WO2013181834A1 - Dreb1 transcription factor of cotton and coding gene and application thereof - Google Patents

Abstract

A DREB1 transcription factor GhCBF1 derived from cotton and a coding gene thereof are provided. An application of the transcription factor in cultivating transgenic plants with stress tolerance such as improved cold tolerance and drought resistance is further provided.

Description

 FIELD OF THE INVENTION The present invention relates to plant transcription factors and coding genes thereof and applications thereof, and in particular to a cotton-derived

The DREB1 transcription factor GhCBF1 and its coding gene, and its application in the cultivation of transgenic plants with improved tolerance. BACKGROUND OF THE INVENTION Abiotic stresses, such as drought, salting, extreme temperature, chemical pollution and oxygen damage, can cause serious damage to plant growth and development, and cause great loss to crop yield, among which drought has an impact on crop yield. It takes the first place in natural adversity, and its harm is equivalent to the sum of other disasters. It is the bottleneck of agricultural development in many areas. According to statistics, the world's dry and semi-dry areas account for 34% of the land area; China's dry and semi-arid areas account for 52% of the country's land area, and the annual area is 20 to 2.7 million hectares. About 3 billion cubic meters, less than 300-400 million kilograms of food due to lack of water; especially China's main grain-producing areas such as North China, Northeast China and Northwest China are the most severe areas in China, and the spring drought frequently reaches 10 years. .

Since the stress tolerance of plants is mostly quantitative, the available germplasm resources are scarce. It is very difficult to improve the stress tolerance of plants by conventional breeding techniques. It is especially difficult to cultivate true stress-tolerant varieties. In recent years, with the deepening of research on the molecular mechanism of plant stress resistance and the rapid development of molecular biology technology, stress resistance research has progressed from physiological level to molecular level, which promoted the development of plant stress resistance genetic engineering. When plants are stressed, they will respond accordingly to reduce or eliminate the damage to plants. This response of plants is a complex process involving multiple genes, multiple signaling pathways, and multiple gene products. These genes and their expression products can be divided into three categories: (1) genes and products involved in signal cascade amplification and transcriptional control; (2) genes and their expression products that directly contribute to the protection of biofilms and proteins; ) Proteins associated with the uptake and transport of water and ions. In recent years, studies on the ability of plants to improve stress tolerance through transgenic techniques, as well as studies on stress-tolerant crops, xerophytes and halophytes have yielded significant results for stress-related genes and signal transduction. The system has a further understanding (Liu Q.1998. Two transcrip tion facto rs, DREB1 and DREB2, w ith an EREBP/AP2 DNA binding domain, separate two cellular signal transduction pathways in drought-and low temperature-responsive gene exp ression , respectively, in A rabidopsis. Plant Cell, 10: 1391-1406; KAN GJY.2002. A rabid op sis basic leucine zipper p ro teins that mediate Stress2responsive abscisic acid signaling. Plant Cell, 14: 343-357; ABE H.2003.A rabid op sis AtMYC2 (bHLH) and AtMYB2(MYB) function as transcrip tional activato rs in abscisic acid signaling. Plant Cell, 15: 63-78.

 However, as far as the current research situation is concerned, due to the complexity of its mechanism, the biochemical and physiologic response mechanisms of many plants to stress remain to be further studied. Studies on the function and expression regulation of stress-responsive genes account for the majority, but the link between stress-resistance-related signaling pathways and the mechanism of the entire signaling network system remains to be further studied. Although many research institutes have acquired a variety of transgenic plants with certain resilience through modern biotechnology, they have not yet reached the standard of industrialization. Therefore, there is still much work to be done to improve plant stress resistance.

SUMMARY OF THE INVENTION The present inventors cloned a DNA sequence encoding a DREB (dehydration responsive element binding protein) transcription factor (designated herein as GhCBFl) using a combination of SSH and RACE. It was found that the introduction of the transgenic plants significantly improved the cold resistance and early resistance of the transgenic plants, and these traits were stably inherited.

 A first aspect of the invention provides a DREB-like transcription factor GhCBF1 of cotton having the sequence SEQ ID NO: l o

 A second aspect of the invention provides a nucleotide sequence encoding the transcription factor of the first aspect of the invention. Preferably, the nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 2.

 A third aspect of the invention provides a recombinant expression vector comprising the nucleotide sequence of the second aspect of the invention and the nucleotide sequence is operably linked to an expression control sequence of the expression vector; preferably, The vector is the rd29A-GhCBF 1-2300 vector shown in Figure 2.

 A fourth aspect of the present invention provides a recombinant cell comprising the nucleotide sequence of the second aspect of the present invention or the recombinant expression vector of the third aspect of the present invention; preferably, the recombinant cell is a recombinant Agrobacterium cell .

 A method for improving cold tolerance and/or early resistance of a plant according to the fifth aspect of the invention, comprising: introducing the nucleotide sequence of the second aspect of the invention or the recombinant expression vector of the third aspect of the invention into a plant or Plant tissue and expression of the gene; preferably, the plant is tobacco.

 A method for producing a transgenic plant according to a sixth aspect of the present invention, comprising: cultivating a plant comprising the nucleotide sequence of the second aspect of the present invention, the recombinant expression vector of the third aspect of the present invention, under conditions effective for producing a plant Or plant tissue; preferably, the plant is tobacco.

A seventh aspect of the present invention provides the transcription factor of the first aspect of the present invention, the nucleoside of the second aspect of the present invention The acid sequence, the recombinant expression vector of the third aspect of the invention or the recombinant cell of the fourth aspect of the invention for improving cold tolerance and/or early resistance of the plant and for use in plant breeding; preferably, said The plant is tobacco.

 Brief Description of the Drawings Fig. 1 is a construction flow of a plant expression vector (rd29A-GhCBF1-2300) of GhCBF1.

 Figure 2 is a plasmid map of the plant expression vector (rd29A-GhCBF1-2300) of GhCBF1.

 Figure 3 shows the experimental results of cold resistance of transgenic tobacco. The left side of the figure is the transgenic plant (TJ1-3); the right side is the non-transgenic plant (control).

 Figure 4 shows the experimental results of drought resistance of transgenic tobacco. The left side of the figure is the transgenic plants (TJ4-15); the right side is the non-transgenic plants (control). BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be further illustrated by the following non-limiting examples.

 The restriction enzymes mentioned in the examples below were all purchased from New England Biolabs. Example 1 Cotton SSH library construction under cold stress:

 The specific method is:

Using Clontech's PCR-select ^TM cDNA Subtraction Kit, according to the method shown subtractive library constructed by the product specification suppression subtractive hybridization method. The mRNA of cotton seedling leaves treated with low temperature for 6 h was used as a tester during the experiment, and the mRNA of untreated cotton seedling leaves was used as a control (drivei^

(1) Test materials - 冀 cotton 14 (National Cotton Medium Term Bank, obtained by the China Cotton Research Institute, Uniform No.: ZM-30270) sown on sterilized vermiculite at 25 ° C, photoperiod 16 h / 8 h conditions Under the culture, 1/2 MS medium (9.39 mM KN0 ₃ , 0.625 mM KH ₂ P0 ₄ , 10.3 mM NH ₄ N0 ₃ , 0.75 mM MgS0 ₄ , 1.5 mM CaCl ₂ , 50 μ M KI, lOOu MH3BO3, 100 uMMnSO ₄ per week) , 30 uM ZnSO ₄ , 1 u MNa ₂ Mo0 ₄ , 0.1 u M CoCl ₂ , 100 MNa ₂ EDTA, 100 MFeSO ₄ ) once. It was used for experiments when the seedlings were as high as 25-30 cm.

 (2) Material handling:

The test seedlings were divided into 2 groups, 4 pots per group and 1 pot per pot. The first group was the control group, cultured at 25 ° C, light. The second group was a low temperature treatment group, which was treated at 4 ° C for 6 hours at low temperature and cultured in light. After the treatment, the leaves of the top 1/3 of the seedlings of the two groups were cut out in time, quickly frozen with liquid nitrogen, and stored in a -70 °C refrigerator.

 (3) Total RNA extraction:

 0.5 g of control and low temperature treated cotton leaves were taken, and total RNA of cotton was extracted using a plant RNA extraction kit (invitrogen). The absorbance of total RNA at 260 nm and 280 nm was measured by HITACHI's UV spectrophotometer U-2001. The OD260/OD280 ratio was 1.8-2.0, indicating that the total RNA purity was high. Total RNA was detected by 1.0% agarose gel electrophoresis. The integrity of the 28S strip is about twice that of the 18S strip, indicating good RNA integrity. mRNA was isolated using Qiagen's Oligotex mR A purification kit (purification of polyA+ RNA from total RNA).

 (4) Inhibition subtractive hybridization:

 In order to increase the availability of ESTXunigene, to avoid gene-free cleavage sites and to obtain sequences in untranslated regions, our laboratory uses Clontech's PCR-selectTM cDNA Subtraction Kit, according to the manufacturer's instructions, using Rsal, Haelll, respectively. The double-stranded cDNA of the isolated mRNA was digested, and two sets of suppression subtractive hybridization were performed. The other steps and methods were carried out in strict accordance with the method shown in Clontech's PCR-selectTM cDNA Subtraction Kit product specification, and the two groups were combined with positive subtraction. The second PCR product of the hybrid cDNA fragment.

 (5) Construction and preliminary screening, cloning and identification of cDNA subtractive library

The second PCR product of the combined forward subtractive hybridization cDNA fragment (QIAquick PCR Purification Kit purified from Qiagen) was ligated with pGEM-T Easy vector (purchased from Promega) according to the pGEM-T Easy kit product specification. The specific steps are as follows: the following components are sequentially added by using a 200 ul PCR tube: the second PCR product of the purified cDNA fragment is 3 ul, the T4 ligase buffer is 5 ul, the pGEM-T Easy vector is ul, the T4 DNA ligase is lul, at 4 °C overnight. The reaction product was ligated to ΙΟΟμί competent Escherichia coli JM109 (purchased from TAKARA), ice bath for 30 min, heat shock for 60 s, ice bath for 2 min, and 250 μL LB medium (1% Tryptone was purchased from OXOID, 0.5). % Yeast Extract was purchased from OXOID, 1% NaCl was purchased from Sinopharm. It was placed in a 37 °C shaker, 225 r/min was shaken for 30 min, and 200 μM solution was added to 50 μg/mL ampicillin, 40 ug/mL. X-gal, 24 ug/mL IPTG (X-gal/IPTG was purchased from TAKARA) on LB (ibid.) solid culture plates, incubated at 37 °C for 18 h. Count the number of clear white and blue colonies with a diameter > 1 mm in the culture plate, and randomly pick 200 white colonies (number: Gh-C001 to Gh-C200) in 96 LB liquid medium containing 50 ug/mL ampicillin. In a well cell culture plate (CORNING), incubated at 37 ° C overnight, glycerol was added to a final concentration of 20%, and stored at -80 ° C for later use. Nested PCR primer Primer 1 (PCR-selectTM cDNA Subtraction Kit kit) and Primer 2R (PCR-selectTM cDNA Subtraction Kit kit) were used for PCR amplification of PBS. Cloning, sequencing of all positive clones sent to Yingjie Jieji (Shanghai) Trading Co., Ltd.

 (6) cDNA sequencing analysis of differential clones:

 After the DNA sequencing results were removed from the vector and the ambiguous sequence and the excess cDNA, 112 ESTs (unigene;) were obtained. BlastN found that 52 unigenes have homologous sequences in GenBank (similar to more than 50%), 25 ESTs are unknown or hypothetical proteins, and 35 have not obtained homologous matches, presumably at 3 ', 5 ' A shorter sequence of terminal untranslated regions. Example 2 Cloning of the gene encoding GhCBF1

 In the unigene having the homologous sequence of Example 1, the clone Gh-C021 sequence is as shown in SEQ ID NO: 3:

Sequence analysis indicated that the encoded amino acid sequence of the sequence belongs to the DREB1 class protein, and the protein was named GhCBF1.

 (1) Cloning of the full-length gene of GhCBF1

 Based on the gene fragment of GhCBF 1 that has been obtained, two specific primers were designed as the 5 ' end specific primer of 3 ' RACE:

 GhCBFl GSP1 : SEQ ID NO: 4:

 CCTACACCTGAAATGGCTGCACGA

 GhCBFl GSP2: SEQ ID NO: 5:

 CGAGCACATGATGTTGCTGCA

 The experimental procedure was carried out according to the kit instructions ( 3 ' RACE System for Rapid Amplification of cDNA Ends kit, purchased from invitrogen)

The first round of PCR amplification was carried out using SEQ ID NO: 4 and the 3' primer AUAP (provided with the kit), using mRNA reverse transcribed cDNA as a template. The specific steps are as follows: Ex Taq purchased from TAKARA, 50 μ1 ΡΟ Reaction system: 5 μΐ ΙΟχΕχ Buffer, 3 μΐ 2.5 mM dNTP, 2.0 μΐ mRNA reverse transcribed cDNA, 1.0 μΐ Ex Taq, 10 μΜ primer SEQ ID NO : 4 and AUAP each 2.0μ1, and 35 μΐ double distilled water. PCR reaction conditions: 94 °C Pre-denaturation for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, 33 cycles; extension at 72 °C for 10 min.

 The obtained PCR product was diluted 100-fold with double-distilled water, and 2.0 μl was used as a template, and the second round of PCR amplification was carried out using SEQ ID NO: 5 and 3, the terminal primer AUAP, and the specific steps were as follows: 50 μΙ ΡΟΙ Reaction system: 5 μΐ ΙΟχΕχ Buffer, 3 μΐ 2.5 mM dNTP, 2.0 μΐ first round of diluted PCR product, 1.0 μΐ Ex Taq, 10 μΜ primers SEQ ID NO: 5 and AUAP each 2.0 μl, and 35 μΐ double distilled water. PCR reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, 33 cycles; extension at 72 °C for 10 min. The second PCR product (QIAquick PCR Purification Kit purified from Qiagen) was ligated to pGEM-T Easy Vector, transformed into E. coli JM109 (specifically the same as above), and 10 white colonies were randomly picked up to contain 50 ug/mL ampicillin. The penicillin was cultured in LB liquid medium, cultured at 37 ° C overnight, and then glycerin was added to a final concentration of 20%, and stored at -80 ° C until use. SEQ ID NO: 5 and 3' primer AUAP were used for PCR amplification (system and conditions are the same as above), and 5 positive clones were obtained, which were sent to Yingji Jieji (Shanghai) Trading Co., Ltd. for sequencing, and 3 of the cDNA of the gene was obtained. 'end.

 Based on the gene fragment of GhCBF1 that has been obtained, three specific primers were designed as mRNA reverse transcription primers (SEQ ID NO: 6) and 5' RACE 3' terminal specific primers (SEQ ID NOS: 7 and 8).

 GhCBFl GSP3: SEQID O: 6:

 GTTAACCTCGACGCCACTCG A

 GhCBFl GSP4: SEQID O: 7:

 CTTTTACCTCTAAACGCTAA TG

 GhCBFl GSP5: SEQID O: 8:

 TGCAGCAACATCATGTGCTC GTG

 The experimental procedure was performed according to the kit instructions (5' RACE System for Rapid Amplification of cDNA Ends kit, purchased from Invitrogen). SEQ ID NO: 6 is a primer that is reverse transcribed into cDNA into mRNA.

The first round of PCR amplification was carried out using SEQ ID NO: 7 and 5' universal primer AAP (provided with the kit), and cDNA reverse transcription cDNA (reverse transcription primer SEQ ID NO: 6) was used as a template. The specific steps are as follows: Ex Taq Purchased from TAKARA, 50 μΐ PC Reaction system: 5 μΐ ΙΟχΕχ Buffer, 3 μΐ 2.5 mM dNTP, 2.0 μΐ total RNA reverse transcribed cDNA, 1.0

10 μΜ of the primers SEQ ID NO: 7 and AAP each 2.0 μl, and 35 μΐ of double distilled water. PCR reaction conditions: predenaturation at 94 °C for 5 min; 94 变性 denaturation for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, 33 cycles; 72 "C extension for 10 min.

The obtained PCR product was diluted 100-fold with double distilled water, and then 2.0 μL was used as a template. The second round of PCR amplification was carried out with SEQ ID NO: 8 and the 3' primer AUAP. The specific steps were as follows: 50 l PCR reaction system: 5 μΐ ΙΟχΕχ Buffer, 3 μΐ 2.5 mM dNTP, 2.0 μΐ first round of diluted PCR product, 1.0 μΐ Ex Taq, 10 μΜ SEQ ID NO: 8 and AUAP were each 2.0 μl, and 35 μΐ of double distilled water. PCR reaction conditions: predenaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, 33 cycles; extension at 72 °C for 10 min. The second PCR product (QIAquick PCR Purification Kit purified from Qiagen) was ligated to pGEM-T Easy Vector, transformed into JM109 (specific method as above), and 10 white colonies were randomly picked up to contain 50 ug/mL ampicillin. Incubate in LB liquid medium, incubate at 37 °C overnight, add glycerol to a final concentration of 20%, and store at -80 °C until use. SEQ ID NO: 8 and the 3' primer AUAP were used for PCR amplification (reaction system and reaction conditions as above), and 4 positive clones were obtained and sent to Guangzhou Yingjie Jieji (Shanghai) Trading Co., Ltd. for sequencing. The 5' end of the cDNA.

 The obtained 5 ' RACE product was cloned and sequenced, and spliced with the 3 ' RACE product sequencing result. The full-length cDNA sequence of GhCBF1 was obtained. A pair of primers were designed based on the full-length cDNA sequence of GhCBF1 as follows:

 G CBFlF: SEQ ID NO: 9:

 ATGGCGGCAGAAACGGCGGAGACACC

 GhCBFIR: SEQ ID NO: 10:

 TCAGTAACTCCACAAGGAAACA

 The full length of the GhCBF1 encoding gene was cloned by SEQ ID NO: 9 and B SEQ ID NO: 10.

 PCR was performed using TaKaRa's PrimeSTAR HS DNA polymerase and cotton cDNA as a template. 50 l PCR reaction system: 10 1 5 X PS Buffer, 3 μ 1 2.5 mM continuous P, 2.0 1 cDNA, Ι.Ο μ 1 PrimeSTAR, 10 μM primer SEQ ID NO: 9 and SEQ ID NO: 10 2.0 μl, 30 μΐ each of double distilled water. PCR reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 60 s, 33 cycles; extension at 72 °C for 10 min.

The PCR amplification product was added with A: PCR product plus 2.5 times absolute ethanol, placed at -20 ° C for 10 minutes, centrifuged, de-cleared, air-dried, and dissolved in 21 μl of double distilled water. Add 2.5 ul 10 X Ex Buffer, 0.5 ul 5 mM dATP, 2.5 ul lO X Ex Taq. Reaction conditions: The reaction was carried out at 70 ° C for 30 minutes. A DNA fragment of about 600 bp was recovered (Omega recovery kit), cloned into pGEM T-easy vector, and transformed into JM109C method as above). Ten white colonies were randomly picked and cultured in LB liquid medium containing 50 ug/mL ampicillin. After incubation at 37 ° C overnight, glycerol was added to a final concentration of 20%, and stored at -80 ° C until use. SEQ ID NO: 9 and SEQ ID NO: 10 were used for bacterial liquid PCR amplification (reaction system and reaction conditions are the same as above), and 4 positive clones were obtained, which were sent to Yingjie Jieji (Shanghai) Trading Co., Ltd. for sequencing, and the sequence was SEQ ID NO. : 2. Its protein expression sequence is SEQ ID NO: 1. Amino acid sequence of GhCBF1: SEQ ID NO: 1 1 MAAETAETPS SSSEEVYSLA

 21 TSKPKKRAGR RIFKETRRPI

 41 FRGVRQRKV KWVCELREPN

 61 KKTRIWLGTY PTPEMAARAH

 81 DVAALAFRGK SACLNFADSA

 101 WKLPLPASMD AIDIRRAAVE

 121 AAEAFRPKES EEPLGGGGTR

 141 QGSVEACSSG VEVNFVDEEA

 161 MFDMPNLLAS MAEGLLLSPP

 181 RST RDDDDD DSDIDVSLWS

 201

Nucleotide sequence of the GhCBF1 encoding gene: SEQ ID NO: 2

Example 3 Construction of GhCBF1 Plant Expression Vector

 The plant expression vector rd29A-GhCBFl-2300 was constructed as shown in Figure 1.

The plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as a plant expression vector, and the Pnos promoter was used to replace the 35S promoter of the PTII gene containing the double enhancer to reduce the expression of prion protein in plants. . Inducible promoter rd29A and Tnos were selected as promoters of GhCBF1 gene Sub and terminator. Specific steps are as follows:

 Pnos was amplified using the plant expression vector PBI121 (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) using SEQ ID NO: 11 and SEQ ID NO: 12, using TaKaRa's PrimeSTAR HS DNA polymerase. 50 μΐ PCR reaction system: 10 μΐ 5 xPS Buffer, 3 μΐ 2.5 mM dNTP, 1.0 μ1 ΡΒΙ121, 1.0 μΐ PrimeSTAR, 10 μΜ primers SEQ ID NO: 11 and SEQ ID NO: 12 each 2.0 μl, and 31 μΐ Double distilled water. PCR reaction conditions: predenaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, extension at 72V for 30 s, 33 cycles; extension at 72 °C for 10 min, product ligated by EcoRI, Bglll pCAMBIA2300-1 was obtained by pCAMBIA2300 (promega T4 ligase cassette).

 SEQ ID NO: 11:

 GCAC GAATTC ATACAAATGGACGAACGGAT

SEQ ID NO: 12:

 ATCC AGATCT AGATCCGGTGCAGATTATTTG

 Tnos was amplified using SEQ ID NO: 13 and SEQ ID NO: 14 with PBI121 as a template, using TaKaRa's PrimeSTAR HS DNA polymerase. 50 μΐ PCR reaction system: 10 μΐ 5 xPS Buffer, 3 μΐ 2.5 mM dNTP, 1.0 μ1 ΡΒΙ121, 1 0 μΐ Prime STAR, 10 μΜ primers SEQ ID NO: 13 and SEQ ID NO: 14 each 2.0 μ1, and 31 ΐ ΐ double distilled water. PCR reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 V for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, 33 cycles; extension at 72 °C for 10 min. The product was cleaved by Sacl, EcoRI and ligated into pCAMBIA2300-1 to obtain pCAMBIA2300-2.

 SEQ ID O: 13:

 AAGGAGCTCGAATTTCCCCGATCGTTCAAA SEQ ID O: 14:

 TCAGAATTC CCAGTGAATT CCCGATCTAG TA

Amplification of the Arabidopsis thaliana rd29A promoter using SEQ ID NO: 15 and SEQ ID NO: 16 using Arabidopsis thaliana (Columbia type, available from www.arabidopsis.org) genomic DNA (see Zeng J., et L 2002) , Preparation of total DNA from "recalcit rant plant taxa", Acta Bot. Sin., 44(6): Method 694-697 for extracting Arabidopsis DNA). PrimeSTAR HS DNA polymerase using TaKaRa. 50 μΐ PCR reaction system: 10 μΐ 5×PS Buffer, 3 μΐ 2.5 mM dNTP, 1.0 μΐ Arabidopsis DNA, 1.0 μΐ PrimeSTAR 10 μΜ primers SEQ ID NO: 15 and SEQ ID NO: 16 each 2.0 μl, and 31 μΐ Double steamed water. PCR reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72V for 30 s, 33 cycles; extension at 72 °C for 10 min, PCR products were digested by HindIII, Sail Connect to pCAMBIA2300-2 to obtain pCAMBIA2300-3. SEQ ID NO: 15:

 ACTAAGCTTCCTTCTTGACATCATTCAATTTTA SEQ ID NO: 16:

 TGAGTCGACTCCAAAGATT TTTTTCTTTC CAATAG

 The GhCBF1 gene was amplified using SEQ ID NO: 17 and SEQ ID NO: 18 (template was the pGEM T-easy recombinant vector containing the GhCBF1 gene obtained in Example 1), and TaKaRa's PrimeSTAR HS DNA polymerase was used. 50 μΐ PCR reaction system: 10 μΐ 5×PS Buffer , 3 μΐ 2.5 mM dNTP, 1.0 μΐ GhCBF1-pGEM, 1.0 μΐ PrimeSTAR, 10 μΜ primers SEQ ID NO: 17 and SEQ ID NO: 18 each 2.0 μ1, and 31 ΐ ΐ double distilled water. PCR reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, 33 cycles; extension at 72 °C for 10 min. The plant expression vector, rd29A-GhCBFl-2300, was obtained by cleavage of Sall and Sacl to pCAMBIA2300-3.

 SEQ ID NO: 17:

 TGAGTCGAC ATGGCGGCAGAAACGGCGGAGACACC SEQ ID NO: 18:

 AAGGAGCTC TCAGTAACTC CACAAGGAAA CA Example 4 rd29A-GhCBFl-2300 Expression Vector Transformation Agrobacterium

Agrobacterium tumefaciens LBA4404 (purchased from Biovector Science Lab, Inc) Competent preparation: Agrobacterium LBA4404 was placed on LB solid medium containing 5 (^g/ml rifampicin and 5 (^g/ml streptomycin) 1-2d in advance. Single spotted inoculation, cultured at 28 °C for 1 to 2 days. Pick a single colony and inoculate 5 ml of LB liquid medium containing 50μ _§ /ηι1 rifampicin and 50μ _§ /ηι1 streptomycin, and shake overnight at 28 °C (about 12 -16h) to an OD600 value of 0.4, to form a seed bacterial solution. Take 5ml of activated bacterial solution (1:20 ratio) inoculated in 100ml of the same concentration of antibiotics in LB liquid medium, shake at 28 ° C for 2-2.5h To OD600=0.8. Ice bath liquid for 10min, shake once every 3min, so that the bacteria evenly enter the dormant state. Centrifuge at 4000g for 10min at 4°C, discard the supernatant; add a certain amount of pre-cooled 10% glycerol resuspended bacteria Body, centrifuged at 4000g for 10min at 4 °C for 10min, collect the precipitate; wash 3-4 times with 10% glycerol; add the appropriate amount of ice bath pre-cooled 10% glycerol to resuspend the bacterial pellet, dispense it in 40μ1/tube, at - Store at 70 ° C for later use.

