CN103602687A - Cotton GhMATE1 gene and application thereof to improvement of cotton brown fiber color - Google Patents

Abstract

The invention relates to an improved cotton fiber color gene technology, and particularly relates to a cotton gene and a plant expression binary vector constructed by the gene and application to improvement of cotton brown fiber color. A nucleotide sequence of the cotton GhMATE1 gene is shown in SEQ ID: NO.1. An amino acid sequence of a protein coded by the gene is shown in SEQ ID: NO.2. On the basis of an early-cloned cotton GhTT12a gene (Chinese patent application number: 201310380270.5, and data of application: 2013-8-27), by using a bioinformatics analysis and electronic cloning method, a new gene containing an MATE (multidrug and toxic compound extrusion) conserved domain database is cloned, but a gene structure and a shearing mode of the cotton GhMATE1 gene are completely different from those of the GhTT12a gene, and the cotton GhMATE1 gene has 78 percent of sequence homology with a nucleotide sequence of an arabidopsis thaliana testa brown pigment synthetic TT12 (Transparent Testa) gene.

Description

Cotton GhMATE1 gene and the application in improvement cotton brown fibre color and luster thereof

Technical field

The present invention relates to a kind of improvement cotton fiber Color gene technology, relate in particular to plant binary vector the application in improvement cotton brown fibre color and luster of a kind of cotton gene and structure thereof.

Background technology

Natural color cotton is the specific type cotton that a kind of cotton fibre has natural colour, because it has unique natural colour, weaving and the course of processing in without bleachinging and dyeing, to the mankind and environmental nonpollution, comfortable and easy to wear, be particularly suitable for making underclothes, be real " ecology ", " environmental protection " cotton, thereby cause the extensive concern of domestic and international cotton breeding man and weaving, Clothing industry circle, be described as the ecological textile of the tool potentiality in 21 century world market.Though the research and development starting of China's color cotton is slower, develops very fast.From 1998 to 2010, Chinese natural color cotton cultivated area expanded annual more than 20 ten thousand mu to from annual 10000 mu, and lint yield is increased to annual more than 20,000 tons from annual 800 tons, and between 10 years, color cotton cultivated area and lint yield have increased respectively 20 times and 25 times.

Color cotton mainly contains brown and green two large serial colors, aspect color cotton breeding of new variety, by means of traditional breeding method, some breeding units of countries in the world and China conduct a research one after another and select a collection of color cotton new variety, have improved to a certain extent quality and the proterties of color cotton.The color cotton kind that domestic each research unit selects has: the kinds such as new color cotton series of products (No. 1 to No. 20), CCRI 51, color cotton No. 2 of Zhejiang, color assorted No. 1 of Soviet Union.In the kind of these seed selections, be mainly that brown cotton series of products has obtained application to a certain degree in weaving, Clothing industry.Compare with white cotton, color cotton kind still exists following outstanding problem: fiber specific tenacity is not high, and staple length is partially short, ginning outturn is on the low side, and pigment stability is poor, and color is single, thereby has limited the application of brown cotton in textile industry.Therefore, the fiber colour of innovation color cotton fibre strength, the staple length that improves brown cotton are two key factors that are related to China's textile industry and color cotton industry development success or failure, are also the important topics that vast cotton breeding researcher faces.

At occurring in nature, plant pigments can be divided into photosynthetic pigments (as chlorophyll) and non-photosynthetic pigments (as flavonoid and carotenoid).Research shows, natural colorful cotton fibre pigment belongs to non-photosynthetic pigments, and relevant with the specific period of cotton fiber development.Chinese scholars is by the research to Cotton Fiber of Natural Brown Cotton chromogenesis process and biochemical character essence, tentatively think and have following 2 kinds of suppositions: the suppositions such as (1) Ryser, Xiao and Zhan think that the initial source of natural brown cotton fibre pigment is to be positioned at the proanthocyanidin (Proanthocyanidins) that the catechin derivation in vacuole forms, also referred to as condensed tannin (Condensed Tannins), and by condensed tannin ingress of air, be oxidized and form and there is brown quinones; (2) Zhao waits and thinks that Cotton Fiber of Natural Brown Cotton pigment belongs to flavonoids.And Xiao and Zhan's experiment all confirms that the precursor substance of Cotton Fiber of Natural Brown Cotton pigment belongs to proanthocyanidin (condensed tannin).Zhan etc. analyze the pigment content distributing in brown cotton, white cotton fiber and kind skin, and research is thought: the major cause that determines fiber color is the allocation proportion of pigment between fiber and kind skin.Cotton fibre is to be differentiated by kind of a chrotoplast, and the forming process of cotton fibre is in close relations with the growth of planting chrotoplast.Arabidopis thaliana, cotton belong to dicotyledons, and anabolism and the regulatory pathway of understanding Arabidopis thaliana kind skin pigment have most important theories meaning for the codeposition molecule mechanism that discloses cotton kind skin brown pigments, the growth of cotton fibre brown pigments, fiber and pigment.

The metabolic pathway of synthesizing of Arabidopis thaliana kind skin pigment is subject to the regulation and control of several genes, belongs to Secondary Metabolism of Plant.By the research of Arabidopis thaliana kind skin Transparent testa series mutation body is shown: phenylalanine (Phenylpropanoid) is the initial amino acid that forms condensed tannin, it is under the katalysis of a series of enzymes, finally form colourless condensed tannin, then through atmospheric oxidation, present the brown feature of kind of skin.Wherein, TT4 coding chalkane synthetase (CHS, chalcone synthase), TT5 coding enzyme, namely chalcone isomerase (CHI, chalcone isomerase) etc. is as the enzyme in structural gene coding flavonoid pathways metabolism, TT1, TT2, TTG1, TTG2, TT8 etc. as transcription factor to structure gene transcribe, TT12 and the TT19 pigment translocator of encoding participates in transhipment and the accumulation of flavonoid material.In the correlative study of Cotton Fiber of Natural Brown Cotton colour development, Chinese scholars adopts different molecular biology methods, a plurality of homologous genes relevant to Arabidopis thaliana kind skin pigment metabolic pathway of synthesizing from cotton, have been cloned, as GhCHS, GhCHI, GhF3H, GhDFR, GhANS, GhANR etc., these genes participate in the protein function of pigment synthesis and infer that all the function based on homologous sequence analysis and information biology is inferred, the pigment synthesis metabolism that actually whether simultaneously participates in cotton kind skin pigment, fiber needs further to be confirmed.For the above-mentioned most important theories problem existing in the research of cotton brown pigments, in the urgent need to take Arabidopis thaliana kind skin brown pigments route of synthesis genes involved, it is reference, the relevant homologous gene of clone in cotton, and by the in addition functional verification of molecular biology and transgenic technology, with clear and definite these genes involveds, whether participate in the synthetic of cotton fiber brown pigments simultaneously.Studies confirm that of the problems referred to above, by the research of further carrying out Cotton Fiber of Natural Brown Cotton pigment synthesis pathways metabolism for us, provide theoretical and support, and by molecular biology method improve Cotton Fiber of Natural Brown Cotton quality, breakthrough cotton fibre color and luster Study on Diversity has important theory and practice meaning.

In recent years, along with the rapid progress of gene clone technology, in difference, show on the basis of (differential display) technology, developed annealing control primer system (Annealing Control Primer, ACP), also referred to as Gene Fish ing technology.The present invention utilizes Gene Fishing technology, the specified phase of cotton No. 11 Fibre Developments in the cotton Zhejiang of color cotton No. 2 and white fiber in upland cotton brown fibre Zhejiang, screening participates in the specific expression gene of cotton fibre brown pigments metabolism, thereby cloned GhTT12a gene, be dependent on bioinformatic analysis, homology and the evolution sexual intercourse of preliminary clear and definite GhTT12a gene and other species TT12 gene.With entering, utilize fluorescence quantifying PCR method to analyze GaTT12a gene at Asiatic cotton fiber and planted the developmental expression characteristic of skin, for the biological function that further this gene of research participates in the metabolism of cotton fibre brown pigments has been established certain Research foundation.

In plant gene function research, transgenic function complementation and gene silencing are the effective technology means that disclose gene function.Have complementary functions and transform this deletion mutant body by building the sense expression vector of goal gene, thereby verify the function that this gene is carried out in plant materials.For the checking of homologous gene function, also can adopt the mutant that transforms approximate species, thereby complete fast homogenic functional verification., single traits mutant library long for the cotton transgenic cycle lacks, and the functional verification that adopts arabidopsis thaliana transformation mutant to carry out homologous gene or similar gene structure territory is a kind of fast method.Gene silencing is a kind of ancient mechanism of organism, and it plays a role by degradation of rna, the modes such as translation or modification karyomit(e) that suppress in g and D process.In recent years, this technology is being used widely aspect molecular biology of plants research and genetic improvement as an important genetic manipulation instrument, various plants gene silent technology is set up in succession, comprise that sense-rna, dsRNAi (double-stranded RNA interference) and artificial microRNA, particularly dsRNAi and microRNA have had new breakthrough at aspects such as the accuracy of gene silencing and high efficiency.DsRNAi and microRNA are higher than Antisense RNA Technique in the efficiency of degraded target gene mRNA, can under the concentration lower than the several orders of magnitude of sense-rna, make target gene express to drop to extremely low level even function completely lose; And, in transgenosis process, there is not the problem of insertion point randomness, any gene all can be by dsRNAi or m icroRNA specificity are reticent targetedly in theory.

Summary of the invention

For clone and understand cotton fiber brown pigments synthesis related gene and and then Cotton Fiber of Natural Brown Cotton quality is improved, utilize the means such as biotechnology to realize the variation of cotton fiber color and luster, first object of the present invention is to provide cotton GhMATE1 gene and by the protein of this genes encoding, and prove that by experiment this gene had both participated in kind of a formation for skin brown pigments, participate in again the formation of fiber brown pigments, be expected to be applied in brown cotton breeding.Second object of the present invention is to provide expression vector and the host cell that contains above-mentioned gene.The 3rd object of the present invention is to provide the application of above-mentioned gene in improvement cotton brown fibre color and luster.

In order to realize first above-mentioned object, the present invention has adopted following technical scheme:

Cotton GhMATE1 gene, the nucleotide sequence of this gene is as shown in SEQ ID:NO.1.

By a protein for above-mentioned genes encoding, the aminoacid sequence of this protein is as shown in SEQ ID:NO.2.

In order to realize second above-mentioned object, the present invention has adopted following technical scheme:

The complementary binary expression vector of plant justice of cotton GhMATE1 gene, this expression vector be take plant binary vector pFGC5941 as skeleton carrier, choose one section of sequence containing GhMATE1 gene complete protein coding frame as the just expression structure of this gene, and introduce respectively BamHI and XhoI restriction enzyme site, thereby built the sense expression vector that contains GhMATE1 gene.

A host cell, this host cell adopts the complementary binary expression vector of plant justice of described cotton GhMATE1 gene to transform.As preferably, the bacterial strain of described conversion use adopts Agrobacterium EHA105.Further, described host cell adopts osmose process arabidopsis thaliana transformation mutant tt12.

The double-stranded RNA of cotton GhMATE1 gene is interfered expression vector, this expression vector be take plant binary vector pCAMBia2301 as skeleton carrier, choose the expression nuclear structure of plant binary vector pBI121, enzyme is cut, connect and be built into carrier pCAMBIA2301-121, using one section of sequence in the cotton gene group shown in SEQ ID:NO.1 as the middle Loop ring texture that builds double base interference vector again, shown in the sequence SEQ ID:NO.3 of Loop ring texture, primer is upstream primer: AGAAGCGAGATGAGGGATGT, downstream primer: CATTT TCATGCGAAGGATTC.

A host cell, this host cell adopts the double-stranded RNA of described cotton GhMATE1 gene to interfere expression vector to transform.

In order to realize the 3rd above-mentioned object, the present invention has adopted following technical scheme:

The application of the gene of nucleotide sequence as shown in SEQ ID:NO.1 in improvement cotton brown fibre color and luster.

The present invention clones cotton GhTT12a gene (Chinese invention patent application number: 2013103802705 in early stage, the applying date: 2013-8-27) on basis, utilize the method for bioinformatic analysis and electronic cloning, cloned a new gene that contains MATE conserved domain, but gene structure, cut mode are completely different from GhTT12a gene, there is 78% sequence homology in the synthetic TT12 gene nucleotide series of this gene and Arabidopis thaliana kind skin brown pigments.Utilize subsequently the method for RT-PCR to clone this gene, called after GhMATE1,497 amino-acid residues of this genes encoding, the about 53.6KD of molecular weight, belongs to a member in MATE supergene family.Utilize quantitative fluorescent PCR to analyze the expression characteristic of GhMATE1 gene at development in different stages fiber, kind skin, result shows: GhMATE1 gene is equal predominant expression in diploid cotton and the brown fibre of tetraploid cotton, white cotton seed skin and brown cotton seed skin, in white cotton fiber, express hardly, illustrate that this gene had both participated in kind of a formation for skin brown pigments, participated in again the formation of fiber brown pigments.Functional analysis for cotton GhMATE1 gene, build plant justice binary expression vector promotor 35S::GhTT12a::Nos terminator and express the complementary Arabidopsis Mutants tt12 of nuclear structure, Molecular Identification and transgenosis physiologic analyses all show that this gene can make Arabidopsis Mutants tt12 recover wild-type phenotype, thereby prove that this gene participates in the synthetic of kind of skin brown pigments; According to the molecular structure of this gene and conserved structure characteristic of field, build 2 kinds of dissimilar double-stranded RNA interference vectors (dsRNAi, carrier sequence sees appendix), by the pollen tube passage method damaging, transform brown cotton, to 30 transgenic line T of brown cotton ₀generation and T ₁the Molecular Identification in generation and the analysis of transgene cotton physiologic index all show that this gene all can reduce the color and luster of cotton brown fibre in various degree, thereby prove that this gene participates in the metabolism of cotton fiber brown pigments.In research process, to utilize GhTT12a gene and by biotechnological means, obtain 10 parts of the cotton germ plasm resources of brown fibre of different depth degrees, these germplasm materials of innovation are expected to be applied on Cotton Fiber of Natural Brown Cotton quality-improving.

Accompanying drawing explanation

Fig. 1 is intron and the exon schematic diagram of cotton GhMATE1 gene.

Fig. 2 is the homogenic aminoacid sequence comparison diagram of cotton GhMATE1 gene and other species TT12.

Fig. 3 is the nucleotide sequence phylogenetic analysis figure of cotton GhMATE1 gene.

That Fig. 4 is GhMATE1 gene is brown diploid, tetraploid, the expression level figure of white cotton fiber different development stage.

Fig. 5 is the design of graphics that contains GhMATE1 gene plant sense expression vector.

Fig. 6, Fig. 7 are the structure schema that contains 2 different structure double base interference vectors of GhMATE1 gene.

Fig. 8 is the pcr amplification evaluation figure that cotton GhMATE1 gene turns the positive strain that Arabidopis thaliana tt12 mutant obtains; M:DNA marker DL2000,1: the positive plasmid pFGC5941-GhMATE1 that contains cotton GhMATE1 gene; 2,3,4,5,6: spray the Arabidopis thaliana individual plant that Basta has resistance; 7: wild-type Arabidopis thaliana plant.

Fig. 9 turns the expression level figure of cotton GhMATE1 gene the positive strain root of complementary Arabidopis thaliana tt12 mutant, stem, leaf, angle fruit and in spending.

Figure 10 be turn cotton GhMATE1 gene in the positive strain of complementary Arabidopis thaliana tt12 mutant containing spirogram.

Figure 11 is the pcr amplification evaluation figure of Partial Fragment in turning nigger-brown fibre cotton in cotton GhMATE1 gene interference vector; M:DNA marker DL2000,1: the positive plasmid pFGC5941-GhMATE1RA that contains cotton GhMATE1 gene interference vector; 2,3,4,5,6,7: spray the transgenic cotton individual plant that 4/1000ths card sodium mycins have resistance; 8: the cotton T586 individual plant of wild-type.Figure 12 is the application drawing that cotton GhMATE1 interferes dark-brown cotton fibre; ZM11: transgenosis white cotton Zhejiang cotton 11; T586: the cotton T586 strain (transgenosis parent plant) of dark-brown; T0-1: the cotton interference of dark-brown strain 1; T0-2: the cotton interference of dark-brown strain 2; T0-3: the cotton interference of dark-brown strain 3; T0-4: the cotton interference of dark-brown strain 4; T0-5: the cotton interference of dark-brown strain 5; T0-6: the cotton interference of dark-brown strain 6.

Embodiment

1. materials and methods

1.1 vegetable materials and growth conditions

In color cotton No. 2 of upland cotton brown fibre Zhejiang, white fiber cotton Zhejiang cotton 11, the purple cotton of the cotton Cixi of diploid brown fibre and the cotton Yuyao of white fiber cotton by Zhejiang Academy of Agricultural Science crop with nuclear technique utilizes institute cash crop research department to provide and at the beginning of 2011 5 months live Hangzhou, the court academy proper that is seeded in test field.After 9d(after cotton blooms is bloomed, DPA, Day Post Anthesis), 12d, 15d, 18d, 21d and 24d, choose respectively cotton fiber tissue and the seed coat tissue of growing and carry out correlative study.

1.2 experimental technique

1.2.1 the extraction of cotton genomic dna and cotton fibre, the total RNA of seed coat tissue

Cotton genomic dna extracts the CTAB method (Li et al., 2001) that adopts.Adopt the method that polyphenol, polyose plant RNA extraction test kit provide to extract cotton fiber tissue, the total RNA of seed coat tissue, test kit is purchased from Beijing hundred Tyke Bioteck Bioisystech Co., Ltd.

1.2.2 utilize bioinformatic analysis to screen and clone cotton GhMATE1 gene

According to the protein conserved domain sequence of the cotton brown fibre pigment GhTT12a gene of having cloned and Arabidopis thaliana kind skin brown pigments AtTT12 gene, search cotton ESTs database (http://blast.ncbi.nlm.nih.gov/), (GenBank accession number is DT563323.1 to select altogether 3 sequences, DT568479.1, ES823453.1).Again with this 3 est sequence search ESTs databases splicing, a sequence of final acquisition, this sequence contains a complete open reading frame (ORF, Opening Reading Frame), according to protein and the Arabidopis thaliana TT12 albumen of this sequence ORF prediction, has approximately 82% homology.According to the sequence signature with ORF, design the special primer (P1:TGTAAAGCATGGGTTCAGAGG and P2:ACATCTCAAGTGCCATCTACCT) of 1 pair of pcr amplification.

CDNA the first chain that the color cotton total RNA reverse transcription of cotton fiber tissue of growing 15DPA for No. 2 in Zhejiang of take respectively obtains is template, and in conjunction with round pcr, amplification condition is: 94 ℃ of denaturation 4min; 94 ℃ of sex change 30s, 56 ℃ of annealing 30s, 68 ℃ are extended 2min; 30 PCR circulations, last 68 ℃ are extended 10min, 15 ℃ of insulations.Amplification system is 50ul:2X KOD amplification reaction solution, 10ul dNTP, and 2ul P1 primer, 2ul P2 primer, 1ul KOD FX, 5ul transcribes after product, 5ul ultrapure water; Again PCR product is added to A, adding A reaction system is that 10ul:5ul connects damping fluid, 1ul pTA2 carrier, and 1ul ligase enzyme, 1ul adds A connecting fluid, 2ul KOD amplified production.Transform intestinal bacteria competence TG1, screening positive clone send Nanjing Genscript Biotechnology Co., Ltd.'s order-checking.Synthetic cDNA the first chain of reverse transcription test kit that adopts MBI company, utilizes KOD FX enzymatic amplification to obtain the GhMATE1 gene (bio tech ltd is spun by Japan for TOYOBO, Shanghai) of inferring.It is all synthetic from Shanghai life work biotechnology Engineering Service company limited that this tests involved primer.

1.2.3 design of primers and bioinformatic analysis

The design of primers relating in research is utilized Primer Premier5.0

( http:// www.premierbiosoft.com/index.html) complete, utilize DNAman6.0 software

( http:// www.lynnon.com) aminoacid sequence is carried out to homology relatively and the analysis of nucleic acid systematic evolution tree, the supposition of protein conserved domain adopts the Blast on-line analysis system in Genbank database

( http:// blast.ncbi.nlm.nih.gov), concrete structural domain position analysis utilizes the online software analysis of SMART

（ http://smart.embl-heidelberg.de）。

1.2.4 the structure characteristic analysis of cotton GhMATE1 gene

Positive colony after connection, after order-checking, divides 4 sections of design primers, and its corresponding genomic DNA fragment that increases, through adding A, is cut glue and reclaimed, and is cloned into pTA2 carrier, through the DNA sequence dna of this gene of order-checking splicing acquisition.Enzyme and carrier used in experiment are the same.

1.2.5 utilize quantitative fluorescent PCR to analyze the expression characteristic of GhMATE1 gene in diploid cotton and four times of cottons

According to the cDNA of the fibrous tissue of cotton different development stage, seed coat tissue, with real-time fluorescence quantitative RT-PCR, detect the relative expression level of GhTT12a gene in development in different stages fiber, seed coat tissue.Cotton GBQ7 gene is as the reference gene (amplimer) (Tu et al., 2007) of quantitative fluorescent PCR, and the specificity amplification primer of GhTT12a gene is in Table 2.The equal reference reagent box of experimental implementation specification sheets (bio tech ltd is spun by Japan for TOYOBO SYBR Green Supermixture, Shanghai), the temperature cycle of quantitative fluorescent PCR: 50 ℃, 1min; 94 ℃ of denaturation 3min; 94 ℃ of sex change 30s; 56 ℃ of annealing 30s; 72 ℃ are extended 45s; Amount to 30 PCR circulations.

Primer and sequence used in table 2 quantitative fluorescent PCR

1.2.6 the structure of cotton GhMATE1 gene sense expression vector and the complementation test of Arabidopsis Mutants tt12

The whole protein encoding sequence of the GhTT12a gene cDNA sequence obtaining according to order-checking definite this gene.Because Arabidopis thaliana tt12 mutant is inserted and produced by T-DNA, therefore, we select the two carrier free pFGC5941 of expression of plants as the complementary carrier of justice of this gene, at initiating terminal, introduce restriction enzyme site XhoI, at clearing end, introduce restriction enzyme site BamHI(GhMATE1P1:CCG cTCGAGtGTAAAGCATGGGTTCAGAGG; GhMATE1P2:CGC gGATCCaCATCTCAAGTGCCATCTACCT), thus build complete just genetic expression structure.

Adopt osmose process arabidopsis thaliana transformation mutant tt12.To at 28 ℃, shake bacterium containing recombinant plasmid Agrobacterium and spend the night to OD600 value between 1.0-2.0, the centrifugal 8min of 8000rpm, abandons supernatant and collects thalline.For precipitation, the MS substratum of the sucrose that is 50g/L containing mass concentration, pH value 5.7 is resuspended is about 0.5 to OD600 value, and add 0.02%Silwet70, after fully mixing, Arabidopis thaliana inflorescence is immersed, every 2min, stir bacterium liquid, after 10min, take out and keep flat and moisturizing 12--24 hour, after 4 weeks, collect the seed of Arabidopis thaliana tt12 after transforming.

1.2.7 the structure of cotton GhMATE1 gene double-stranded RNA interference vector

Hairpin ring structure according to one section of sequence in cotton gene group as interference vector design, this section of sequence sees appendix 4, and amplimer INA, INB introduce restriction enzyme site BamHI, SacI and KpnI in the design of hair clip Loop ring.The justice end primer restriction enzyme site XbaI of 2 kinds of different interference structures of cotton GhMATE1 gene, BamHI; Antisense end is introduced restriction enzyme site SacI and KpnI, thereby builds complete hairpin ring structure, and the primer sequence information relating to is in Table 2.The amplification of Loop ring structure be take cotton genomic dna as template, in interference vector structure, to take the GhTT12a gene PCR product that reverse transcription obtains be template in the amplification of gene fragment, all adopt KOD FX enzymatic amplification to obtain object fragment (bio tech ltd is spun by Japan for TOYOBO, Shanghai).

Primer and sequence used in table 2 quantitative fluorescent PCR

1.2.8 improved method pollen tube passage method converting cotton

The processing that contains the fresh bacterium liquid of object interference vector Agrobacterium LBA4404: will shake bacterium at 28 ℃ containing recombinant plasmid Agrobacterium and spend the night to OD600 value between 1.0-2.0, the centrifugal 8min of 8000rpm, abandons supernatant and collect thalline.For precipitation, the MS substratum of the sucrose that is 50g/L containing mass concentration, pH value 5.7 is resuspended is about 0.5 to OD600 value, and adds 0.02%Silwet70, and use immediately after fully mixing, every 2min stirring bacterium liquid.

The operation of improved method pollen tube passage method converting cotton: bloom between pollination 3--6 point that afternoon in cotton, with blade, cotton column cap is rived, with very little cotton mass, dip and soak the fresh bacterium liquid of the Agrobacterium LBA4404 through processing and containing object carrier, then with the cotton mass that tweezers gripping contains bacterium liquid, be clipped in the column cap of riving, use subsequently straw (plastic grip) to clamp cotton column cap the moisturizing of riving.The cotton bell that conversion processing is crossed is pricked cotton boll base portion to show difference with the line of different colours, and while being convenient to sowing, difference is come.

1.2.9 transgenic arabidopsis, cotton plants field test and Molecular Identification

After the Arabidopis thaliana seed that transgenosis is collected dries, with after 75% ethanol (containing 0.2% polysorbas20) sterilization 10min, abandon supernatant, then use after dehydrated alcohol rinsing 10s, be placed in and on aseptic filter paper, dry up 30min, be seeded in MS substratum, in the illumination box of illumination 8h, dark 16h, cultivate after 14d, spray the preliminary evaluation that the Basta solution of 3/1000ths concentration carries out positive strain.

The evaluation of the positive strain of transgene cotton adopts cotyledon period card sodium mycin Rapid identification method.

Selection is identified Basta and card sodium mycin identifies that T0, the T1 all with resistance carry out PCR detection for Arabidopis thaliana and cotton plants.Goal gene amplification and interference vector fragment amplification and evaluation sequence be referring to table 2 and table 4, following 94 ℃ of PCR circulating reaction condition, 30s; 64 ℃, 30s; 68 ℃, 90s.

1.2.10 the mensuration of transgenic arabidopsis, cotton kind skin brown pigments and fiber brown pigments content

The extraction of transgenic positive strain and offspring's brown pigments and detection are first adopted p-Dimethylaminocinnamaldehyde (DMACA) and are analyzed, respectively seed, fiber are immersed in 2%DMACA and 3M hydrochloric acid (volume ratio) solution to 4 days, then clean up under optical microphotograph and observe with 70% ethanol; The second, with the Flavonoid Content of high performance liquid chromatography (HPLC) mensuration material, concrete operation step is referring to document ^[11,16].

2. results and analysis

2.1 cotton GhTT12a gene clones, sequence information and gene structure feature

The speculated sequence information that splicing obtains according to est sequence, design respectively the encoder block region that primer covers this gene, in conjunction with RT-PCR method, obtain aim sequence again, the result that order-checking obtains is consistent with the data that EST splicing obtains, and proves this sequence GhMATE1 gene just.From the 46bp of GhMATE1 gene open reading frame to 1516bp, 497 amino acid of encoding altogether, molecular size range is 53.6KD, in conjunction with SMART On-line analysis program (http://smart.embl-heidelberg.de/), show at the 27th to existing continuous 10 membrane spaning domains (aminoacid sequence of the middle line that sees the following form) between 469 amino acids.Utilize Blast to analyze and show, this aminoacid sequence belongs to MATE(multidrug and toxic compound ext rusion) supergene family.

Underscore amino acid moiety is 10 continuous membrane spaning domains ,=representing the initiator codon position of this gene, * represents the position of terminator codon.

Utilize the same primers of amplification GhMATE1 gene, segmentation amplification Asiatic cotton brown cotton genomic dna, obtain the PCR product of about 2.9Kb, through checking order and being spliced into after complete sequence, analysis show this amplified fragments really for this gene for DNA sequence dna, result also shows that GhMATE1 gene has 5 exons and 4 introns to form, as shown in Figure 1.E1-E5 represents exon, and single line bar represents intron.

Phyletic evolution and the homology analysis of 2.2 cotton GhTT12a genes

The aminoacid sequence of cotton GhMATE1 genes encoding and other species TT12 protein are carried out to BlastP and multiple sequence comparison (mutiple alignment) analysis, result shows, cotton GhMATE1 gene is the same with other species TT12 gene, all contain MATE conserved domain, and with the TcTT12-2 of cocoa tree, the GaTT12a of Asiatic cotton, the GmTT12 of soybean, the BnTT12 gene of rape and the coded albumen of the AtTT12 of Arabidopis thaliana all have certain amino acid sequence similarity, especially the sequence that contains MATE structural domain part between aminoacid sequence 45--480 is more consistent, show that TT12 gene is comparatively conservative on evolving, as shown in Figure 2.

The TT12 homologous genes of choosing other 7 kinds of species carries out multiple sequence together with cotton GhMATE1 gene to be compared, and builds the Phylogenetic tree of 8 species TT12 homologous geneses simultaneously.As shown in Figure 3, the TcTT12 of cotton GhMATE1 gene and cocoa tree is the most approaching on evolutionary relationship, amino acid sequence homology reaches 90%, on evolutionary relationship, also exist 82% sequence homology with the GaTT12a gene of Asiatic cotton, and have approximately 81% homology between the GmTT12 gene in soybean.

Arabidopis thaliana (Arabidopsis thaliana) AtTT12(NM_115765.3), rape (Brassica napus) BnTT12(EU818785.1), apple (Malus x domestica) MdTT12-1(GU064954.1), soybean (Glycine max) GmTT12(XM_003553118.1), clover (Medicago truncatula) MtTT12-1(FJ858726.1), MtTT12-2(GU064955), cocoa tree (Theobroma cacao) TcTT12-2(EOX93053) and Arabidopis thaliana (Arabidopsis thaliana) AtTT12(NP_191462) TT12 homologous gene.

2.3 the expression analysis of cotton GhMATE1 gene in cotton different developmental phases fiber, seed coat tissue

In order to study the expression pattern of GhMATE1 gene in Diploid and Tetraploid cotton fibre different steps, we adopt the method for real-time fluorescence quantitative RT-PCR to detect the expression of this gene.Select respectively Boll Development to fibrous tissue and the seed coat tissue of 9d, 12d, 15d, 18d, 21d, 24d after blooming, extract total RNA, utilize the synthetic cDNA of reverse transcription the first chain as the template of fluorescence quantitative PCR detection, fluorescent quantitation detected result as shown in Figure 4.The expression of GhMATE1 in all samples, all can be detected.In color cotton No. 2 of the purple cotton and Zhejiang of the cotton Cixi of brown fibre, along with kind of skin and the growth of Fibre Development time, the expression amount of GhMATE1 all has increasing in various degree, and after 15DPA, expression amount has raising rapidly especially; But in the cotton 11 of Zhong Mianhe Zhejiang, white cotton Yuyao in cotton fibre, along with the growth of development time, this gene expression amount present future and increase substantially, and maintain your the low level that compares always.In 18DPA and 21DPA period, the expression amount of GhMATE1 in brown fibre is respectively 8 times and 10 times of expression amount in white fiber.Above result tentatively shows: GhMATE1 gene predominant expression in brown fibre.

The structure of the complementary binary expression vector of 2.4 cotton GhMATE1 gene plant justice

In order to verify whether cotton GhMATE1 gene participates in the anabolism of cotton kind skin brown pigments, experiment be take plant binary vector pFGC5941 as skeleton carrier, choose one section of sequence containing GhMATE1 gene complete protein coding frame as the just expression structure of this gene, and introduce respectively BamHI and XhoI restriction enzyme site, building process See Figure 5, Fig. 6.Finally by double digestion, PCR, identify and order-checking, show that object fragment is connected in binary expression vector, thereby built the sense expression vector that contains GhMATE1 gene, name pFGC-GhMATE1.

2.5 cotton GhTT12a gene plants are interfered the structure of expression vector

Take plant binary vector pCAMBia2301 as skeleton carrier, choose the expression nuclear structure of plant binary vector pBI121, enzyme cuts, connect and be built into carrier pCAMBIA2301-121, using that one section of sequence is as the middle Loop ring texture that builds double base interference vector in cotton gene group, sequence and the primer location of Loop ring texture see the following form again.

Underscore sequence is the primer sequence of hair clip ring texture.

According to the MATE structural domain region of cotton GhMATE1 gene protein sequence, select respectively 2 sections of different sequences as the positive-sense strand of the interference expression structure of this gene, its corresponding antisense strand is as the reverse complemental structure building, the justice end of the chain is introduced XbaI and BamHI restriction enzyme site, and antisense complementary strand is introduced KpnI and SacI restriction enzyme site.Building process is shown in Fig. 7.Finally by not exclusively double digestion, PCR evaluation and order-checking, show that object fragment is connected in binary expression vector, thereby built the interference expression vector that contains 2 different interference structures, respectively called after pGhMATE1RI-A and pGhMATERI-B.

The evaluation of 2.6 cotton GhMATE1 gene complementation Arabidopsis Mutants tt12

The sense expression vector pFGC-GhMATE1 that contains cotton GhMATE1 gene building is proceeded to Agrobacterium EHA105, by agriculture bacillus mediated titbit dip method arabidopsis thaliana transformation tt12 mutant, and obtained seed.In order to detect cotton GhMATE1 gene, whether successfully transform tt12 mutant, when the arabidopsis thaliana transformation T0 individual plant obtaining grows to 3----4 sheet leaf, the Arabidopis thaliana plant growing with 3/1000ths Basta spray solution, after 2 weeks, choose 4 strains and Basta is there is to the Arabidopis thaliana individual plant of resistance, with Arabidopsis Mutants tt12(N5740, http://www.arabidopsis.org/) genomic dna of strain, as template, is reacted and is detected by PCR.Result shows, 4 transgenic arabidopsis strains all amplify object band (Fig. 8).Show that cotton GhMATE1 gene successfully proceeds to Arabidopsis Mutants, and Bar gene normal expression.

In order to verify whether normal expression of the cotton GhMATE1 gene that proceeds to, we adopt the method for quantitative fluorescent PCR to detect the expression of this gene.With the contrast that is expressed as of wild-type Arabidopis thaliana TT12 gene, select the T1 of above 4 strains for the positive strain of Basta, by strain, detect respectively.In Arabidopis thaliana tt12 mutant, the expression intensity of cotton GhMATE1 gene is shown in Fig. 9.From Fig. 9 table, can find out, the expression amount of wild-type Arabidopis thaliana TT12 gene at root, stem, leaf and in spending is all lower, then the expression amount in the fruit of angle is extremely high, shows that TT12 gene mainly plays a role in Seed development, basically identical with forefathers' research.With the 5 strain T1 of the complementary Arabidopsis Mutants tt12 of cotton GhMATE1 gene success in positive strain, root, stem, leaf and spend in expression amount difference be not very obvious, but the expression amount between strain has notable difference, it may be the reason with composition type expression promoter CaMV35S.

For further determining whether GhMATE1 carries out the function identical with Arabidopis thaliana TT12, we extract flavonoid compound PAs polymkeric substance from the seed of the positive individual plant results of complementary tt12 mutant, and combined acid catalytic hydrolysis and liquid chromatography mass (LC-MS) analyses are measured its content.In strongly-acid and oxicracking condition, the monomer output quantitative analysis at an easy rate of PAS pink cyanidin(e).In Arabidopis thaliana tt12 mutant seed, insoluble PAs is 5 times of content in wild type seeds, and solubility PAs and insoluble PAs content are more or less the same.Positive individual plant measurement result after complementation shows, solubility PAs greatly reduces compared with the content in mutant tt12, minimizing ratio is respectively 69%, 63%, 74%, 70% and 68%, in positive strain, insoluble PAs is 4.81,4.17,3.79,4.57,4.35 times of solubility PAs, more than the results are shown in (data slightly) shown in Figure 10.Above experimental result shows: cotton GhMATE1 gene forms and carries out critical function at cotton kind skin brown pigments, similar with AtTT12 gene function.

2.7 cotton GhMATE1 gene dsRNAi carriers, in expression process, have reduced the color and luster of dark-brown cotton fibre in various degree

According to the gene structure of cotton GhMATE1, we have designed respectively 2 kinds of different double-stranded RNA interference vector structures, utilize improved method pollen tube passage method to transform the cotton P158 of nigger-brown fibre, and T0 has been carried out to Molecular Identification for positive strain, confirm that goal gene has turned the brown color cotton of depth (Figure 11), and transgenosis T0 presents for some individual plants the brown cotton (Figure 12) that depth degree differs.Above experimental result shows that cotton GhMATE1 gene also participates in the anabolism of cotton fiber brown pigments simultaneously, plays critical function in fiber brown pigments is grown.

3. discuss

The present invention utilizes bioinformatic analysis in conjunction with homologous clone and function, to infer again.According to the huge EST data of cotton in ncbi database, thereby est sequence splicing, the integration higher to similarity obtain the preliminary aim sequence of inferring, binding molecule biology correlation technique obtains the true sequence of goal gene again, thereby is cloned into faster goal gene.This method is particularly useful for studying relatively further investigation and set up the species in EST storehouse.Up to the present, in ncbi database, only the est sequence of cotton different tissues has surpassed 310,000, and new cotton est sequence is still in constantly increasing, and makes full use of these data messages, is a kind of effective ways that obtain fast the new gene of cotton.

In cotton GhMATE1 protein sequence, contain typical membrane spaning domain.Sequence alignment analysis shows, gene on GhMATE1 gene and GaTT12a gene and other species exists certain consistence in sequence, but the homology of whole coding region protein reaches 82%, and contain MATE conserved domain, but the cut mode of these 2 genes is completely different, nucleotide sequence homology only has 76%, may be relevant with the evolution of this gene in different plant species.And these 2 genes all exist in diploid and tetraploid cotton.

Cotton is the important cash crop of China, fibre crops.In natural brown cotton, the height of brown pigments content has influence on again the depth of cotton fibre color and luster, and the precursor substance of brown pigments is proanthocyanidin.This research is started with from cotton GhMATE1 gene, utilize different varieties color and luster filamentary material to carry out preliminary study to kind of a skin, the biosynthesizing of fiber brown pigments, recognize the vital role of GhMATE1 gene in cotton proanthocyanidin is synthetic. in the Cotton Fiber of Natural Brown Cotton pigment synthesis metabolism related gene of cloning, as GhCHS1, GhCHI, GhF3H, GhDFR, GhANS, GhANR etc., these genes all have higher homology with Arabidopis thaliana kind skin brown pigments metabolic pathway of synthesizing genes involved, but the research of participation cotton kind skin brown pigments function has no report always.Arabidopis thaliana TT12 protein coding cross-film transport protein, in brown pigments anabolism, be responsible for the reverse transportation of Cyanidin-3-oxygen-glucosides/hydrogen, thereby cause the accumulation of former anthocyanogen lead in vacuole, in kind of skin brown pigments metabolic pathway of synthesizing, carry out critical function.Therefore, infer that the above homologous gene in cotton also participates in the synthetic of kind of skin brown pigments simultaneously.

Initial analysis in, white cotton brown at 2 times of body Asiatic cottons to GhMATE1 gene and tetraploid cotton fibre shows: this gene expression amount in Cotton Fiber of Natural Brown Cotton is the highest, and minimum in white cotton fiber.Originally studies have shown that cotton gene GhMATE1 had not only participated in the anabolism of cotton kind skin brown pigments but also participated in the anabolism of fiber brown pigments, thereby from molecular biology level, proved conclusions, also the anabolism for research cotton fiber brown pigments provides a kind of Research Thinking.Also imply and synthesizing of cotton kind skin brown pigments and fiber brown pigments may share similar pathways metabolism simultaneously.According to above result of study, can filter out the deep mixed brown cotton individual plant of fiber color, be expected to be applied in breeding.

Sequence table

<110> the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute; Zhejiang Academy of Agricultural Science

<120> cotton GhMATE1 gene and expression vector thereof, host cell and the application in improvement cotton brown fibre color and luster

 

<160>6

 

<210>?1

<211>?1654

<212>?DNA

<213> cotton

<400>?1

1?ATAGAAGTCA?TTTGCCTAAC?GTAAATACTA?GAAAGCTGTA?AAGCATGGGT?TCAGAGGAAC

61?AGCGGCCATT?GCTACGAATA?TCGGAATTAT?CATCGGATGC?GATCGAAGAG?GTTTTTGAAA

121?GTGGCGACGG?CGGCGGAGGA?GTAGGGTGGT?GGGTGAGGCT?TGTTGCGTGG?GAATCGAGGA

181?TTTTGTGGTT?GTTATCAGGG?GCATCCATAA?TTGTCTCTGT?TTTTAATTAT?ATGCTCACTT

241?TTGTCACTTT?AATGTTCACT?GGTCATCTTA?ATGCATTGGA?ATTGGCTGGT?GCTTCTATTG

301?CTAGTGTTGG?AATTCAAGGT?CTTGCTTATG?GGATTATGTT?GGGCATGGCG?AGTGCGGTAC

361?AGACCGTGTG?TGGCCAAGCA?TACGGTGCCA?AGAAATACGC?AGCCATGGGG?ATCATTTGCC

421?AAAGAGCAAT?TGTATTACAC?ATAGGAGCCT?CAGTTATCCT?AACATTCCTC?TATTGGTATT

481?CGGACACCGT?CCTTCAAGCA?ATAGGTCAAT?CGGCAAGTAT?AGCAGAGCAA?GGCCAAGTTT

541?TCGCCCGTGG?TTTAATCCCT?CAACTTTACG?CATTCGCCAT?AAGTTGCCCC?ATGCAAAGGT

601?TCCTTCAAGC?TCAAAACATA?GTGAATCCTT?TGGCTTATAT?CTCCGTTGGG?GTATTTTTGC

661?TCCACATTCT?TCTTACTTGG?CTTGCCGTTG?ATGTATTGGG?ATATGGTCTT?CTTGGGGCAT

721?CTTTGACATT?AAGTCTTTCA?TGGTGGATTC?TTACTATTCT?TAATGGACTT?TACATTGTTT

781?TAAGTCCTTC?CTGTAAAGAG?ACTTGGACTG?GTTTGTCTAC?TAAAGCTCTT?AAAGGGATTT

841?GGCCTTATTT?CAAGATTACT?GCTGCTTCTG?CTGTTATGCT?TTGCTTGGAG?ATATGGTATA

901?ACCAAGGACT?GGTGCTTATA?TCTGGTCTTC?TTCCTAATGC?AGCAATTGCA?CTAGACTCCA

961?TTTCTATTTG?CATGAACTAC?TGGAACTGGG?ATATCAACTT?TGTTTTAGGC?TTTAGTGCAG

1021?CAGCCAGTGT?GCGAGTGAGT?AATGAGCTAG?GGGCAGGGCA?TCCCAAGCTG?ACCAAATTTT

1081?CAGTCATAGT?AGTGAATGCT?ACCAGCATTT?TCATTAGTAC?AGTTTTCACT?GCCATTGTTA

1141?TCATATGTCG?ATCCCTATTA?ATCAAAGCTT?TCTCAACCGA?CGCTGAAGTT?ATACAAGCTG

1201?GTTCCAGTTT?GATTCCATTG?CTTGCCATCT?CCATTTTCTT?GAATGGAATC?CAGCCCATTC

1261?TCTCAGGAGT?GGCCATTGGG?AGTGGATGGC?AACATATAGT?AGCATATGTC?AACCTCACTA

1321?CATATTACAT?TATTGGTCTT?CCAATTGGAT?GTGTTCTTGG?ATTCAAATTA?GGCTTAGGAG

1381?TAGAAGGTAT?ATGGTGGGGG?ATGGTAGTTG?GGGTTCTTCT?ACAAACAATA?ACTCTAATCA

1441?TTCTCACTGC?CAGAACAAAC?TGGGACTTGG?AGGTTGAAAA?AGCTGCGGAT?CGGTTGAGGA

1501?AATCAGCCAA?TGAAGAGACA?TTACATTTGA?TTACTGATTA?GAGGTAGATG?GCACTTGAGA

1561?TGTAGTCAAA?TAAACATTAC?ATACATTTAG?TTCTCTCTTT?TCTTAGTTTT?ATTTTTTTTA

1621?ATATAAATCT?GTTTGCCAAA?AAAAAAAAAA?AAAA

 

<210>?2

<211>?499

<212> amino acid

<213> cotton

<400>?2

1?MGSEEQRPLL?RISELSSDAI?EEVFESGDGG?GGVGWWVRLV?AWESRILWLL?SGASIIVSVF

61?NYMLTFVTLM?FTGHLNALEL?AGASIASVGI?QGLAYGIMLG?MASAVQTVCG?QAYGAKKYAA

121?MGIICQRAIV?LHIGASVILT?FLYWYSDTVL?QAIGQSASIA?EQGQVFARGL?IPQLYAFAIS

181?CPMQRFLQAQ?NIVNPLAYIS?VGVFLLHILL?TWLAVDVLGY?GLLGASLTLS?LSWWILTILN

241?GLYIVLSPSC?KETWTGLSTK?ALKGIWPYFK?ITAASAVMLC?LEIWYNQGLV?LISGLLPNAA

301?IALDSISICM?NYWNWDINFV?LGFSAAASVR?VSNELGAGHP?KLTKFSVIVV?NATSIFISTV

361?FTAIVIICRS?LLIKAFSTDA?EVIQAGSSLI?PLLAISIFLN?GIQPILSGVA?IGSGWQHIVA

421?YVNLTTYYII?GLPIGCVLGF?KLGLGVEGIW?WGMVVGVLLQ?TITLIILTAR?TNWDLEVEKA

481?ADRLRKSANE?ETLHLITD

 

<210>?3

<211>?420

<212>?DNA

<213> cotton

<400>?3

1?TGAAAAGTAG?AAGCGAGATG?AGGGATGTGC?ATCGCTAAAA?TTTCATCACA?CAAATTTAAA

61?CAATGTTAAA?TAAATATACT?GAACATTATA?TGGATTATTA?TTAGTTATAG?TGGTAGTTGA

121?CAGTTGGTTT?TTGAAAGCTA?TCATGTGCTT?TTAATTAGTT?TTTTTATATA?TTTAAAAAAA

181?ATAATATAAG?AATACTTGAT?AATTTCTGAA?ATTTGCTTGT?GCAGTTTTTT?TAATTTCATT

241?CTTAATATGC?AACTTAATTA?TCCTATGTTT?AAATACAATT?AAATATATTT?AATGTATGTT

301?TTGAATGTTG?ACATATTTAA?TTATATTTAT?GAAATTGATA?TGAAAATAAT?ACGAGACATA

361?GAACACAGTT?ACAAATCGTC?GAATCTGGGT?AATATCATTT?TCATGCGAAG?GATTCAAACA

 

Claims (8)

1. cotton GhMATE1 gene, is characterized in that: the nucleotide sequence of this gene is as shown in SEQ ID:NO.1.

2. the complementary binary expression vector of the plant of gene claimed in claim 1 justice, it is characterized in that: this expression vector be take plant binary vector pFGC5941 as skeleton carrier, choose one section of sequence containing GhMATE1 gene complete protein coding frame as the just expression structure of this gene, and introduce respectively BamHI and XhoI restriction enzyme site, thereby built the sense expression vector that contains GhMATE1 gene.

3. a host cell, is characterized in that: this host cell adopts expression vector claimed in claim 2 to transform.

4. a kind of host cell according to claim 2, is characterized in that: the bacterial strain that transforms use adopts Agrobacterium EHA105.

5. the double-stranded RNA of gene claimed in claim 1 is interfered expression vector, it is characterized in that: this expression vector be take plant binary vector pCAMBia2301 as skeleton carrier, choose the expression nuclear structure of plant binary vector pBI121, enzyme is cut, connect and be built into carrier pCAMBIA2301-121, using one section of sequence in the cotton gene group shown in SEQ ID:NO.1 as the middle Loop ring texture that builds double base interference vector again, shown in the sequence SEQ ID:NO.3 of Loop ring texture, primer is upstream primer: AGAAGCGAGATGAGGGATGT, downstream primer: CATTT TCATGCGAAGGATTC.

6. a host cell, is characterized in that: this host cell adopts expression vector claimed in claim 5 to transform.

7. a protein, is characterized in that the aminoacid sequence of this protein is as shown in SEQ ID:NO.2.

8. the application of gene claimed in claim 1 in improvement cotton brown fibre color and luster.

Images