CN103602687B - Cotton GhMATE1 gene and the application in improvement cotton brown fibre color and luster thereof - Google Patents

Abstract

The present invention relates to a kind of improvement cotton fiber color gene technology, particularly relate to the plant binary vector of a kind of cotton gene and structure thereof and the application in improvement cotton brown fibre color and luster.Cotton GhMATE1 gene, is the nucleotide sequence of this gene as SEQ? shown in ID:NO.1.Is the aminoacid sequence of this protein as SEQ by a protein for above-mentioned genes encoding? shown in ID:NO.2.The present invention is in clone cotton GhTT12a gene (Chinese invention patent application number: 2013103802705 in early stage, the applying date: 2013-8-27) on basis, utilize the method for bioinformatic analysis and electronic cloning, clone a new gene containing MATE conserved domain, but gene structure, cut mode are completely different from GhTT12a gene, this gene and Arabidopis thaliana seed coat brown pigments synthesize the sequence homology that TT12 gene nucleotide series exists 78%.

Description

Cotton GhMATE1 gene and the application in improvement cotton brown fibre color and luster thereof

Technical field

The present invention relates to a kind of improvement cotton fiber color gene technology, particularly relate to the plant binary vector of a kind of cotton gene and structure thereof and the application in improvement cotton brown fibre color and luster.

Background technology

Natural color cotton is the specific type cotton that a kind of cotton fibre has natural colour, because it has unique natural colour, without the need to bleachinging and dyeing in weaving and the course of processing, to the mankind and environmental nonpollution, comfortable and easy to wear, be particularly suitable for making underclothes, be that real " ecology ", " environmental protection " are cotton, thus cause the extensive concern of domestic and international cotton breeding man and weaving, Clothing industry circle, be described as the ecological textile of 21 century world market most potentiality.Though the research and development starting of China's color cotton is comparatively slow, develop very fast.From 1998 to 2010, Chinese natural color cotton cultivated area expanded annual more than 20 ten thousand mu to from annual 10000 mu, and lint yield is increased to annual more than 20,000 tons from annual 800 tons, and between 10 years, color cotton cultivated area and lint yield increase 20 times and 25 times respectively.

Color cotton mainly contains brown and green two large serial colors, in color cotton breeding of new variety, by means of traditional breeding method, countries in the world and some breeding units of China conduct a research one after another and select a collection of color cotton new variety, improve quality and the proterties of color cotton to a certain extent.The color cotton kind that domestic each research unit selects has: the kind such as new color cotton series of products (No. 1 to No. 20), CCRI 51, color cotton No. 2 of Zhejiang, color assorted No. 1 of Soviet Union.In the kind of these seed selections, mainly brown cotton series of products obtains application to a certain degree in weaving, Clothing industry.Compared with white cotton, color cotton kind still also exists following outstanding problem: fiber strength is not high, and staple length is partially short, ginning outturn is on the low side, and pigment stability is poor, and color is single, thus limits the application of brown cotton in textile industry.Therefore, the fiber colour of innovation color cotton and improve the fibre strength of brown cotton, staple length is two key factors being related to China's textile industry and color cotton industry development success or failure, is also the important topic that vast cotton breeding researcher faces.

At occurring in nature, plant pigments can be divided into photosynthetic pigments (as chlorophyll) and non-photosynthetic pigments (as flavonoid and carotenoid).Research shows, natural colorful cotton fibre pigment belongs to non-photosynthetic pigments, and relevant with the specific period of cotton fiber development.Chinese scholars is passed through Cotton Fiber of Natural Brown Cotton chromogenesis process and this Quality Research of biochemical character, tentatively think to there are following 2 kinds of suppositions: (1) Ryser, Xiao and Zhan etc. infers that thinking that natural liquor storeroom fiber pigment is originated at first is the proanthocyanidin (Proanthocyanidins) that the catechin derivation be positioned in vacuole is formed, also referred to as condensed tannin (Condensed Tannins), and be oxidized by condensed tannin ingress of air and formed there is brown quinones; (2) Zhao etc. think that Cotton Fiber of Natural Brown Cotton pigment belongs to flavonoids.And the experiment of Xiao and Zhan all confirms that the precursor substance of Cotton Fiber of Natural Brown Cotton pigment belongs to proanthocyanidin (condensed tannin).Zhan etc. analyze the pigment content distributed in brown cotton, white cotton fiber and seed coat, and research is thought: the major cause of decision fiber color is the allocation proportion of pigment between fiber and seed coat.Cotton fibre is by kind of an epithelial cell differentiation, and the forming process of cotton fibre is in close relations with the growth of planting chrotoplast.Arabidopis thaliana, cotton belong to dicotyledons, understand the anabolism of Arabidopis thaliana seed coat pigment and regulatory pathway for disclosing cotton seed coat brown pigments, cotton fibre brown pigments is grown, the codeposition molecule mechanism of fiber and pigment has most important theories meaning.

The metabolic pathway of synthesizing of Arabidopis thaliana seed coat pigment is subject to the regulation and control of several genes, belongs to Secondary Metabolism of Plant.By showing the research of Arabidopis thaliana seed coat Transparent testa series mutants: phenylalanine (Phenylpropanoid) is the initial amino acid forming condensed tannin, it is under the katalysis of a series of enzyme, the condensed tannin that final formation is colourless, the browner feature presenting seed coat through atmospheric oxidation.Wherein, TT4 coding chalkane synthetase (CHS, chalcone synthase), TT5 coding enzyme, namely chalcone isomerase (CHI, chalcone isomerase) etc. are as the enzyme in structural gene coding flavonoid pathways metabolism, TT1, TT2, TTG1, TTG2, TT8 etc. transcribe to structure gene as transcription factor, TT12 and TT19 pigment translocator of then encoding participates in transhipment and the accumulation of flavonoid substances.In the correlative study of Cotton Fiber of Natural Brown Cotton colour development, Chinese scholars adopts different molecular biology methods, multiple homologous gene relevant to Arabidopis thaliana seed coat pigment metabolic pathway of synthesizing has been cloned from cotton, as GhCHS, GhCHI, GhF3H, GhDFR, GhANS, GhANR etc., the protein function of these genes participation pigment synthesis infers the possible function all based on homologous sequence analysis and information biology, whether participates in cotton seed coat pigment actually simultaneously, the pigment synthesis metabolism of fiber needs confirmation further.For the above-mentioned most important theories problem existed in the research of cotton brown pigments, in the urgent need to Arabidopis thaliana seed coat brown pigments route of synthesis genes involved for reference, associated homologous gene is cloned in cotton, and by the in addition functional verification of molecular biology and transgenic technology, whether participate in the synthesis of cotton fiber brown pigments with these genes involveds clear and definite simultaneously.The research of the problems referred to above confirms, there is provided theories integration by the research carrying out Cotton Fiber of Natural Brown Cotton pigment synthesis pathways metabolism for us further, and by molecular biology method improvement Cotton Fiber of Natural Brown Cotton quality, breakthrough cotton fibre color and luster Study on Diversity, there is important theory and practice meaning.

In recent years, along with the rapid progress of gene clone technology, on the basis of differential disply (differential display) technology, develop annealing control primer system (Annealing Control Primer, ACP), also referred to as Gene Fishing technology.The present invention utilizes Gene Fishing technology, the specified phase of cotton No. 11 Fibre Developments of color cotton No. 2 and the cotton Zhejiang of white fiber in upland cotton brown fibre Zhejiang, screening participates in the specific expression gene of cotton fibre brown pigments metabolism, thus cloned GhTT12a gene, be dependent on bioinformatic analysis, tentatively specify that homology and the EA hardware relation of GhTT12a gene and other species TT12 gene.With entering, utilize fluorescence quantifying PCR method to analyze GaTT12a gene at Asiatic cotton fiber and the developmental expression characteristic of seed coat, the biological function participated in the metabolism of cotton fibre brown pigments for studying this gene has further established certain Research foundation.

In plant gene function research, transgenic function complementation and gene silencing are the effective technology means disclosing gene function.Have complementary functions and transform this deletion mutant body by building the sense expression vector of goal gene, thus verify the function that this gene performs in plant materials.For the checking of homologous gene function, also can adopt the mutant transforming approximate species, thus complete homogenic functional verification fast., single traits mutant library longer for the cotton transgenic cycle lacks, and the functional verification adopting arabidopsis thaliana transformation mutant to carry out homologous gene or similar genes structural domain is a kind of fast method.Gene silencing is the ancient mechanism of one of organism, and it is played a role by modes such as degradation of rna, suppression translation or modification karyomit(e)s in g and D process.In recent years, this technology is used widely in molecular biology of plants research and genetic improvement as an important genetic manipulation instrument, various plants gene silent technology is set up in succession, comprise sense-rna, dsRNAi (double-stranded RNA interference) and artificial microRNA, particularly dsRNAi and microRNA and had new breakthrough in the accuracy and high efficiency etc. of gene silencing.DsRNAi and microRNA is higher than Antisense RNA Technique in the efficiency of degraded target gene mRNA, target gene can be made under the concentration lower than the several order of magnitude of sense-rna to express drop to extremely low level even function completely lose; And in transgenic protocol, there is not the problem of insertion point randomness, any gene all can by dsRNAi or microRNA specificity is reticent targetedly in theory.

Summary of the invention

In order to clone and understand cotton fiber brown pigments synthesis related gene and and then Cotton Fiber of Natural Brown Cotton quality is improved, the means such as biotechnology are utilized to realize the variation of cotton fiber color and luster, first object of the present invention is to provide cotton GhMATE1 gene and the protein by this genes encoding, and prove that this gene had both participated in the formation of seed coat brown pigments by experiment, participate in again the formation of fiber brown pigments, be expected to be applied in brown cotton breeding.Second object of the present invention is to provide expression vector containing above-mentioned gene and host cell.3rd object of the present invention is to provide the application of above-mentioned gene in improvement cotton brown fibre color and luster.

In order to realize first above-mentioned object, present invention employs following technical scheme:

Cotton GhMATE1 gene, the nucleotide sequence of this gene is as shown in SEQ ID:NO.1.

By a protein for above-mentioned genes encoding, the aminoacid sequence of this protein is as shown in SEQ ID:NO.2.

In order to realize second above-mentioned object, present invention employs following technical scheme:

The plant positive sense complementary binary expression vector of cotton GhMATE1 gene, this expression vector with plant binary vector pFGC5941 for skeleton carrier, choose the just expression structure of one section of sequence containing GhMATE1 gene whole protein encoder block as this gene, and introduce BamHI and XhoI restriction enzyme site respectively, thus construct the sense expression vector containing GhMATE1 gene.

A kind of host cell, the plant positive sense complementary binary expression vector of the cotton GhMATE1 gene described in this host cell adopts transforms.As preferably, the bacterial strain of described conversion adopts Agrobacterium EHA105.Further, described host cell adopts osmose process arabidopsis thaliana transformation mutant tt12.

The double-stranded RNA interference expression vector of cotton GhMATE1 gene, this expression vector with plant binary vector pCAMBia2301 for skeleton carrier, choose the expression nuclear structure of plant binary vector pBI121, enzyme is cut, connect and be built into carrier pCAMBIA2301-121, again in the cotton gene group shown in SEQ ID:NO.1 one section of sequence as the middle Loop ring texture building double base interference vector, shown in the sequence SEQ ID:NO.3 of Loop ring texture, primer is upstream primer: AGAAGCGAGATGAGGGATGT, downstream primer: CATTT TCATGCGAAGGATTC.

A kind of host cell, the double-stranded RNA interference expression vector of the cotton GhMATE1 gene described in this host cell adopts transforms.

In order to realize the 3rd above-mentioned object, present invention employs following technical scheme:

The application of the gene of nucleotide sequence as shown in SEQ ID:NO.1 in improvement cotton brown fibre color and luster.

The present invention is in clone cotton GhTT12a gene (Chinese invention patent application number: 2013103802705 in early stage, the applying date: 2013-8-27) on basis, utilize the method for bioinformatic analysis and electronic cloning, clone a new gene containing MATE conserved domain, but gene structure, cut mode are completely different from GhTT12a gene, this gene and Arabidopis thaliana seed coat brown pigments synthesize the sequence homology that TT12 gene nucleotide series exists 78%.Utilize the method for RT-PCR to clone this gene subsequently, called after GhMATE1, this genes encoding 497 amino-acid residues, molecular weight is about 53.6KD, belongs to a member in MATE supergene family.Quantitative fluorescent PCR is utilized to analyze the expression characteristic of GhMATE1 gene at development in different stages fiber, seed coat, result shows: equal predominant expression in the brown fibre of GhMATE1 gene and tetraploid cotton cotton diploid, white cotton seed coat and brown cotton seed coat, express hardly in white cotton fiber, illustrate that this gene had both participated in the formation of seed coat brown pigments, participate in again the formation of fiber brown pigments.For the functional analysis of cotton GhMATE1 gene, build plant justice binary expression vector promotor 35S::GhTT12a::Nos terminator and express nuclear structure complement Arabidopsis mutant tt12, Molecular Identification and transgenosis physiologic analyses all show that this gene can make Arabidopsis Mutants tt12 recover wild type phenotype, thus prove that this gene participates in the synthesis of seed coat brown pigments; According to molecular structure and the conserved domains characteristic of this gene, build 2 kinds of dissimilar double-stranded RNA interference carriers (dsRNAi, carrier sequence sees appendix), transform brown cotton, to brown cotton 30 transgenic line T by the pollen tube passage method of damage ₀generation and T ₁the Molecular Identification in generation and the analysis of transgene cotton physiologic index all show that this gene all can reduce the color and luster of cotton brown fibre in various degree, thus prove that this gene participates in the metabolism of cotton fiber brown pigments.In research process, utilize GhTT12a gene and obtained the cotton germ plasm resource 10 parts of brown fibre of different depth degree by biotechnological means, these germplasm materials of innovation are expected to be applied on Cotton Fiber of Natural Brown Cotton quality-improving.

Accompanying drawing explanation

Fig. 1 is intron and the exon schematic diagram of cotton GhMATE1 gene.

Fig. 2 is the homogenic aminoacid sequence comparison diagram of cotton GhMATE1 gene and other species TT12.

Fig. 3 is the nucleotide sequence phylogenetic analysis figure of cotton GhMATE1 gene.

That Fig. 4 is GhMATE1 gene is brown diploid, tetraploid, the expression level figure of white cotton fiber different development stage.

Fig. 5 is the design of graphics containing GhMATE1 gene plant sense expression vector.

Fig. 6, Fig. 7 are the structure schema containing GhMATE1 gene 2 different structure double base interference vectors.

Fig. 8 turns the pcr amplification qualification figure of the positive strain that Arabidopis thaliana tt12 mutant obtains for cotton GhMATE1 gene; M:DNAmarker DL2000,1: the positive plasmid pFGC5941-GhMATE1 containing cotton GhMATE1 gene; 2,3,4,5,6: spray the Arabidopis thaliana individual plant that Basta has resistance; 7: wild-type Arabidopsis plants.

Fig. 9 turns cotton GhMATE1 gene at the positive strain root of complement Arabidopsis tt12 mutant, stem, leaf, angle fruit and the expression level figure in spending.

Figure 10 be turn cotton GhMATE1 gene in the positive strain of complement Arabidopsis tt12 mutant containing spirogram.

Figure 11 is that in cotton GhMATE1 gene interference vector, Partial Fragment is turning the pcr amplification qualification figure in nigger-brown fibre cotton; M:DNAmarker DL2000,1: the positive plasmid pFGC5941-GhMATE1RA containing cotton GhMATE1 gene interference vector; 2,3,4,5,6,7: spray the transgenic cotton individual plant that 4/1000ths card sodium mycins have resistance; 8: the cotton T586 individual plant of wild-type.Figure 12 is the application drawing that cotton GhMATE1 interferes dark-brown cotton fibre; ZM11: non-transgenosis white cotton Zhejiang cotton 11; T586: cotton T586 strain (transgenosis parent plant) of dark-brown; T0-1: dark-brown cotton interferes strain 1; T0-2: dark-brown cotton interferes strain 2; T0-3: dark-brown cotton interferes strain 3; T0-4: dark-brown cotton interferes strain 4; T0-5: dark-brown cotton interferes strain 5; T0-6: dark-brown cotton interferes strain 6.

Embodiment

1. materials and methods

1.1 vegetable materials and growth conditions

Cottonly in the purple cotton and cotton Yuyao of white fiber of color cotton No. 2 of upland cotton brown fibre Zhejiang, white fiber cotton Zhejiang cotton 11, the cotton Cixi of diploid brown fibre to provide by Zhejiang Academy of Agricultural Science crop and cash crop research department of nuclear technique research on utilization institute and field is tested by live Hangzhou, the court academy proper that is seeded at the beginning of 2011 5 months.At the 9d(Post flowering of cotton Post flowering, DPA, DayPost Anthesis), 12d, 15d, 18d, 21d and 24d, choose the cotton fiber tissue of growing respectively and seed coat tissue carries out correlative study.

1.2 experimental technique

1.2.1 the extraction of cotton genomic dna and cotton fibre, seed coat tissue total serum IgE

Cotton genomic dna extracts and adopts CTAB method (Li et al., 2001).The method that employing polyphenol, polyose plant RNA extraction test kit provide extracts cotton fiber tissue, seed coat tissue total serum IgE, and test kit is purchased from Tyke, Beijing hundred Bioteck Bioisystech Co., Ltd.

1.2.2 utilize bioinformatic analysis to screen and clone cotton GhMATE1 gene

According to the protein conserved domain sequence of the cotton brown fibre pigment GhTT12a gene of having cloned and Arabidopis thaliana seed coat brown pigments AtTT12 gene, search cotton ESTs database (http://blast.ncbi.nlm.nih.gov/), (GenBank accession number is DT563323.1 to select 3 sequences altogether, DT568479.1, ES823453.1).Search for ESTs databases with these 3 est sequences and splice again, final acquisition sequence, this sequence contains an entire open reading frame (ORF, OpeningReading Frame), and the protein predicted according to this sequence ORF and Arabidopis thaliana TT12 albumen exist the homology of about 82%.According to the sequence signature with ORF, the special primer (P1:TGTAAAGCATGGGTTCAGAGG and P2:ACATCTCAAGTGCCATCTACCT) of design 1 pair of pcr amplification.

CDNA first chains that cotton fiber tissue's total serum IgE reverse transcriptions of growing 15DPA with the color cotton No. 2 in Zhejiang respectively obtain are for template, and in conjunction with round pcr, amplification condition is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 30s, 56 DEG C of annealing 30s, 68 DEG C extend 2min; 30 PCR circulations, last 68 DEG C extend 10min, 15 DEG C of insulations.Amplification system is 50ul:2X KOD amplification reaction solution, 10ul dNTP, 2ul P1 primer, 2ul P2 primer, 1ul KOD FX, and 5ul transcribes after product, 5ul ultrapure water; Again PCR primer is added A, adding A reaction system is that 10ul:5ul connects damping fluid, and 1ul pTA2 carrier, 1ul ligase enzyme, 1ul adds A connecting fluid, 2ul KOD amplified production.Transformation of E. coli competence TG1, screening positive clone send Nanjing Genscript Biotechnology Co., Ltd. to check order.Adopt Reverse Transcription box synthesis cDNA first chain of MBI company, utilize KOD FX enzymatic amplification to obtain the GhMATE1 gene (bio tech ltd is spun by Japan for TOYOBO, Shanghai) inferred.Primer involved by this experiment all synthesizes the raw work biotechnology Engineering Service company limited from Shanghai.

1.2.3 design of primers and bioinformatic analysis

The design of primers related in research utilizes Primer Premier5.0

( http:// www.premierbiosoft.com/index.html) complete, utilize DNAman6.0 software

( http:// www.lynnon.com) tetraploid rice and nucleic acid Phylogenetic analysis are carried out to aminoacid sequence, the supposition of protein conserved domain adopts the Blast on-line analysis system in Genbank database

( http:// blast.ncbi.nlm.nih.gov), concrete structural domain position analysis utilizes the online software analysis of SMART

（ http://smart.embl-heidelberg.de）。

1.2.4 the structure characteristic analysis of cotton GhMATE1 gene

Positive colony after connection is after order-checking, and point 4 sections of design primers, the genomic DNA fragment of its correspondence that increases, through adding A, cutting glue and reclaiming, being cloned into pTA2 carrier, obtain the DNA sequence dna of this gene through order-checking splicing.Enzyme used in experiment and carrier the same.

1.2.5 quantitative fluorescent PCR is utilized to analyze the expression characteristic of GhMATE1 gene in diploid cotton and four times of cottons

According to the fibrous tissue of cotton different development stage, the cDNA of seed coat tissue, detect the relative expression levels of GhTT12a gene in development in different stages fiber, seed coat tissue with real-time fluorescence quantitative RT-PCR.Cotton GBQ7 gene is used as the reference gene (amplimer) (Tu et al., 2007) of quantitative fluorescent PCR, and the specificity amplification primer of GhTT12a gene is in table 2.Experimental implementation equal reference reagent box specification sheets (bio tech ltd is spun by Japan for TOYOBO SYBR Green Supermixture, Shanghai), the temperature cycle of quantitative fluorescent PCR: 50 DEG C, 1min; 94 DEG C of denaturation 3min; 94 DEG C of sex change 30s; 56 DEG C of annealing 30s; 72 DEG C extend 45s; Amount to 30 PCR circulations.

Primer used in table 2 quantitative fluorescent PCR and sequence

1.2.6 the structure of cotton GhMATE1 gene sense expression vector and the complementation test of Arabidopsis Mutants tt12

The GhTT12a gene cDNA sequence obtained according to order-checking also determines the entire protein coding sequence of this gene.Produce because Arabidopis thaliana tt12 mutant is inserted by T-DNA, therefore, we select the two carrier free pFGC5941 of expression of plants as the positive sense complementary carrier of this gene, introduce restriction enzyme site XhoI, introduce restriction enzyme site BamHI(GhMATE1P1:CCG at clearing end at initiating terminal cTCGAGtGTAAAGCATGGGTTCAGAGG; GhMATE1P2:CGC gGATCCthus build complete just genetic expression structure ACATCTCAAGTGCCATCTACCT).

Adopt osmose process arabidopsis thaliana transformation mutant tt12.To shake bacterium containing recombinant plasmid Agrobacterium at 28 DEG C spends the night to OD600 value between 1.0-2.0, and the centrifugal 8min of 8000rpm, abandons supernatant and collect thalline.Precipitation be the sucrose of 50g/L containing mass concentration, the MS substratum of pH value 5.7 is resuspended is about 0.5 to OD600 value, and add 0.02%Silwet70, after abundant mixing, Arabidopis thaliana inflorescence is immersed, bacterium liquid is stirred every 2min, take out after 10min and keep flat and moisturizing 12--24 hour, after 4 weeks, collect the seed of Arabidopis thaliana tt12 after transforming.

1.2.7 the structure of cotton GhMATE1 gene double-stranded RNA interference vector

According to the hairpin ring structure that section sequence of in cotton gene group designs as interference vector, this section of sequence sees appendix 4, amplimer INA, INB, in hair clip Loop ring design, introduce restriction enzyme site BamHI, SacI and KpnI.The justice end primer restriction enzyme site XbaI of 2 kinds of different interference structures of cotton GhMATE1 gene, BamHI; Antisense end introduces restriction enzyme site SacI and KpnI, thus builds complete hairpin ring structure, and the primer sequence information related to is in table 2.The amplification of Loop ring structure take cotton genomic dna as template, the GhTT12a gene PCR product that in interference vector structure, the amplification of gene fragment obtains with reverse transcription is for template, KOD FX enzymatic amplification is all adopted to obtain object fragment (bio tech ltd is spun by Japan for TOYOBO, Shanghai).

Primer used in table 2 quantitative fluorescent PCR and sequence

1.2.8 improved method pollen tube passage method converting cotton

Process containing the fresh bacterium liquid of object interference vector Agrobacterium LBA4404: will shake bacterium containing recombinant plasmid Agrobacterium at 28 DEG C and spend the night to OD600 value between 1.0-2.0, the centrifugal 8min of 8000rpm, abandons supernatant and collect thalline.Precipitation be the sucrose of 50g/L containing mass concentration, the MS substratum of pH value 5.7 is resuspended is about 0.5 to OD600 value, and adds 0.02%Silwet70, fully use immediately after mixing, every 2min stirring bacterium liquid.

The operation of improved method pollen tube passage method converting cotton: namely bloom between pollination 3--6 point that afternoon in cotton, with blade, cotton column cap is rived, dip with very little cotton mass and soak through processing and containing the fresh bacterium liquid of the Agrobacterium LBA4404 of object carrier, then be clipped in the cotton mass that tweezers gripping contains bacterium liquid in the column cap of riving, the cotton column cap moisturizing using straw (plastic grip) to clamp subsequently to rive.The line of conversion treated cotton bell different colours pricks cotton boll base portion to show difference, distinguishes and come when being convenient to sowing.

1.2.9 transgenic arabidopsis, cotton plants field test and Molecular Identification

After the Arabidopis thaliana seed that transgenosis is collected is dried, after 75% ethanol (containing the 0.2% polysorbas20) 10min that sterilizes, abandon supernatant, then after using dehydrated alcohol rinsing 10s, be placed on aseptic filter paper and dry up 30min, be seeded in MS substratum, after the illumination box of illumination 8h, dark 16h cultivates 14d, the Basta solution spraying 3/1000ths concentration carries out the preliminary evaluation of positive strain.

The qualification of the positive strain of transgene cotton adopts cotyledon period card sodium mycin Rapid identification method.

T0, T1 Basta qualification and the qualification of card sodium mycin all to resistance is selected to carry out PCR detection for Arabidopis thaliana and cotton plants.Goal gene amplification and interference vector fragment amplification and identify sequence see table 2 and table 4, following 94 DEG C of PCR circulating reaction condition, 30s; 64 DEG C, 30s; 68 DEG C, 90s.

1.2.10 the mensuration of transgenic arabidopsis, cotton seed coat brown pigments and fiber brown pigments content

The isolation and determination of transgenic positive strain and offspring's brown pigments is first adopted p-Dimethylaminocinnamaldehyde (DMACA) and is analyzed, respectively seed, fiber to be immersed in 2%DMACA and 3M hydrochloric acid (volume ratio) solution 4 days, more totally to observe under optical microphotograph with the ethanol purge of 70%; The second, measure the Flavonoid Content of material by high performance liquid chromatography (HPLC), concrete operation step is see document ^[11,16].

2. results and analysis

2.1 cotton GhTT12a gene clones, sequence information and gene structure feature

The speculated sequence information obtained is spliced according to est sequence, design the encoder block region that primer covers this gene respectively, obtain aim sequence in conjunction with RT-PCR method again, it is consistent that the result that order-checking obtains and EST splice the data obtained, and proves this sequence GhMATE1 gene just.From 46bp to the 1516bp of GhMATE1 gene open reading frame, coding 497 amino acid altogether, molecular size range is 53.6KD, in conjunction with SMART On-line analysis program (http://smart.embl-heidelberg.de/), show between the 27th to 469 amino acids, there are continuous 10 membrane spaning domains (aminoacid sequence of the middle line that sees the following form).Utilize Blast to analyze to show, this aminoacid sequence belongs to MATE(multidrug and toxic compound extrusion) supergene family.

Underscore amino acid moiety is continuous print 10 membrane spaning domains ,=representing the initiator codon position of this gene, * represents the position of terminator codon.

Utilize the same primers of amplification GhMATE1 gene, segmentation amplification Asiatic cotton brown cotton genomic dna, obtain the PCR primer of about 2.9Kb, after checking order and be spliced into complete sequence, analyze show this amplified fragments really for this gene for DNA sequence dna, result also shows GhMATE1 gene has 5 exons and 4 introns to form, as shown in Figure 1.E1-E5 represents exon, and single line bar represents intron.

The phyletic evolution of 2.2 cotton GhTT12a genes and homology analysis

BlastP is carried out to the aminoacid sequence of cotton GhMATE1 genes encoding and other species TT12 protein and Multiple sequence alignments (mutiple alignment) is analyzed, result shows, cotton GhMATE1 gene is the same with other species TT12 gene, all containing MATE conserved domain, and with the TcTT12-2 of cocoa tree, the GaTT12a of Asiatic cotton, the GmTT12 of soybean, the BnTT12 gene of rape and the albumen coded by AtTT12 of Arabidopis thaliana all have certain amino acid sequence similarity, especially the sequence containing MATE domain portion between aminoacid sequence 45--480 is more consistent, show that TT12 gene is comparatively conservative in evolution, as shown in Figure 2.

The TT12 homologous genes choosing other 7 kinds of species carries out Multiple sequence alignments together with cotton GhMATE1 gene, builds the Phylogenetic tree of 8 species TT12 homologous geneses simultaneously.As shown in Figure 3, the TcTT12 of cotton GhMATE1 gene and cocoa tree is the most close on evolutionary relationship, amino acid sequence homology reaches 90%, on evolutionary relationship, also there is the sequence homology of 82% with the GaTT12a gene of Asiatic cotton, and between the GmTT12 gene in soybean, there is the homology of about 81%.

Arabidopis thaliana (Arabidopsis thaliana) AtTT12(NM_115765.3), rape (Brassica napus) BnTT12(EU818785.1), apple (Malus x domestica) MdTT12-1(GU064954.1), soybean (Glycinemax) GmTT12(XM_003553118.1), clover (Medicago truncatula) MtTT12-1(FJ858726.1), MtTT12-2(GU064955), cocoa tree (Theobroma cacao) TcTT12-2(EOX93053) and Arabidopis thaliana (Arabidopsisthaliana) AtTT12(NP_191462) TT12 homologous gene.

2.3 the expression analysis of cotton GhMATE1 gene in cotton different developmental phases fiber, seed coat tissue

In order to study the expression pattern of GhMATE1 gene in Diploid and Tetraploid cotton fibre different steps, we adopt the method for real-time fluorescence quantitative RT-PCR to detect the expression of this gene.Select Boll Development to the fibrous tissue of Post flowering 9d, 12d, 15d, 18d, 21d, 24d and seed coat tissue respectively, extract total serum IgE, cDNA first chain utilizing reverse transcription to synthesize is as the template of fluorescence quantitative PCR detection, and fluorescent quantitation detected result as shown in Figure 4.The expression of GhMATE1 all can be detected in all samples.In the purple cotton and color cotton No. 2 in Zhejiang of the cotton Cixi of brown fibre, along with seed coat and the growth of Fibre Development time, the expression amount of GhMATE1 all has increasing in various degree, and especially after 15DPA, expression amount has and improves rapidly; But in white cotton Yuyao in cotton and Zhejiang cotton 11 in cotton fibre, along with the growth of development time, this gene expression amount to present future and increase substantially, and maintain your the low level that compares always.In 18DPA and 21DPA period, the expression amount of GhMATE1 in brown fibre is 8 times and 10 times of expression amount in white fiber respectively.Above result tentatively shows: GhMATE1 gene predominant expression in brown fibre.

The structure of 2.4 cotton GhMATE1 gene plant positive sense complementary binary expression vectors

In order to verify whether cotton GhMATE1 gene participates in the anabolism of cotton seed coat brown pigments, test with plant binary vector pFGC5941 as skeleton carrier, choose the just expression structure of one section of sequence containing GhMATE1 gene whole protein encoder block as this gene, and introduce BamHI and XhoI restriction enzyme site respectively, building process See Figure 5, Fig. 6.Finally by double digestion, PCR qualification and order-checking, show that object fragment is connected in binary expression vector, thus construct the sense expression vector containing GhMATE1 gene, name pFGC-GhMATE1.

2.5 cotton GhTT12a gene plants interfere the structure of expression vector

With plant binary vector pCAMBia2301 for skeleton carrier, choose the expression nuclear structure of plant binary vector pBI121, enzyme is cut, connect and be built into carrier pCAMBIA2301-121, in cotton gene group, one section of sequence is as the middle Loop ring texture building double base interference vector again, and sequence and the primer location of Loop ring texture see the following form.

Underlined sequences is the primer sequence of hairpin loop structures.

According to the MATE domain region of cotton GhMATE1 gene protein sequence, the sequence that selection 2 sections is different is respectively as the positive-sense strand of the interference expression structure of this gene, the antisense strand of its correspondence is as the reverse complemental structure built, the justice end of the chain introduces XbaI and BamHI restriction enzyme site, and anti-sense strand complementary introduces KpnI and SacI restriction enzyme site.Building process is shown in Fig. 7.Finally by incomplete double digestion, PCR qualification and order-checking, show that object fragment is connected in binary expression vector, thus construct the interference expression vector containing 2 different interference structures, respectively called after pGhMATE1RI-A and pGhMATERI-B.

The qualification of 2.6 cotton GhMATE1 gene complementation Arabidopsis Mutants tt12

The sense expression vector pFGC-GhMATE1 containing cotton GhMATE1 gene built is proceeded to Agrobacterium EHA105, by agriculture bacillus mediated titbit dip method arabidopsis thaliana transformation tt12 mutant, and obtains seed.In order to detect cotton GhMATE1 gene whether successful conversion tt12 mutant, when the arabidopsis thaliana transformation T0 individual plant obtained grows to 3----4 sheet leaf, the Arabidopsis plant that Basta spray solution with 3/1000ths is growing, after 2 weeks, choose 4 strains have resistance Arabidopis thaliana individual plant to Basta, with Arabidopsis Mutants tt12(N5740, http://www.arabidopsis.org/) genomic dna of strain as template, detected by PCR reaction.Result shows, 4 transgenic arabidopsis strains all amplify object band (Fig. 8).Show that cotton GhMATE1 gene successfully proceeds to Arabidopsis Mutants, and Bar gene normal expression.

In order to verify the cotton GhMATE1 gene that proceeds to whether normal expression, we adopt the method for quantitative fluorescent PCR to detect the expression of this gene.Be expressed as contrast with wildtype Arabidopsis thaliana TT12 gene, select the T1 of above 4 strains for the positive strain of Basta, detect respectively by strain.In Arabidopis thaliana tt12 mutant, the expression intensity of cotton GhMATE1 gene is shown in Fig. 9.As can be seen from Fig. 9 table, wildtype Arabidopsis thaliana TT12 gene is all lower at root, stem, leaf and the expression amount in spending, then the expression amount in the fruit of angle is abnormal high, shows that TT12 gene mainly plays a role in Seed development, basically identical with the research of forefathers.With the 5 strain T1 of cotton GhMATE1 gene success complement Arabidopsis mutant tt12 in positive strain, root, stem, leaf and the expression amount difference in spending are not clearly, but the expression amount between strain has notable difference, it may be the reason with composition type expression promoter CaMV35S.

For determining whether GhMATE1 performs the function identical with Arabidopis thaliana TT12 further, we extract flavonoid compound PAs polymkeric substance from the seed of the positive individual plant results of complementary tt12 mutant, and combined acid catalytic hydrolysis and liquid chromatography mass (LC-MS) analysis measure its content.In strongly-acid and oxicracking condition, the monomer output of PAS pink cyanidin(e) can quantitative analysis easily.In Arabidopis thaliana tt12 mutant seeds, insoluble PAs is 5 times of content in wild type seeds, and solubility PAs and insoluble PAs content are more or less the same.Positive individual plant measurement result after complementation shows, solubility PAs greatly reduces compared with the content in mutant tt12, minimizing ratio is respectively 69%, 63%, 74%, 70% and 68%, in positive strain, insoluble PAs is 4.81,4.17,3.79,4.57,4.35 times of solubility PAs, more than the results are shown in (data slightly) shown in Figure 10.Above experimental result shows: cotton GhMATE1 gene is formed at cotton seed coat brown pigments and performs critical function, similar with AtTT12 gene function.

