outer primer 2 in present method reaction.The PCR reaction is 25 μ l systems, 10 * PCR Buffer (PCR reaction buffer, Promega company), 2.5 μ l; 10mM dNTPs (Promega company) 0.5 μ l, the respectively corresponding outer primer 1 of upstream and downstream primer and outer primer 2, each 0.5 μ l; Taq enzyme (5U/ μ l; Promega company) 0.5 μ l, dna profiling 1 μ l mends to 25 μ l with the sterilization deionized water.Response procedures is 95 ℃ of preparatory sex change 5min, 95 ℃ of sex change 30s, and 58 ℃ of annealing 30s, 72 ℃ are extended 30s, and 72 ℃ are extended 7min.The PCR product is got 10 μ l and 2% agarose gel electrophoresis, 40min under the 100V voltage, and through gel imaging analysis appearance observations, corresponding band is respectively: M, DL600 DNA Marker (dna molecular amount standard, maximum DNA fragment are 600 base pairs); 1, positive control; 2,5%; 3,0.5%; 4,0.1%; 5,0.05%; 6,0.01%; 7,0.005%; 8, negative control.Wherein the sensitivity of PCR method is 0.05%, and 6,7 are shown as negative findings.
Can find out relatively that by two kinds of methods the result of the sensitivity of test kit of the present invention can reach 0.005% concentration, and the sensitivity of PCR method is 0.05%, and 0.01% or below be shown as negative findings; Through comparison, test kit of the present invention and method sensitivity can detect the more sample of low levels apparently higher than the susceptibility of PCR method.
The experiment of embodiment 4 specificitys
With the authentication method of embodiment 1 respectively to transgenic corns BT176, BT11, Event98140,59122, MON810, MON88017, MON89034, MON863, GA21, the MIR604 of separation and purification; Genetically engineered soybean MON89788; Transgenic paddy rice BT63; Transgenic potato EH92-527-1; Transgene rape T45, transgene cotton GHB614, non-transgenic corn, paddy rice, wheat, rape, cotton are identified; With reference to the primer Bt176 F:GGCCGTGAACGAGCTGTT (SEQ ID No.5) among the EU Reference Laboratory for GM Food and Feed, Bt176 R:GGGAAGAAGCCTACATGTTTTCTAA (SEQ ID No.6) and probe Bt176 Probe:FAM-AGCAACCAGATCGGCCGACACC-TAMRA (SEQ ID No.7) carry out the quantitative fluorescent PCR check simultaneously.
Qualification result shows: transgenic corn BT 11, Event98140,59122, MON810, MON88017, MON89034, MON863, GA21, MIR604; Genetically engineered soybean MON89788, transgenic paddy rice BT63, transgenic potato EH92-527-1; Transgene rape T45; Transgene cotton GHB614, non-transgenic corn, paddy rice, wheat, rape, cotton reaction tubes are orange, promptly do not have amplification; The reaction tubes of transgenic corns BT176 is green, and the amplification (see figure 4) is promptly arranged.This result is consistent with the quantitative fluorescent PCR reaction result among the EU Reference Laboratory for GM Food and Feed, demonstrates good specificity.
< 110>Guangzhou enlightening Australia bio tech ltd
< 120>LAMP of transgenic corns BT176 and derived varieties thereof detects primer sets, test kit and detection method
<130>
<150> CN201210012283.2
<151> 2012-01-16
<160> 7
<170> PatentIn?version?3.5
<210> 1
<211> 17
<212> DNA
< 213>artificial primer
<400> 1
tggacttcag?cctgccg 17
<210> 2
<211> 18
<212> DNA
< 213>artificial primer
<400> 2
gtgggaggga?gaactccg 18
<210> 3
<211> 36
<212> DNA
< 213>artificial primer
<400> 3
aggccattga?tggcgtgcat?tcctgcccgt?caccga 36
<210> 4
<211> 40
<212> DNA
< 213>artificial primer
<400> 4
aagccttggc?cgaccgtttc?tctgggcgtg?gtatcgactt 40
<210> 5
<211> 18
<212> DNA
< 213>artificial primer
<400> 5
ggccgtgaac?gagctgtt 18
<210> 6
<211> 25
<212> DNA
< 213>artificial primer
<400> 6
gggaagaagc?ctacatgttt?tctaa 25
<210> 7
<211> 22
<212> DNA
< 213>artificial primer
<400> 7
agcaaccaga?tcggccgaca?cc 22
Claims (8)
1. the LAMP of transgenic corns BT176 and derived varieties thereof detects primer sets, comprises outer primer 1 and outer primer 2, inner primer 1 and inner primer 2, and its nucleotide sequence is as follows respectively:
Outer primer 1:TGGACTTCAGCCTGCCG (SEQ ID No:1);
Outer primer 2:GTGGGAGGGAGAACTCCG (SEQ ID No:2);
Inner primer 1:AGGCCATTGATGGCGTGCATTCCTGCCCGTCACCGA (SEQ ID No:3);
Inner primer 2:AAGCCTTGGCCGACCGTTTCTCTGGGCGTGGTATCGACTT (SEQ ID No:4).
2. the LAMP detection kit of transgenic corns BT176 and derived varieties thereof comprises following composition:
(1) primer liquid: contain the described primer sets of claim 1, concentration is respectively 4～6 μ M outer primers, 1,4～6 μ M outer primers, 2,32～48 μ M inner primers, 1,32～48 μ M inner primers 2;
(2) reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 7～9:4～6:2;
(3) archaeal dna polymerase: concentration is 7～9U/ μ l;
(4) contrast: positive control is the DNA of transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, and negative control is not for containing the reaction mixture of goal gene.
3. the LAMP detection kit of transgenic corns BT176 according to claim 2 and derived varieties thereof is characterized in that: contain 5 μ M outer primers, 1,5 μ M outer primers, 2,40 μ M inner primers, 1,40 μ M inner primers 2 in the said primer liquid.
4. the LAMP detection kit of transgenic corns BT176 according to claim 2 and derived varieties thereof is characterized in that: said archaeal dna polymerase is the Bst archaeal dna polymerase, and concentration is 8U/ μ l.
5. the LAMP detection kit of transgenic corns BT176 according to claim 2 and derived varieties thereof is characterized in that: in the said reaction solution, 10mM dNTP:10 * ThermoPol reaction buffer: the volume ratio of 150mM MgSO4 is 8:5:2.
6. utilize each described test kit of claim 2～5 to detect the method for transgenic corns BT176 and derived varieties thereof, comprise the steps:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purification of samples DNA;
(2) constant temperature gene amplification reaction: in the PCR pipe, prepare reaction system: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2～5 μ l to be checked use sterilization deionized water polishing to 25 μ l; In positive control when reaction, be set, substitute DNA to be checked with the DNA of transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3) result judges: change through sedimentary turbidity in the observing response pipe and judge amplification.
7. according to each described LAMP detection kit of claim 2～5, it is characterized in that: also contain developer, said developer is optical dye SYBRGreen I.
8. utilize the described test kit of claim 7 to detect the method for transgenic corns BT176 and derived varieties thereof, comprise the steps:
(1) extraction of sample DNA to be checked: adopt the CTAB method to extract purification of samples DNA;
(2) constant temperature gene amplification reaction: prepare reaction system at 200ul PCR pipe: primer liquid 1 μ l, reaction solution 12.5 μ l, archaeal dna polymerase 1 μ l, DNA 2～5 μ l to be checked use sterilization deionized water polishing to 25 μ l; In positive control when reaction, be set, substitute DNA to be checked with the DNA of transgenic corns BT176 or the e. coli plasmid dna that contains goal gene, when the negative control reaction is set, with the alternative DNA to be checked of the reaction mixture that does not contain goal gene; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3) result judges: in above-mentioned reaction tubes, add 1～2 μ l developer, and mixing, the result judges amplification according to colour developing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210128802.1A CN102634592B (en) | 2012-01-16 | 2012-04-28 | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210012283 | 2012-01-16 | ||
| CN201210012283.2 | 2012-01-16 | ||
| CN201210128802.1A CN102634592B (en) | 2012-01-16 | 2012-04-28 | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102634592A true CN102634592A (en) | 2012-08-15 |
| CN102634592B CN102634592B (en) | 2014-01-08 |
Family
ID=46619166
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210128802.1A Active CN102634592B (en) | 2012-01-16 | 2012-04-28 | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102634592B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816859A (en) * | 2012-09-07 | 2012-12-12 | 徐君怡 | Loop-mediated isothermal amplification (LAMP) primer, kit and application of kit for T25 strain of transgenic maize |
| CN102827939A (en) * | 2012-09-07 | 2012-12-19 | 徐君怡 | Loop-mediated isothermal amplification (LAMP) primer of genetically modified maize BT11 strain, reagent kit and application of LAMP primer |
| CN105132420A (en) * | 2015-09-23 | 2015-12-09 | 北京市农林科学院 | Complete set of primers for identifying purity of maize varieties and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302565A (en) * | 2008-06-30 | 2008-11-12 | 天津市农业科学院中心实验室 | Method for rapid detecting transgenic maize BT176 |
-
2012
- 2012-04-28 CN CN201210128802.1A patent/CN102634592B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302565A (en) * | 2008-06-30 | 2008-11-12 | 天津市农业科学院中心实验室 | Method for rapid detecting transgenic maize BT176 |
Non-Patent Citations (1)
| Title |
|---|
| 兰青阔: "环状等温扩增技术快速检测转基因玉米MON863的研究", 《玉米科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816859A (en) * | 2012-09-07 | 2012-12-12 | 徐君怡 | Loop-mediated isothermal amplification (LAMP) primer, kit and application of kit for T25 strain of transgenic maize |
| CN102827939A (en) * | 2012-09-07 | 2012-12-19 | 徐君怡 | Loop-mediated isothermal amplification (LAMP) primer of genetically modified maize BT11 strain, reagent kit and application of LAMP primer |
| CN105132420A (en) * | 2015-09-23 | 2015-12-09 | 北京市农林科学院 | Complete set of primers for identifying purity of maize varieties and application |
| CN105132420B (en) * | 2015-09-23 | 2018-02-13 | 北京市农林科学院 | A kind of primer set for identifying corn variety purity and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102634592B (en) | 2014-01-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102634593B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
| CN102634588B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof | |
| CN102634591B (en) | Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof | |
| CN103642918B (en) | LAMP (Loop-Mediated Isothermal Amplification) rapid detection method and application of glyphosate-resist transgenic soybean | |
| CN101775440A (en) | Plasmid control molecule for detection of transgenic soybean and building method thereof | |
| CN101225435A (en) | Method for quickly detecting transgenic soybean | |
| CN102649976B (en) | LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method | |
| CN102634592B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof | |
| CN104513861B (en) | LAMP detection primer group, detection kit and the detection method of genetically engineered soybean MON89788 and its derived varieties | |
| CN101302565B (en) | Method for rapid detecting transgenic maize BT176 | |
| CN104726582A (en) | Probe method based constant temperature detection primer group, detection kit and detection method of genetically modified soybeans MON89788 | |
| CN102634590B (en) | LAMP (Loop-Mediated Isothermal Amplification) detection primer group, detection kit and detection method of transgenic soybean A5547-127 and derived varieties thereof | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN102134602A (en) | Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof | |
| CN103773867A (en) | LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method | |
| CN102634589B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof | |
| CN102766624A (en) | Primer group, kit and method for detecting specific sequence of genetically modified organism corn Bt176 transformant | |
| CN102134603A (en) | Primer, probe, test kit and method for testing genetically modified rice or products thereof | |
| CN103509875A (en) | Detection of CaMV 35S promoter and nos terminator by adopting RPA (Recombinase Ploymerase Amplification) technology | |
| CN103060460A (en) | Primer, kit and method for detecting transgenic rice containing NOS (Nitric Oxide Synthase) terminator | |
| CN104726580B (en) | A kind of transgenic corns MON810 constant temperature probe method detection primer group, detection kit and detection method | |
| CN104894280A (en) | Primer, kit and method for detecting transgenic maize NOS terminator | |
| CN110643734A (en) | RPA primer and probe combination, kit and detection method of transgenic corn DAS-40278-9 | |
| CN109628632A (en) | A kind of primer combination, probe, kit and method for transgenic corns MON87419 event-specific detection | |
| CN102876800A (en) | Quantitative detection method of phytase gene in transfer phytase gene corn or feed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: THE INSPECTION AND QUARANTINE TECHNOLOGY CENTER OF Effective date: 20121214 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20121214 Address after: 510663 innovation building, 182 science Avenue, Science City, Guangdong, Guangzhou C2-1303 Applicant after: Guangzhou Deaou Biotechnology Co., Ltd. Applicant after: Guangdong Inspection & Quarantine Technology Center of Guangdong Entry-Exit Inspection & Quarantine Bureau Address before: 510663 innovation building, 182 science Avenue, Science City, Guangdong, Guangzhou C2-1303 Applicant before: Guangzhou Deaou Biotechnology Co., Ltd. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |