CN103849676A - Specific primer and liquid phase chip for detecting CCDC26 gene mutation - Google Patents

Specific primer and liquid phase chip for detecting CCDC26 gene mutation Download PDF

Info

Publication number
CN103849676A
CN103849676A CN201210513280.7A CN201210513280A CN103849676A CN 103849676 A CN103849676 A CN 103849676A CN 201210513280 A CN201210513280 A CN 201210513280A CN 103849676 A CN103849676 A CN 103849676A
Authority
CN
China
Prior art keywords
seq
site
sequence
ccdc26
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201210513280.7A
Other languages
Chinese (zh)
Other versions
CN103849676B (en
Inventor
刘志明
林丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201210513280.7A priority Critical patent/CN103849676B/en
Publication of CN103849676A publication Critical patent/CN103849676A/en
Application granted granted Critical
Publication of CN103849676B publication Critical patent/CN103849676B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a liquid phase chip and a specific primer for detecting CCDC26 gene mutation. The liquid phase chip mainly comprises: ASPE primers, microspheres coated by different anti-tag sequences, and an amplification primer, wherein each ASPE primer is composed of a tag sequence at a 5' end and specific primer sequences at a 3' end and aiming at target gene mutation sites, and the specific primer sequences are as follows: SEQ ID NO.11 and SEQ ID NO.12 aiming at an A231C site, SEQ ID NO.13 and SEQ ID NO.14 aiming at an T144G site, SEQ ID NO.15 and SEQ ID NO.16 aiming at a A100G site, SEQ ID NO.17 and SEQ ID NO.18 aiming at a T90C site, and/or SEQ ID NO.19 and SEQ ID NO.20 aiming at a G75A site. The coincidence rate of the detection result of the detection liquid phase chip disclosed by the invention with that of a sequencing method reaches as high as 100%, and parallel detection of a wild type and a mutant of a plurality of mutation sites is achieved.

Description

CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of CCDC26 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
Containing coiled coil territory 26(coiled-coil domain containing26, CCDC26) be positioned on No. 8 karyomit(e) 8q24.21, the dependency that has of the sudden change occurring on No. 8 karyomit(e) 8q24.21 and a lot of tumours, these tumours comprise knot rectum, mammary gland, bladder and prostate cancer, glioblastoma, oligodendrocyte and astrocytoma etc.CCDC26 coding tretinoin modulin, research report tretinoin can be by lowering the activity inducement glioblastoma multiforme apoptosis of Telomerase.
At present, CCDC26 detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology and ground substance assistant laser desorption ionization time-of-fight mass spectrometry technology (MALDI-TOF-MS), although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, be difficult to meet the needs of practical application, ground substance assistant laser desorption ionization time-of-fight mass spectrometry technology is a kind of soft ionization technology, in the detection of protein and other, there is powerful and ripe function, but in detection of nucleic acids field, due to the singularity of nucleic acid molecule itself, detection is subject to certain restrictions.
The CCDC26 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of CCDC26 gene point mutation Write a Chinese character in simplified form
1 , there is A → C sudden change in the 231st Nucleotide of SEQ ID NO.49 A231C
2 , there is T → G sudden change in the 144th Nucleotide of SEQ ID NO.50 T144G
3 , there is A → G sudden change in the 100th Nucleotide of SEQ ID NO.51 A100G
4 , there is T → C sudden change in the 90th Nucleotide of SEQ ID NO.52 T90C
5 , there is G → A sudden change in the 75th Nucleotide of SEQ ID NO.53 G75A
SEQ ID NO.49 mutational site: A231C
TAGAAACAGTCCTCACTTGGCAATCTGGTTTCCTAAGACATAGCAGATTAGATACAGAAAATTTTAAAAGTGTGAAGAGGAAGGGGCTGCAAGGTTTTGCTCAGGCAAGCTGCATAAAATCCAGAGAGCCTGGCAGACAACAACTAGCAAGAAGTAGAGAAGACTCAGTAGGTGCCAAGCTTCTGGCATTCTGTGCAAGGACAATAGTGTATGATAGCTCAGTAGTTCCC
Figure BDA00002522267800011
TGGCTTTTGCAGTGTAATTAATAATGACCCTTGGTCACTGAACAAGACTAAAATTATGTCTTAATATCTCAGTTTACAAAGATAAGAGAGGTGAGACACTTTTCCTTCC
SEQ ID NO.50 mutational site: T144G
CTCAAACTTCCTCATGGACTAAGCAGATTATGTTAATGAGTGAAGATTAAACCAGTTGACTTGGGATCCTTCTGGTATATTGCAATACATTCTGGGGTCACCCAATCCTTGCTACATTCCCCCATTTTTTTCCAGACACTGAG
Figure BDA00002522267800021
CTGTGTATTGCTGTACTGCAATAATGACCAGTGTTTCCAGAGCTTACAATCTTTCAATAAAAAACAGAATTCCAAAATGTTATATGATATATTCCAATTTTTAAATGCTATGAGTCAAATTTAGCCAGTAGCTGAGCTAATAACCTCTGGCTTAATAATGCTAACATCATAAGGAAATTTCTAACACCAAGGGAAGATTATTTTGATGGTGGC
SEQ ID NO.51 mutational site: A100G
CTGGAGTTTTGGTAGAGTTGACCTAAGATCCTTTGCTTCTCATATGGTAGAGATTGCTGGGTGTCCCACCCAGTCTTTCTGAGAACAACCCAGTTAGAC
Figure BDA00002522267800022
TAATGATTTAGAAAAACCCAGGGTTTTTTGATGTCTAATTGATTGATGATTGATGTCTCATGTGGGACATGGGTGGTTCTTTAACATTTTCAAGCACAATTATGTATGTGCATTGGCTGTAACCCATATAAAGTTCAGATCACCTGAACAGAAATGGAGACAAATAAGAGAGTTTAATAAAATAAAGACTTCAAAAATATTACTCATGGAGTCTATGCATACACATATGCAGACTCTCAATTAGGAGAGAACCAGAAGGAACTG
SEQ ID NO.52 mutational site: T90C
TGCTATGCTGTAACCATTATGTGCTGTTTTGTCCCCTGACAGCTATTTTTTTCTTTCATTTAATCCTTCCAACAACACCCTGAGCAGTA
Figure BDA00002522267800023
TGTCAGCATTCTATTTTGCTAGAGAAAAGCTGAGGCACAGAGGAGTGGCTTACTGTGGCCACGTGGCTCACAGTACCAGAGCATTCTCACCTTGAACCTTGCTACTTGAGCCTGGGGAGTTTCCTAGGCCCCCTGACATGGTCCAGTGGAGGCCACCTTGAACACTTTGGAGATGCTTAGGTTCAGA
SEQ ID NO.53 mutational site: G75A
ACCATGTCCCAATTTGTACGCACCCCAGATCCAGCTTTTGAAATAAAGAGGGACTTTGGTTACAAAACTCTGAT
Figure BDA00002522267800024
GCACTTGATTTTAGTAGCAAGAGCAAAATGTTTCCATATTAGCTTTGCTATTAGCTTACGGTGCTACCTTCACCAAGTCACTTCCCATCTCTGGGCCTCACTTTCTTCATCCAAATGAGGAATTGGACTCGTTGATTTCATGGATTCATTCGAGTATCTACCACTTAGTAAGAACTGGCGCTGTCTGAGAGATTTTTATCTCTAATACTCACTGCAGAGAACTGAGTCTCAGCAAGGTTAAGTCTGGGTTCAAACCCCAGTCTGTGTAACAATAC。
Summary of the invention
One of object of the present invention is to provide CCDC26 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of parallel detection CCDC26 gene five kinds of common genotype A231C, T144G, A100G, T90C and G75A.
A kind of CCDC26 gene mutation detection liquid-phase chip, includes:
(A). the wild-type designing respectively for the different mutational sites of CCDC26 gene and the ASPE primer pair of saltant type: every ASPE primer is made up of for the specific primer sequence in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQ ID NO.11 and the SEQ ID NO.12 in A231C site, for SEQ ID NO.13 and the SEQ ID NO.14 in T144G site, for SEQ ID NO.15 and the SEQ ID NO.16 in A100G site, for SEQ ID NO.17 and the SEQ ID NO.18 in T90C site, and/or for SEQ ID NO.19 and the SEQ ID NO.20 in G75A site, described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.10,
(B). there is microballoon that different anti-tag sequences are coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.21～SEQ ID NO.30, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding mutational site.
Therein in an embodiment, described amplimer is: for SEQ ID NO.31 and the SEQ ID NO.32 in A231C site, for SEQ ID NO.33 and the SEQ ID NO.34 in T144G site, for SEQ ID NO.35 and the SEQ ID NO.36 in A100G site, for SEQ ID NO.37 and the SEQ ID NO.38 in T90C site, and/or for SEQ ID NO.39 and the SEQ ID NO.40 in G75A site.
Therein in an embodiment, described ASPE primer is for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.11 in A231C site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.12, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.13 in T144G site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.14, for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.15 in A100G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.16, for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.17 in T90C site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.18, and/or for the sequence being formed by SEQ ID NO.9 and SEQ ID NO.19 in G75A site and the sequence that formed by SEQ ID NO.10 and SEQ ID NO.20.
Another object of the present invention is to provide the Auele Specific Primer for CCDC26 detection in Gene Mutation.
The technical scheme that realizes this object is as follows.
For the Auele Specific Primer of CCDC26 detection in Gene Mutation, described Auele Specific Primer is for the SEQ ID NO.11 in A231C site and SEQ ID NO.12, for SEQ ID NO.13 and the SEQ ID NO.14 in T144G site, for SEQ ID NO.15 and the SEQ ID NO.16 in A100G site, for SEQ ID NO.17 and the SEQ ID NO.18 in T90C site, and/or for SEQ ID NO.19 and the SEQ ID NO.20 in G75A site.
Major advantage of the present invention is:
1. the detected result of CCDC26 gene mutation detection liquid-phase chip provided by the present invention and sequencing are coincide rate up to 100%, and detect the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared CCDC26 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in multiple mutational sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also sudden change situation in the multiple mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, the amplification that can complete by a step PCR 5 target sequences that contain mutational site is detected in 5 kinds of mutational sites, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR are avoided, thereby can greatly improve Detection accuracy, embody accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1CCDC26 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of CCDC26 gene five kinds of common genotype A231C, T144G, A100G, T90C and G75A, design respectively specific primer sequence.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1CCDC26 gene
Figure BDA00002522267800041
Figure BDA00002522267800051
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 10 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
Figure BDA00002522267800061
10 kinds of microballoons selecting, purchased from Luminex company of the U.S., are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) disturb, can also use poly(TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 × 10 6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/LTris(pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/LEDTA, 2-8 DEG C keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For CCDC26 gene five kinds of common genotype A231C, T144G, A100G, T90C and G75A, design of amplification primers, to (in table 3), amplifies 5 target sequences that contain 5 mutational sites.
Table 3 amplifies the primer of the target sequence with mutational site
Figure BDA00002522267800071
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses the detection to sample of CCDC26 gene mutation detection liquid-phase chip described in embodiment 1
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
Reagent Source Final concentration The consumption of every 250ml
1MTris-HCl， SigmaT3038 0.2M 50ml
pH8.0 ? ?
5MNaCl Sigma?S5150 0.4M 20ml
Triton?X-100 Sigma?T8787 0.16％ 0.4ml
After filtration, be stored in 4 DEG C.
ExoSAP-IT test kit is purchased from US B company of the U.S..
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to " molecular cloning " about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 5 pairs of primers, multiplex PCR one step amplifies 5 target sequences that contain respectively CCDC26 gene five kinds of common genotype A231C, T144G, A100G, T90C and G75A, product size is respectively 340bp, 357bp, 364bp, 277bp, 350bp, and primer sequence (SEQ ID NO.31-40) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.31-40 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Figure BDA00002522267800081
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ulPCR, add 1ul10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Figure BDA00002522267800091
Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.
Five, hybridization
According to design ASPE primer, the corresponding 10 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 × 10 5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 DEG C, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI(NET MFI is less than 0 represent with 0);
3. meet the data of above two conditions, calculate sudden change ratio by following formula:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments CCDC26 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with liquid-phase chip result and compare with sequencing, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments CCDC26 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible CCDC26 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of CCDC26 exactly, and result is reliable and stable.
Table 4 pattern detection result (MFI)
Figure BDA00002522267800101
Table 5 sample CCDC26 transgenation ratio (%)
Sample number A231C T144G A100G T90C G75A
1 2% 2% 2% 1% 1%
2 3% 2% 2% 2% 2%
3 1% 2% 3% 2% 1%
4 2% 3% 3% 1% 2%
5 1% 98% 2% 3% 2%
6 2% 3% 3% 2% 99%
7 2% 2% 2% 2% 2%
8 1% 2% 2% 2% 1%
9 2% 2% 2% 2% 2%
10 3% 2% 99% 1% 2%
11 1% 3% 2% 2% 1%
12 2% 2% 2% 2% 1%
13 2% 2% 2% 1% 1%
14 1% 2% 2% 1% 2%
15 2% 2% 1% 2% 1%
16 52% 2% 1% 2% 1%
17 2% 2% 2% 1% 2%
18 2% 2% 2% 2% 1%
19 2% 1% 2% 1% 1%
20 1% 1% 2% 2% 2%
Table 6 sample CCDC26 gene mutation type analytical results
Figure BDA00002522267800112
Figure BDA00002522267800121
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to CCDC26 gene SNP site
One, the design (selection of Tag sequence and Anti-Tag sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking CCDC26 Gene A 231C, T144G, T90C and G75A site mutation, respectively for the wild-type of A231C, T144G, T90C and G75A and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.10, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.21-SEQ ID NO.30.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
Figure BDA00002522267800122
Figure BDA00002522267800131
Figure BDA00002522267800141
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 8 sample CCDC26 Gene A 231C detected result and Polymorphism Analysis
Table 9 sample CCDC26 gene T144G detected result and Polymorphism Analysis
Figure BDA00002522267800151
Table 10 sample CCDC26 gene T90C detected result and Polymorphism Analysis
Figure BDA00002522267800161
Table 11 sample CCDC26 gene G75A detected result and Polymorphism Analysis
Figure BDA00002522267800162
From above-described embodiment, other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1, test group 5, test group 8 and test group 12.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4CCDC26 detection in Gene Mutation specific primer sequence
One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking the pleomorphism site of CCDC26 Gene A 100G and T90C, taking the complementary sequence forward or backwards of this place, mutational site target sequence as template, respectively for the wild-type of A100G and T90C and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 12.Wherein,
Figure BDA00002522267800172
interior base is pleomorphism site.
Table 12 specific primer sequence
Figure BDA00002522267800173
Figure BDA00002522267800181
Detect liquid-phase chip as example taking the pleomorphism site of CCDC26 Gene A 100G and T90C, select different specific primer sequences for A100G and T90C, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 13).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 13 liquid-phase chip
Figure BDA00002522267800182
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 14 sample CCDC26 Gene A 100G detected result and Polymorphism Analysis
Figure BDA00002522267800191
Table 15 sample CCDC26 gene T90C detected result and Polymorphism Analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 13 and test group 16.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detects effect also better, and concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Figure IDA00002522268300011
Figure IDA00002522268300021
Figure IDA00002522268300031
Figure IDA00002522268300041
Figure IDA00002522268300061
Figure IDA00002522268300071
Figure IDA00002522268300081
Figure IDA00002522268300091
Figure IDA00002522268300101
Figure IDA00002522268300111

Claims (5)

1. a CCDC26 gene mutation detection liquid-phase chip, is characterized in that, includes:
(A). the wild-type designing respectively for the different mutational sites of CCDC26 gene and the ASPE primer pair of saltant type: every ASPE primer is made up of for the specific primer sequence in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQ ID NO.11 and the SEQ ID NO.12 in A231C site, for SEQ ID NO.13 and the SEQ ID NO.14 in T144G site, for SEQ ID NO.15 and the SEQ ID NO.16 in A100G site, for SEQ ID NO.17 and the SEQ ID NO.18 in T90C site, and/or for SEQ ID NO.19 and the SEQ ID NO.20 in G75A site, described tag sequence is selected from SEQID NO.1～SEQ ID NO.10,
(B). there is microballoon that different anti-tag sequences are coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.21～SEQ ID NO.30, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding mutational site.
2. CCDC26 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described amplimer is: for SEQ ID NO.31 and the SEQ ID NO.32 in A231C site, for SEQ ID NO.33 and the SEQ IDNO.34 in T144G site, for SEQ ID NO.35 and the SEQ ID NO.36 in A100G site, for SEQ ID NO.37 and the SEQID NO.38 in T90C site, and/or for SEQ ID NO.39 and the SEQ ID NO.40 in G75A site.
3. CCDC26 gene mutation detection liquid-phase chip according to claim 1 and 2, it is characterized in that, described ASPE primer is for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.11 in A231C site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.12, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.13 in T144G site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.14, for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.15 in A100G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.16, for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.17 in T90C site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.18, and/or for the sequence being formed by SEQ ID NO.9 and SEQ ID NO.19 in G75A site and the sequence that formed by SEQ ID NO.10 and SEQ ID NO.20.
4. CCDC26 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
5. for the Auele Specific Primer of CCDC26 detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is for the SEQ ID NO.11 in A231C site and SEQ ID NO.12, for SEQ ID NO.13 and the SEQ ID NO.14 in T144G site, for SEQ ID NO.15 and the SEQ ID NO.16 in A100G site, for SEQ ID NO.17 and the SEQ ID NO.18 in T90C site, and/or for SEQ ID NO.19 and the SEQ ID NO.20 in G75A site.
CN201210513280.7A 2012-12-04 2012-12-04 CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip Active CN103849676B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210513280.7A CN103849676B (en) 2012-12-04 2012-12-04 CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210513280.7A CN103849676B (en) 2012-12-04 2012-12-04 CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Publications (2)

Publication Number Publication Date
CN103849676A true CN103849676A (en) 2014-06-11
CN103849676B CN103849676B (en) 2016-04-27

Family

ID=50857798

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210513280.7A Active CN103849676B (en) 2012-12-04 2012-12-04 CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Country Status (1)

Country Link
CN (1) CN103849676B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SHANQU LI ET AL: "polymorphisms of TREH，IL4R and CCDC26 genes associated with risk of glioma", 《CANCER EPIDEMIOLOGY》 *
陈玮: "液相芯片技术的原理与应用进展", 《成都医学院学报》 *

Also Published As

Publication number Publication date
CN103849676B (en) 2016-04-27

Similar Documents

Publication Publication Date Title
CN103451271B (en) THADA gene mutation detection specific primer and liquid phase chip
CN103451267B (en) TERT detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102912002B (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN102191336B (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip
CN103451272A (en) BAT3 gene mutation detection specific primer and liquid phase chip
CN103374607B (en) ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN103849676B (en) CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN102304567B (en) Polymorphic detection specific primers and liquid phase chip in 8 q 24 section of chromosome
CN102952868B (en) Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN102952870B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene
CN103849940A (en) Specific primer and liquid phase chip for detecting BARD1 gene mutation
CN103849942A (en) Specific primer and liquid phase chip for detecting TOX3 gene mutation
CN102952872B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN103571919A (en) Specific detection primers and detection liquid phase chip for HNF1B gene mutation
CN103451266B (en) NKX3.1 gene mutation detection specific primers and liquid chip
CN103849675B (en) RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374608B (en) MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip
CN102888444B (en) Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant