CN103842375A - Dreb1 transcription factor of cotton and coding gene and application thereof - Google Patents

Abstract

A DREB1 transcription factor GhCBF1 derived from cotton and a coding gene thereof are provided. An application of the transcription factor in cultivating transgenic plants with stress tolerance such as improved cold tolerance and drought resistance is further provided.

Description

Dreb1 transcription factor of cotton and coding gene and application thereof

A DREB1 classes transcription factor and its encoding gene for cotton is with applied technical field the present invention relates to plant transcription factor and its encoding gene and application, and more particularly to one from cotton

DREB1 class transcription factor GhCBFl and its encoding gene, and its application in the genetically modified plants that resistance of reverse is improved are cultivated.Background technology abiotic stress, such as arid, salt marsh, extreme temperature, chemical contamination and oxygen injury can cause serious harm to growing for plant, extreme loss is caused to crop yield, wherein influence of the arid to crop yield, first place is accounted in many natural adverse circumstances, it is endangered equivalent to other disaster sums, be many areas be agricultural development bottleneck.According to statistics, dry early, the half-dried early area in the world accounts for the 34% of land area;The dry early, semiarid zone of China accounts for the 52% of area, and year, the national billion cubic meter of the annual water shortage in irrigation district about 30 received 350 40 hundred million kilograms of grain because of water shortage less by early area up to 20 270 ten thousand hectares；Particularly China relationship and primary grain producing such as North China, northeast and northwest, is the area of China's water shortage most serious, and spring drought frequently reaches 10 years nine chances.

Because the resistance to coercive of plant belongs to quantitative character mostly, existing available germ plasm resource is deficient, and the difficulty for improveing stress tolerance in plants using traditional breeding method is quite big, cultivates really resistance to stress kind just particularly difficult.In recent years, with to plant stress-resistance molecular mechanism research deepen continuously and Protocols in Molecular Biology fast development, degeneration-resistant research is deep into molecular level from physiological level, promotes the development of plant stress-resistance genetic engineering.Corresponding responsing reaction can be produced when plant is being forced, to reduce or eliminate the harm brought to plant.This responsing reaction of plant is one and is related to polygenes, multi signal approach, the complex process of polygenes product.These genes and its expression product can be divided into 3 classes：（1) gene and product of signal cascade amplification system and transcription control are participated in；(2) gene and its expression product directly worked to protection biomembrane and protein；（3) protein related with transhipment to the intake of water and ion.In recent years, research of the plant to stress-tolerance ability is improved by transgenic technology, and significant achievement is all achieved to the research for coercing crops, xerophyte and halophytes with tolerance, stress-related genes and signal transduction system there has also been and further understand（Liu Q.1998. Two transcrip tion facto rs,DREBl and DREB2,w ith an EREBP/AP2 DNA binding domain, separate two cellular signal transduction pathways in drought-and low temperature-responsive gene exp ression, respectively, in A rabidopsis. Plant Cell, 10: 1391-1406； KAN GJY.2002. A rabid op sis basic leucine zipper p ro teins that mediate stress2responsive abscisic acid signaling. Plant Cell, 14: 343- 357； ABE H.2003.A rabid op sis AtMYC2 (bHLH) and AtMYB2(MYB) function as transcrip tional activato rs in abscisic acid signaling. Plant Cell, 15: 63-78. ) .

But for current research situation, because its mechanism is sufficiently complex, many plants still need to be studied to the biochemistry under adverse circumstance and physiological response mechanism.Research in terms of the function and expression regulation of degeneration-resistant response gene occupies the majority, but the mechanism of contact between degeneration-resistant related signaling pathways and whole signal transmission network system need further research.Although many research institutions are by modern biotechnology, all kinds of genetically modified plants with certain anti-adversity ability are obtained, the standard of industrialization is also not up to.Therefore in terms of stress resistance of plant is improved, also many needs of work are done.

Content of the invention the present inventor has cloned a DREB (dehydration response element conjugated protein, dehydration responsive element binding protein) class transcription factor of cotton using SSH with the RACE methods being combined（Be named as GhCBFl herein) encoding gene DNA sequence dna.And find to be conducted into after transfer-gen plant, the winter resistance and anti-morning property of transfer-gen plant are can obviously improve, and these characters can stablize heredity.

First aspect present invention provides a DREB class transcription factor GhCBFl for cotton, and its sequence is SEQ ID NO: l o

Second aspect of the present invention provides the nucleotide sequence of the transcription factor described in coding first aspect present invention.Preferably, the nucleotide sequence has SEQ ID NO:Nucleotide sequence shown in 2.

Third aspect present invention provides a kind of recombinant expression carrier, and it contains the nucleotide sequence described in second aspect of the present invention and the nucleotide sequence is operably connected with the expression control sequence of the expression vector；Preferably, the carrier is the rd29A-GhCBF 1-2300 carriers shown in accompanying drawing 2.

Fourth aspect present invention provides a kind of recombinant cell, and it contains the recombinant expression carrier described in nucleotide sequence or third aspect present invention described in second aspect of the present invention；Preferably, the recombinant cell is restructuring agrobatcerium cell.

The method of a kind of improvement plant cold-resistant of fifth aspect present invention and/or anti-morning property, including：Recombinant expression carrier described in nucleotide sequence or third aspect present invention described in second aspect of the present invention is imported into plant or plant tissue and makes the gene expression；Preferably, the plant is tobacco.

A kind of method of prepare transgenosis plant of sixth aspect present invention, including：Cultivated under conditions of plant is effectively produced containing the nucleotide sequence described in second aspect of the present invention, the plant of the recombinant expression carrier described in third aspect present invention or plant tissue；Preferably, the plant is tobacco.

Seventh aspect present invention provides the transcription factor described in first aspect present invention, the nucleosides described in second aspect of the present invention The recombinant cell described in recombinant expression carrier or fourth aspect present invention described in acid sequence, third aspect present invention is used to improve plant cold-resistant and/or anti-morning property and the purposes for plant breeding；Preferably, the plant is tobacco.

Brief description of the drawings Fig. 1 is the structure flow of GhCBFl plant expression vector (rd29A-GhCBFl-2300).

Fig. 2 is the plasmid figure of GhCBFl plant expression vector (rd29A-GhCBFl-2300).

Fig. 3 is the experimental result of transgene tobacco winter resistance.Left figure is transfer-gen plant（TJ1-3);Right figure is nontransgenic plants（Control）.

Fig. 4 is the experimental result of transgene tobacco drought resistance.Left figure is transfer-gen plant（TJ4-15);Right figure is nontransgenic plants（Control）.The present invention is further described with reference to non-limiting example for embodiment embodiment.

The restriction enzyme mentioned in example below is purchased from cotton SSH library constructions under the cold stress of New England Biolabs companies embodiment 1：

Specific method is：

Utilize the PCR-select of Clontech companies^TMCDNA Subtraction Kit, subtractive library is built according to the method shown in product description by suppressed subtractive hybridization method.Using the mRNA of low-temperature treatment 6h cotton seedling blade as sample (tester) in experimentation, control (drivei^ is used as using the mRNA of untreated cotton seedling blade

(1) material to be tested-Ji cotton 14 (National Cotton mid-term storehouse, acquisition unit Cotton research institute, Unified number：ZM-30270) it is seeded on sterilized vermiculite, is cultivated under the conditions of 25 °C, photoperiod 16h/8h, 1/2MS culture mediums are poured weekly（9.39 mM KN0₃, 0.625 mM KH₂P0₄, 10.3 mM NH₄N0₃, 0.75 mM MgS0₄, 1.5mMCaCl₂, 50 μM of KI, lOOu MH3BO3,100uMMnSO₄, 30uMZnSO₄, 1 u MNa₂Mo0₄, 0.1 u M CoCl₂, 100 MNa₂EDTA, 100 MFeSO₄) once.It is used to test when seedling plant height reaches 25-30cm.

(2) material process：

2 groups, every group of 4 basins, per 1 plant of basin will be divided into for examination seedling.First group is control group, in 25 °C, illumination cultivation, Second group is low-temperature treatment group, and 6h, illumination cultivation are handled in 4 °C of low temperature.The blade of two groups of seedling apicals 1/3 of timely clip after being disposed, after liquid nitrogen quick freeze, is preserved in -70 °C of refrigerators.

(3) Total RNAs extraction：

The cotton leaf 0.5g of control and low-temperature treatment is taken respectively, uses plant RNA extraction kit（Invitrogen the total serum IgE of cotton) is extracted.Absorbance of the total serum IgE in 260nm and 280nm is determined with the ultraviolet specrophotometer U-2001 of HITACHI companies, OD260/OD280 ratios are 1.8-2.0, show that total serum IgE purity is higher, the integrality of total serum IgE is detected with 1.0% agarose gel electrophoresis, the brightness of 28S bands is about 2 times of 18S bands, shows that RNA integrality is good.MRNA is separated using the Oligotex mR A purification kits (purification of polyA+ RNA from total RNA) of Qiagen companies.

(4) suppressed subtractive hybridization：

In order to have increased access to ESTXunigene) validity, avoid gene without restriction enzyme site and obtained sequence in non-translational region, this laboratory uses the PCR-selectTM cDNA Subtraction Kit of Clontech companies, according to catalogue Rsal, Haelll digests to the double-strand cDNA from above-mentioned separation mRNA respectively, do two groups of suppressed subtractive hybridizations, the method of other steps and method strictly as shown in the PCR-select cDNA Subtraction Kit product descriptions of Clontech companies carries out suppressed subtractive hybridization, finally merge second of PCR product of two groups of positive subtractive hybridization cDNA fragments.

(5) structure of cDNA subtractive libraries and preliminary screening, clone, identification

Second of PCR primer of the positive subtractive hybridization cDNA fragments of merging（QIAquick PCR Purification Kit are purified, purchased from Qiagen) it is connected with pGEM-T Easy carriers (being purchased from Promega), according to the method shown in pGEM-T Easy reagent kit product specifications, comprise the following steps that：Following ingredients are sequentially added with 200ul PCR pipes：Second of PCR primer 3ul, T4 ligase buffer solution 5 ul, pGEM-T Easy carrier l ul, T4 DNA ligase lul of cDNA fragments is purified, is stayed overnight in 4 °C of connections.Take Ι Ο μ Ι ^ coupled reaction products, it is added in Ι Ο Ο μ competence e. coli jm109 (being purchased from TAKARA), ice bath 30min, heat shock 60s, ice bath 2min, separately adding 250 μ L LB nutrient solutions, (1% Tryptone is purchased from OXOID, 0.5% Yeast Extract are purchased from OXOID, and 1% NaCl is purchased from traditional Chinese medicines）Put in 37 °C of shaking tables, 225 r/min shake bacterium 30min, take 200 μ ^ bacterium solutions plant in containing 50 ug/mL ampicillins, 40 ug/mL X-gal, 24 ug/mL IPTG (X-gal/IPTG be purchased from TAKARA) LB (ibid）On solid culture flat board, 37 °C of 18 h of cultivation.Count the clear white and blue colonies number of the mm of diameter ＞ 1 in culture plate, random 200 white colonies of picking (numbering：Gh-C001 to Gh-C200) in 96 porocyte culture plates (CORNING) of the LB fluid nutrient mediums containing 50 ug/mL ampicillins, glycerol adding is saved backup to final concentration 20% in -80 °C after 37 °C of overnight incubations.With nest-type PRC primer Primer 1, (PCR-select cDNA Subtraction Kit kits are carried）(PCR-select cDNA Subtraction Kit kits are carried standing grain Π Primer 2R）Bacterium solution PCR amplifications are carried out, 152 positives are obtained All positive colonies are being sent Invitrogen by clone（Shanghai）Trade Co., Ltd is sequenced.

(6) the cDNA sequencing analysis of differential cloning：

DNA sequencing result is removed after carrier and indefinite sequence and unnecessary cDNA, 112 EST (unigene are obtained；).Find that wherein 52 unigene have homologous sequence in GenBank through BlastN（Similar more than 50%）, 25 EST Unknown Functions or for assume albumen, separately there are 35 not obtain homologous matching, thus it is speculated that to be probably the shorter sequence in 3 ', 5 ' end non-translational regions.The clone of the GhCBFl encoding genes of embodiment 2

In embodiment 1 has the unigene of homologous sequence, clone Gh-C021 sequences such as SEQ ID NO:Shown in 3：

Sequence analysis shows that the amino acid sequence of the coding of the sequence belongs to DREB1 albuminoids, and the albumen is named as into GhCBFl herein.

(1) clone of GhCBFl full-length gene

According to the GhCBF l obtained genetic fragment, two specific primers are designed, 3 ' RACE 5 ' end primers are used as：

GhCBFl GSP1 : SEQ ID NO: 4：

CCTACACCTGAAATGGCTGCACGA

GhCBFl GSP2: SEQ ID NO: 5：

CGAGCACATGATGTTGCTGCA

Experimental procedure is operated by kit specification（3 ' RACE System for Rapid Amplification of cDNA Ends kits, purchased from invitrogen companies）

With SEQ ID NO:4 hold primer AUAP with 3 ', and (kit is carried）, the amplification of first round PCR is carried out by template of the cDNA of mRNA reverse transcriptions.Ju Ti Walk are suddenly as follows：Ex Taq are purchased from TAKARA, the Ρ Ο reaction systems of 50 μ 1：5 μ Ι Ο χ Ε χ Buffer, 3 μ 2.5mM dNTP, the cDNA of 2.0 μm of RNA reverse transcriptions, 1.0 μ Ex Taq, 10 μ Μ primer SEQ ID NO:Each 2.0 μ 1 of 4 and AUAP, and 35 μ distilled water.PCR reaction conditions： 94 °C The min of pre-degeneration 5;94 °C of denaturation 30 s, 58 °C of annealing 30 s, 72 °C of extension lmin, 33 circulations；72 °C of 10 min of extension.

The PCR primer of gained takes 2.0 μ 1 as template after diluting 100 times with double distilled waters, with SEQ ID NO:5 and 3, end primer AUAP carry out second and take turns PCR amplifications, comprise the following steps that：50 μ Ι Ρ Ο Ι reaction systems：5 μ Ι Ο χ Ε χ Buffer, 3 μ 2.5mM dNTP, the PCR primer that the 2.0 μ first round diluted, 1.0 μ Ex Taq, 10 μ Μ primer SEQ ID NO:Each 2.0 μ 1 of 5 and AUAP, and 35 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 °C of denaturation 30 s, 58 °C of annealing 30 s, 72 °C of extension lmin, 33 circulations；72 °C of 10 min of extension.Second of PCR primer（QIAquick PCR Purification Kit are purified, purchased from Qiagen) 3ul is connected to pGEM-T Easy Vector, it is transformed into e. coli jm109 (specific method is ibid), random 10 white colonies of picking are cultivated in the LB fluid nutrient mediums containing 50 ug/mL ampicillins, glycerol adding is to final concentration 20% after 37 °C of overnight incubations, and -80 °C save backup. SEQ ID NO:5 carry out bacterium solution PCR amplifications with 3' ends primer AUAP（System and condition are ibid）, 5 positive colonies are obtained, Invitrogen is sent（Shanghai）Trade Co., Ltd is sequenced, and obtains the cDNA of gene 3' ends.

According to the GhCBFl obtained genetic fragment, three specific primers are designed, respectively as mRNA reverse transcription primer（SEQIDNO:6) with 5'RACE 3' end primers（SEQIDNO:7 and 8).

GhCBFl GSP3: SEQID O: 6：

GTTAACCTCGACGCCACTCG A

GhCBFl GSP4: SEQID O: 7：

CTTTTACCTCTAAACGCTAA TG

GhCBFl GSP5: SEQID O: 8：

TGCAGCAACATCATGTGCTC GTG

Experimental procedure is operated by kit specification（5'RACE System for Rapid Amplification of cDNA Ends kits, purchased from invitrogen companies）. SEQ ID NO:6 as mRNA reverse transcriptions into cDNA primer.

Use SEQIDNO:7 (kit is carried with 5' universal primers AAP）, with cDNA (the reverse transcription primer SEQ ID NO of mRNA reverse transcriptions:6) amplification of first round PCR is carried out for template, comprised the following steps that：Ex Taq are purchased from TAKARA, 50 μ PC reaction systems：The cDNA of the 5 μ Ι Ο χ Ε χ μ total serum IgE reverse transcriptions of Buffer, 3 μ 2.5mM dNTP, 2.0,1.0 10 μ Μ primer SEQ ID NO:Each 2.0 μ 1 of 7 and AAP, and 35 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 denaturation 30 s, 55 °C of annealing 30 s, 72 °C of extension lmin, 33 circulations；72 " C extends 10 min.

The PCR primer of gained takes 2.0 μ as template after diluting 100 times with distilled water, with SEQ ID NO:8 carry out second with 3' ends primer AUAP takes turns PCR amplifications, comprises the following steps that：50 l PCR reaction systems：5 μ Ι Ο χ Ε χ Buffer, 3 μ 2.5mM dNTP, the PCR primer that the 2.0 μ first round diluted, 1.0 μ Ex Taq, 10 μ Μ draw Thing SEQ ID NO:Each 2.0 μ 1 of 8 and AUAP, and 35 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 °C of denaturation 30 s, 58 °C of annealing 30 s, 72 °C of extension lmin, 33 circulations；72 °C of 10 min of extension.Second of PCR primer（QIAquick PCR Purification Kit are purified, purchased from Qiagen) 3ul is connected to pGEM-T Easy Vector, it is transformed into JM109 (specific method is ibid), random 10 white colonies of picking are cultivated in the LB fluid nutrient mediums containing 50 ug/mL ampicillins, glycerol adding is to final concentration 20% after 37 °C of overnight incubations, and -80 °C save backup. SEQ ID NO:8 carry out bacterium solution PCR amplifications with 3' ends primer AUAP（Reaction system and reaction condition are ibid）, 4 positive colonies are obtained, Guangzhou Invitrogen is sent（Shanghai）Trade Co., Ltd is sequenced, and obtains the cDNA of gene 5' ends.

After 5 ' the RACE product clonings sequencing of gained, splice with 3 ' RACE products sequencing results.Obtain GhCBFl full length cDNA sequence.Pair of primers is designed according to GhCBFl full length cDNA sequence as follows：

G CBFlF: SEQ ID NO: 9：

ATGGCGGCAGAAACGGCGGAGACACC

GhCBFIR: SEQ ID NO: 10：

TCAGTAACTCCACAAGGAAACA

Pass through SEQ ID NO:9 standing grain B SEQ ID NO:10 clone the total lengths of GhCBFl encoding genes.

Using TaKaRa PrimeSTAR HS archaeal dna polymerases, performing PCR reaction is entered by template of the cDNA of cotton.50 l PCR reaction systems：10 15 X PS Buffer, 3 μ 1 2.5mM Continued P, 2.0 1 cDNA, Ι Ο μ 1 PrimeSTAR, 10 μM of primer SEQ ID NO:9 standing grain Jie SEQ ID NO:10 each μ of 2.0 μ 1,30 distilled water.PCR reaction conditions：94 °C of pre-degeneration 5min;94 °C of denaturation 30s, 58 °C of annealing 30s, 72 °C of extension 60s, 33 circulations；72 °C of extension 10min.

Pcr amplification product adds A:PCR primer adds 2.5 times of absolute ethyl alcohol, and -20 °C are placed 10 minutes, and centrifugation is removed supernatant, dried, and is dissolved with the distilled waters of 21 μ 1.Add 2.5ul 10 X Ex Buffer, 0.5ul 5 mM dATP, 2.5ul lO X Ex Taq.Reaction condition：70 °C are reacted 30 minutes.The DNA fragmentation for obtaining about 600bp is reclaimed（Omega QIAquick Gel Extraction Kits）, it is cloned on pGEM T-easy carriers, conversion JM109C methods are ibid).Random 10 white colonies of picking are cultivated in the LB fluid nutrient mediums containing 50 ug/mL ampicillins, and glycerol adding is to final concentration 20% after 37 °C of overnight incubations, and -80 °C save backup. SEQ ID NO:9 and SEQ ID NO:10 carry out bacterium solution PCR amplifications（Reaction system and reaction condition are ibid）, 4 positive colonies are obtained, Invitrogen is sent（Shanghai）Trade Co., Ltd is sequenced, and sequence is SEQ ID NO: 2.Its protein expression sequence is SEQ ID NO: 1.GhCBFl amino acid sequence： SEQ ID NO: 1 1 MAAETAETPS SSSEEVYSLA

21 TSKPKKRAGR RIFKETRRPI

41 FRGVRQRKV KWVCELREPN

61 KKTRIWLGTY PTPEMAARAH

81 DVAALAFRGK SACLNFADSA

101 WKLPLPASMD AIDIRRAAVE

121 AAEAFRPKES EEPLGGGGTR

141 QGSVEACSSG VEVNFVDEEA

161 MFDMPNLLAS MAEGLLLSPP

181 RST RDDDDD DSDIDVSLWS

201

The nucleotide sequence of GhCBFl encoding genes： SEQ ID NO: 2

The GhCBFl plant expression vector constructions of embodiment 3

Plant expression vector rd29A- GhCBFl -2300 build flow as shown in Figure 1.

Plant binary expression vector pCAMBIA2300 is selected (to be purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd）As plant expression vector, the 35S promoter that PTII genes contain double enhancers is replaced with Pnos promoters, to reduce expression of the Ρ Τ Π albumen in plant.Inducible promoter rd29A and Tnos is selected as the startup of GhCBFl genes Son and terminator.Comprise the following steps that：

Use SEQ ID NO:11 and SEQ ID NO:12 (are purchased from ocean Science and Technology Ltd. of Beijing China with plant expression vector PBI121）For template amplification Pnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ PCR reaction systems：10 μ, 51 Ρ Β Ι of xPS Buffer, 3 μ 2.5mM dNTP, 1.0 μ 121,1.0 μ PrimeSTAR, 10 μ Μ primer SEQ ID NO:11 and SEQ ID NO:12 each 2.0 μ 1, and 31 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 °C of denaturation 30 s, 56 °C of annealing 30 s, 72V extend 30 s, 33 circulations；72 °C of 10 min of extension, product is connected to pCAMBIA2300 (promega T4 ligases box) by EcoRI, Bglll digestion and obtains pCAMBIA2300-l.

SEQ ID NO: 11 ：

GCAC GAATTC ATACAAATGGACGAACGGAT

SEQ ID NO: 12：

ATCC AGATCT AGATCCGGTGCAGATTATTTG

Use SEQ ID NO:13 and SEQ ID NO：14 using PBI121 as template amplification Tnos, using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ PCR reaction systems：The μ Prime STAR of 10 μ, 51 Ρ Β Ι of xPS Buffer, 3 μ 2.5mM dNTP, 1.0 μ 121,10,10 μ Μ primer SEQ ID NO:13 and SEQ ID NO:14 each 2.0 μ 1, and 31 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94V is denatured 30 s, 58 °C of annealing 30 s, 72 °C of 30 s of extension, 33 circulations；72 °C of 10 min of extension.Product is connected to pCAMBIA2300-l by Sacl, EcoRI digestion, obtains pCAMBIA2300-2.

SEQ ID O: 13：

AAGGAGCTCGAATTTCCCCGATCGTTCAAA SEQ ID O: 14：

TCAGAATTC CCAGTGAATT CCCGATCTAG TA

Use SEQ ID NO:15 standing grain B SEQ ID NO:16 with arabidopsis（Colombia's type, purchased from www.arabidopsis.org) genomic DNA be template amplification arabidopsis rd29A promoters（With reference to Zeng J., et L 2002, Preparation of total DNA from " recalcit rant plant taxa ", Acta Bot. Sin., 44 (6):Method in 694-697 extracts arabidopsis DNA).Using TaKaRa PrimeSTAR HS archaeal dna polymerases.50 μ PCR reaction systems：10 the μ 5xPS μ arabidopsis of Buffer, 3 μ 2.5mM dNTP, 1.0 DNA, 1.0 μ PrimeSTAR 10 μ Μ primer SEQ ID NO:15 and SEQ ID NO:16 each 2.0 μ 1, and 31 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 °C of denaturation 30 s, 58 °C of annealing 30 s, 72V extend 30 s, 33 circulations；72 °C of 10 min of extension, PCR primer is connected to pCAMBIA2300-2 by HindIII, Sail digestion, obtains pCAMBIA2300-3. SEQ ID NO: 15：

ACTAAGCTTCCTTCTTGACATCATTCAATTTTA SEQ ID NO: 16：

TGAGTCGACTCCAAAGATT TTTTTCTTTC CAATAG

Use SEQ ID NO:17 and SEQ ID NO:18 amplification GhCBFl genes（Template is that embodiment 1 obtains the pGEM T-easy recombinant vectors containing GhCBFl genes）, using TaKaRa PrimeSTAR HS DNA polymerases.50 μ PCR reaction systems：The 10 μ 5xPS μ GhCBFl of Buffer, 3 μ 2.5mM dNTP, 1.0-pGEM, 1.0 μ PrimeSTAR, 10 μ Μ primer SEQ ID NO:17 standing grain Π SEQ ID NO:18 each 2.0 μ 1, and 31 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 °C of denaturation 30 s, 58 °C of annealing 30 s, 72 °C of extension lmin, 33 circulations；72 °C of 10 min of extension.PCAMBIA2300-3 is connected to by Sall, Sacl digestion, plant expression vector, rd29A- GhCBFl-2300 is obtained.

SEQ ID NO: 17：

TGAGTCGAC ATGGCGGCAGAAACGGCGGAGACACC SEQ ID NO: 18：

Rd29A- GhCBFl -2300 expression vectors of AAGGAGCTC TCAGTAACTC CACAAGGAAA CA embodiments 4 convert Agrobacterium

It is prepared by Agrobacterium LBA4404 (being purchased from Biovector Science Lab, Inc) competence：In advance l-2d by Agrobacterium LBA4404 (^g/ml rifampins and 5 (draw a single spot to be inoculated with, 28 °C of cultures 1 to 2d on the LB solid mediums of ^g/ml streptomysins containing 5.Picking single bacterium colony is inoculated in 5ml containing 50 μ_§The rifampins of/η ι 1 and 50 μ_§In the LB fluid nutrient mediums of the streptomysins of/η ι 1, it is 0.4 that 28 times, which are shaken overnight incubation (about 12-16h) to OD600 values, forms seed bacterium solution.Take the bacterium solution after 5ml activation（1 :20 ratio）In the LB fluid nutrient mediums for being inoculated in the same concentration antibiotic of 100ml, 28 °C are shaken culture 2-2.5h to OD600=0.8.Ice bath bacterium solution 10min, shakes up once every 3min, makes bacterium even into resting state.In 4 °C of lower 4000g centrifugations 10min, supernatant is abandoned；Certain glycerine resuspension thalline of head for precooling 10% is added, 4 °C of lower 4000g centrifugations 10min collect precipitation；Repeated to wash 3-4 times with 10% glycerine；Adding 10% glycerine of appropriate ice bath precooling, suspended bacterial is precipitated again, is dispensed, is saved backup in -70 °C with the pipes of 40 μ 1/.

Convert Agrobacterium：Melt competent cell on ice, Ι μ rd29A- GhCBF 1-2300 plasmids, the min of ice bath about 10 after mixing are added into 40 μ 1 competent cell.Competence and DNA mixture are transferred in the electric shock of precooling cup with rifle, rapping makes suspension reach bottom, has been careful not to bubble.To be shocked by electricity cup（Purchased from bio-rad) it is put on the slideway of electroporation chamber, promote slideway to put electric shock cup to electroporation chamber base electrode.Using 0.1cm electric shock cup when, MicroPulser (be purchased from bio-rad) program is set to " Agr ", and electric shock is once.Electric shock cup is taken out immediately, plus Enter the LB culture mediums of 28 °C of preheatings.It is quickly soft to be beaten cell with rifle.Suspension is transferred to 1.5ml centrifuge tube, 28 °C, 225rpm cultures lh.100 200 μ 1 bacterium solution is taken to be coated with and corresponding resistance screening culture medium（LB solid mediums, containing 50 μ_§The rifampins of/η ι 1,50 μ_§The streptomysins of/η ι 1,50 μ_§The kanamycins of/η ι 1）On flat board, 28 °C of cultures.Embodiment 5 obtains transgene tobacco using Agrobacterium-medialed transformation method

With 75% alcohol-pickled tobacco seed（Countries tobacco mid-term storehouse, obtains tobacco institute of unit the Chinese Academy of Agricultural Sciences, storehouse numbering I5A00660) 30s, then 8min is soaked with 0.1% mercuric chloride, carry out surface sterilization.Sterilized tobacco seed is placed in MS solid mediums（18.78 mM KN0₃, 1.25 mM KH₂P0₄, 20.6 mM NH4NO3, 1.5 mM MgS0₄, 3.0 mM CaCl₂, 50 μM of KI, 100 μM of H3BO3,100 μM of MnS0₄, 30 μ M ZnS0₄, 1 M Na₂Mo0₄, 0.1 u M CoCl₂, 100 μ M Na₂EDTA, 100 u M FeSO₄, 7.4 g/L agar, sucrose 30g L) on aseptic germination, prepare aseptic seedling.Take tests for sterility to be cut into the leaf dish of 5mm X 5mm sizes, with the During Agrobacterium leaf dish 10min containing expression vector in exponential phase, blot bacterium solution, co-cultured 2 days under dark condition（MS culture mediums）.Blade is gone into differential medium (MS+lmg/L BA+0.1mg/L NAA+50mg/L kanamycins+500mg/L cephalosporins）On, cultivated 45 days or so under illumination condition, cut after bud is grown up and be transferred to root media (MS+50mg/L kanamycins+500mg/L cephalosporins）Middle culture 30 days or so, preservation is numbered after seedling is transferred on the MS culture mediums only added with 500mg/L cephalosporins after well developed root system.

Take the transgenic tobacco leaf of acquisition, extract genomic DNA (arabidopsis DNA extraction method in be the same as Example 3）, with primer SEQ ID NO:17 and SEQ ID NO:18 enter performing PCR identification（50 μ PCR reaction systems：The 5 μ Ι Ο χ Ε χ μ of Buffer, 3 μ 2.5mM dNTP, 2.0 DNA, 1.0 μ Ex Taq, 10 μ Μ primer SEQ ID NO:17 and SEQ ID NO:18 each 2.0 μ 1, and 35 μ distilled water.PCR reaction conditions：94 °C of min of pre-degeneration 5;94 °C of denaturation 30 s, 58 °C of annealing 30 s, 72 °C of extension lmin, 33 circulations；72 °C of 10 min of extension), positive plant is preserved, numbering is T respectively.J1 to T.J20.Choose T.J1-T.J5 seed carries out cold-resistant simulated experiment and the Function Identification in the overexpression of embodiment 6 GhCBFl transgene tobacco generation

Sterilized vermiculite is impregnated with 1/2MS culture mediums.By T_QFor transgene tobacco T.J1, TJ2, TJ3, TJ4 and ToJ5 seed and Wild-type non-transgenic control tobacco seed are sowed on vermiculite respectively, 25th, optical culture/14 hour light culture circulation in 10 hours, pour a 1/2MS culture medium within every 5 days, after culture 25 days, win bottom leaf, extract genomic DNA (arabidopsis DNA extraction method in be the same as Example 3）, utilize primer SEQ ID NO:17 and SEQ ID NO:18 do PCR identifications（Reaction and condition are ibid）, reject negative plant（Control tobacco similarly wins leaf）.Picking transgene tobacco of the same size（Each 10 plants of TJ1, TJ2, TYJ3, TJ4 and TJ5, numbering is TJ1-1 respectively To TJl-lC TJ2-1 to 1^2-10, TiJ3-lSTiJ3-10, TJ4-1 to TJ4-10 and TJ5-1 to TJ5-10), control tobacco（10 plants）Do cold-resistant experiment.Transgene tobacco, control tobacco, 4 °C are coerced 72 hours.Again by 14 days renewal cultivations.Plant pair plant is then taken out to be weighed.Above-mentioned T shows that adjoining tree can not restore normal growth for the cold hardness evaluation of transfer-gen plant, and growth is substantially suppressed, and transfer-gen plant growth shows obvious winter resistance apparently higher than adjoining tree（Accompanying drawing 3 and table 1).In figure 3, transfer-gen plant ^1-3 and one plant of control exemplary display of tobacco are chosen, the result of other tobaccos is similar with them.Embodiment 7 is overexpressed drought resisting simulated experiment and the Function Identification in GhCBFl transgene tobacco ^ generations

Sterilized vermiculite is impregnated with 1/2MS culture mediums.By T.For transgene tobacco T.J1、 TJ2、 TJ3、 T.J4 and J5 seed and control tobacco seed is sowed on vermiculite respectively, 25th, optical culture/14 hour light culture circulation in 10 hours, pour a 1/2MS within every 5 days, after culture 25 days, win bottom leaf, extract genomic DNA (arabidopsis DNA extraction method in be the same as Example 3）, utilize primer SEQ ID NO:17 and SEQ ID NO:18 do PCR identifications, reject negative plant（Control tobacco similarly wins leaf）.Picking transgene tobacco of the same size（TJ1、 TJ2、 TiJ3 , T!Each 10 plants of J4 and TJ5, numbering is ^- to ^^ respectively., 1^2- 11 to 1^2-20, T!D-l l to TiJ3-20, TJ4-11 are to TJ4-20 and TJ5-11 to Τ 5-20), control tobacco（10 plants）Do drought-enduring experiment.Transgene tobacco, arid 14 days (not the watering) of control tobacco, 25 V, optical culture/14 hour light culture circulation in 10 hours.Plant pair plant is then taken out to be weighed.Above-mentioned ^ shows for the Identification of Drought of transfer-gen plant, adjoining tree wilt it is serious, and transfer-gen plant can normal growth, show obvious drought resistance（Accompanying drawing 4 and table 1).In Fig. 4, transfer-gen plant TJ4-15 and one plant of control exemplary display of tobacco are chosen, the result of other tobaccos is similar with them.

Table 1

Claims (10)

1. Claims

   1. a DREB class transcription factor for cotton, its sequence is SEQ ID N0: 1.

   2. encode the nucleotide sequence of the transcription factor described in claim 1.

   3. the nucleotide sequence described in claim 2, it is characterised in that with SEQ ID NO:Nucleotide sequence shown in 2.

   4. a kind of recombinant expression carrier, it contains the nucleotide sequence described in Claims 2 or 3 and the nucleotide sequence is operably connected with the expression control sequence of the expression vector；Preferably, the carrier is the rd29A-GhCBFl-2300 carriers shown in accompanying drawing 2.

   5.-kind of recombinant cell, it contains the recombinant expression carrier described in nucleotide sequence or claim 4 described in Claims 2 or 3；Preferably, the recombinant cell is restructuring agrobatcerium cell.

   6. a kind of method of improvement plant cold-resistant and/or drought resistance, including：Recombinant expression carrier described in nucleotide sequence or claim 4 described in Claims 2 or 3 is imported into plant or plant tissue and makes the gene expression；Preferably, the plant is tobacco.

   7. a kind of method of prepare transgenosis plant, including：The plant containing the recombinant expression carrier described in the nucleotide sequence or claim 4 described in Claims 2 or 3 or plant tissue are cultivated under conditions of plant is effectively produced.

   8. the method described in claim 7, wherein the plant is tobacco.

   9. the recombinant expression carrier described in nucleotide sequence, claim 4 described in the transcription factor of claim 1, Claims 2 or 3 or the recombinant cell described in claim 5 are used to improve plant cold-resistant and/or drought resistance and the purposes for plant breeding.

   10. the purposes described in claim 9, wherein the plant is tobacco.