Transformation of Agrobacterium: The competent cells were thawed on ice, and Ιμΐ rd29A-GhCBF 1-2300 plasmid was added to 40 μl of competent cells, and the mixture was mixed and ice bathed for about 10 min. Transfer the mixture of competent and DNA to a pre-cooled electric shock cup with a gun and tap to bring the suspension to the bottom, taking care not to have air bubbles. Place the electric shock cup (purchased from bio-rad) on the slide of the electric shock chamber and push the slide to place the electric shock cup on the base electrode of the electric shock chamber. When using a 0.1cm electric shock cup, the program of the MicroPulser (purchased from bio-rad) is set to "Agr" and the electric shock is applied once. Take out the electric shock cup immediately, plus Pre-heated LB medium at 28 °C. Quickly and gently spread the cells with a gun. The suspension was transferred to a 1.5 ml centrifuge tube and incubated at 28 ° C, 225 rpm for 1 h. Take 100~200μ1 of bacterial solution coated with the corresponding resistance screening medium (LB solid medium, containing 50μ _§ / ηι1 rifampicin, 50μ _§ / ηι1 streptomycin, 50μ _§ / ηι1 kanamycin) plate On, culture at 28 °C. Example 5 Obtaining Transgenic Tobacco by Agrobacterium-mediated Transformation

To soak the tobacco seeds with 75% alcohol (National Tobacco Medium Term Bank, obtain the Tobacco Institute of the Chinese Academy of Agricultural Sciences, library number I5A00660) for 30s, then soak for 10min with 0.1% liters of mercury for surface disinfection. The sterile tobacco seeds were placed in MS solid medium (18.78 mM KN0 ₃ , 1.25 mM KH ₂ P0 ₄ , 20.6 mM NH4NO3, 1.5 mM MgS0 ₄ , 3.0 mM CaCl ₂ , 50 μM KI, 100 μM H3BO3 , 100 μ M MnS0 ₄ , 30 μ M ZnS0 ₄ , 1 M Na ₂ Mo0 ₄ , 0.1 u M CoCl ₂ , 100 μ M Na ₂ EDTA, 100 u M FeSO ₄ , 7.4 g/L agar, sucrose 30 g L) The bacteria are germinated to prepare sterile seedlings. The leaves of the sterile seedlings were cut into 5 mm X 5 mm leaf discs, and the leaf discs were inoculated with Agrobacterium containing the expression vector in the logarithmic growth phase for 10 min, and the bacterial liquid was absorbed and co-cultured for 2 days in the dark (MS medium). ). The leaves were transferred to a differentiation medium (MS + 1 mg / L BA + 0.1 mg / L NAA + 50 mg / L kanamycin + 500 mg / L cephalosporin), cultured under light conditions for about 45 days, to grow buds After cutting, transfer to rooting medium (MS+50mg/L kanamycin+500mg/L cephalosporin) for about 30 days. After the root system is developed, the seedlings are transferred to only 500mg/L cephalosporin. The number was saved on the MS medium.

 The obtained transgenic tobacco leaves were extracted, and genomic DNA was extracted (the Arabidopsis thaliana DNA extraction method in Example 3), and PCR was carried out using primers SEQ ID NO: 17 and SEQ ID NO: 18 (50 μΐ PCR reaction system: 5 μΐ ΙΟχΕχ Buffer, 3 μΐ 2.5 mM dNTP, 2.0 μΐ DNA, 1.0 μΐ Ex Taq, 10 μΜ primers SEQ ID NO: 17 and SEQ ID NO: 18 each 2.0 μl, and 35 μΐ double distilled water. PCR reaction conditions: 94 Pre-denaturation at °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, 33 cycles; extension at 72 °C for 10 min), and storing positive plants, numbered T. J1 to T. J20. Select T. J1-T. Seeds of J5 were carried out. Example 6 Over-expression of GhCBF1 transgenic tobacco generation cold-resistant simulation experiment and functional identification

The sterilized vermiculite was soaked in 1/2 MS medium. T _Q generation transgenic tobacco T. Seeds of J1, TJ2, TJ3, TJ4 and ToJ5 and wild-type non-transgenic control tobacco seeds were sown on vermiculite, 25 Ό, 10 hours light culture/14 hours dark culture cycle, and 1/2 MS medium was poured every 5 days. After culturing for 25 days, the lowest leaf was extracted, and genomic DNA was extracted (the Arabidopsis DNA extraction method in Example 3), and PCR was identified using primers SEQ ID NO: 17 and SEQ ID NO: 18 (reaction and conditions are the same as above) ), the negative plants were removed (the same leaves were taken from the control tobacco). Picking up the same size of transgenic tobacco (TJ1, TJ2, TYJ3, TJ4 and TJ5 each 10 strains, numbered TJ1-1 To TJl-lC TJ2-1 to 1^2-10, TiJ3-lSTiJ3-10, TJ4-1 to TJ4-10 and TJ5-1 to TJ5-10), control tobacco (10 strains) were subjected to cold resistance experiments. Transgenic tobacco, control tobacco, stressed at 4 ° C for 72 hours. The culture was resumed after another 14 days. The plants are then removed and the plants are weighed. The cold resistance of the above T-transgenic plants showed that the control plants could not resume normal growth, and the growth was significantly inhibited, while the transgenic plants grew significantly higher than the control plants, showing obvious cold resistance (Fig. 3 and Table 1). In Figure 3, the selection of transgenic plants ^ 1-3 and a control tobacco exemplarily showed that the results of other tobaccos were similar to them. Example 7 Drought-resistant simulation experiment and functional identification of transgenic tobacco overexpressing GhCBF1

 The sterilized vermiculite was soaked in 1/2 MS medium. Will T. Generation of genetically modified tobacco T. J1, TJ2, TJ3, T. Seeds of J4 and J5 and control tobacco seeds were separately sown on vermiculite, 25 Ό, 10 hours light culture/14 hours dark culture cycle, 1/2 MS was poured every 5 days, and after 25 days of culture, the lowermost leaves were taken. Genomic DNA was extracted (the Arabidopsis thaliana DNA extraction method in the same manner as in Example 3), and PCR was performed using primers SEQ ID NO: 17 and SEQ ID NO: 18, and the negative plants were knocked out (the control tobacco also extracted a leaf). Pick up the same size of transgenic tobacco (TJ1, TJ2, TiJ3, T!J4 and TJ5 each 10, numbered ^- to ^^., 1^2- 11 to 1^2-20, T!Dl l to TiJ3-20, TJ4-11 to TJ4-20 and TJ5-11 to Τ 5-20), and control tobacco (10 strains) were tested for drought tolerance. Transgenic tobacco, control tobacco drought for 14 days (without watering), 25 V, 10 hours light culture / 14 hours dark culture cycle. The plants are then removed and the plants are weighed. The drought resistance of the above-mentioned transgenic plants showed that the control plants were wilting, and the transgenic plants were able to grow normally, showing significant drought resistance (Fig. 4 and Table 1). In Figure 4, the selection of the transgenic plants TJ4-15 and a control tobacco showed that the results of other tobaccos were similar.

Table 1

Claims

Claim

1. A DREB-like transcription factor of cotton having the sequence SEQ ID NO: 1.

 2. A nucleotide sequence encoding the transcription factor of claim 1.

 The nucleotide sequence according to claim 2, which has the nucleotide sequence shown by SEQ ID NO: 2.

A recombinant expression vector comprising the nucleotide sequence of claim 2 or 3 and operably linked to an expression control sequence of the expression vector; preferably, the vector is The rd29A-GhCBF1-2300 carrier shown in Figure 2 is shown.

 A recombinant cell comprising the nucleotide sequence of claim 2 or 3 or the recombinant expression vector of claim 4; preferably, the recombinant cell is a recombinant Agrobacterium cell.

 A method for improving cold tolerance and/or drought resistance of a plant, comprising: introducing the nucleotide sequence of claim 2 or 3 or the recombinant expression vector of claim 4 into a plant or plant tissue and Gene expression; Preferably, the plant is tobacco.

 A method for producing a transgenic plant, comprising: cultivating a plant or plant tissue comprising the nucleotide sequence of claim 2 or 3 or the recombinant expression vector of claim 4 under conditions effective to produce a plant.

 8. The method of claim 7 wherein the plant is tobacco.

 9. The transcription factor of claim 1, the nucleotide sequence of claim 2 or 3, the recombinant expression vector of claim 4 or the recombinant cell of claim 5 for improving cold tolerance and/or drought resistance of plants Sexuality and use for plant breeding.

 10. The use of claim 9, wherein the plant is tobacco.