2.7 cotton GhMATE1 gene dsRNAi carriers, in expression process, reduce the color and luster of dark-brown cotton fibre in various degree

According to the gene structure of cotton GhMATE1, we devise 2 kinds of different double-stranded RNA interference carrier structures respectively, improved method pollen tube passage method is utilized to transform the cotton P158 of nigger-brown fibre, and for positive strain, Molecular Identification has been carried out to T0, confirm that goal gene has turned the brown color cotton of depth (Figure 11), and transgenosis T0 presents for some individual plants the brown cotton (Figure 12) that depth degree differs.Above experimental result shows that cotton GhMATE1 gene also participates in the anabolism of cotton fiber brown pigments simultaneously, in fiber brown pigments is grown, play critical function.

3. discuss

The present invention utilizes bioinformatic analysis again in conjunction with homologous clone and possible function.According to the EST data that cotton in ncbi database is huge, to the higher est sequence splicing of similarity, integrate thus obtain the aim sequence of initial guess, binding molecule biology correlation technique obtains the real sequence of goal gene again, thus is cloned into goal gene faster.This method is particularly useful for studying the species comparing and further investigate and establish EST storehouse.Up to the present, in ncbi database, only the est sequence of cotton different tissues is more than 310,000, and new cotton est sequence is still in constantly increasing, and making full use of these data messages, is a kind of effective ways obtaining cotton new gene fast.

Containing typical membrane spaning domain in cotton GhMATE1 protein sequence.Sequence alignment analysis shows, gene on GhMATE1 gene and GaTT12a gene and other species also exists certain consistence in sequence, but the homology of whole coding region protein reaches 82%, and containing MATE conserved domain, but the cut mode of these 2 genes is completely different, nucleotide sequence homology only has 76%, may be relevant with the evolution of this gene in different plant species.And these 2 genes all exist in diploid and tetraploid cotton.

Cotton is the important cash crop of China, fibre crops.In natural liquor storeroom, the height of brown pigments content has influence on again the depth of cotton fibre color and luster, and the precursor substance of brown pigments is proanthocyanidin.This research is started with from cotton GhMATE1 gene, different varieties color and luster filamentary material is utilized to carry out preliminary study to seed coat, the biosynthesizing of fiber brown pigments, recognize the vital role of GhMATE1 gene in the synthesis of cotton proanthocyanidin. in the Cotton Fiber of Natural Brown Cotton pigment synthesis metabolism related gene of having cloned, as GhCHS1, GhCHI, GhF3H, GhDFR, GhANS, GhANR etc., these genes all have higher homology with Arabidopis thaliana seed coat brown pigments metabolic pathway of synthesizing genes involved, but the research participating in cotton seed coat brown pigments function has no report always.Arabidopis thaliana TT12 protein coding transdermal delivery albumen, Cyanidin-3-oxygen-reverse transport of glucosides/hydrogen is responsible in brown pigments anabolism, thus cause the accumulation of former anthocyanogen lead in vacuole, in seed coat brown pigments metabolic pathway of synthesizing, perform critical function.Therefore, infer that the above homologous gene in cotton also participates in the synthesis of seed coat brown pigments simultaneously.

Initial analysis in, white cotton brown at 2 times of body Asiatic cottons to GhMATE1 gene and tetraploid cotton fibre shows: this gene expression amount in Cotton Fiber of Natural Brown Cotton is the highest, and minimum in white cotton fiber.This research demonstrates cotton gene GhMATE1 and not only participates in the anabolism of cotton seed coat brown pigments but also participate in the anabolism of fiber brown pigments, thus proved conclusions from molecular biology level, also for the anabolism of research cotton fiber brown pigments provides a kind of Research Thinking.Also imply that cotton seed coat brown pigments may share similar pathways metabolism with the synthesis of fiber brown pigments simultaneously.According to above result of study, the brown cotton individual plant that fiber color is deep mixed can be filtered out, be expected to be applied in breeding.

Sequence table

<110> the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute; Zhejiang Academy of Agricultural Science

<120> cotton GhMATE1 gene and expression vector, host cell and the application in improvement cotton brown fibre color and luster

 

<160>6

 

<210> 1

<211> 1654

<212> DNA

<213> cotton

<400> 1

1 ATAGAAGTCA TTTGCCTAAC GTAAATACTA GAAAGCTGTA AAGCATGGGT TCAGAGGAAC

61 AGCGGCCATT GCTACGAATA TCGGAATTAT CATCGGATGC GATCGAAGAG GTTTTTGAAA

121 GTGGCGACGG CGGCGGAGGA GTAGGGTGGT GGGTGAGGCT TGTTGCGTGG GAATCGAGGA

181 TTTTGTGGTT GTTATCAGGG GCATCCATAA TTGTCTCTGT TTTTAATTAT ATGCTCACTT

241 TTGTCACTTT AATGTTCACT GGTCATCTTA ATGCATTGGA ATTGGCTGGT GCTTCTATTG

301 CTAGTGTTGG AATTCAAGGT CTTGCTTATG GGATTATGTT GGGCATGGCG AGTGCGGTAC

361 AGACCGTGTG TGGCCAAGCA TACGGTGCCA AGAAATACGC AGCCATGGGG ATCATTTGCC

421 AAAGAGCAAT TGTATTACAC ATAGGAGCCT CAGTTATCCT AACATTCCTC TATTGGTATT

481 CGGACACCGT CCTTCAAGCA ATAGGTCAAT CGGCAAGTAT AGCAGAGCAA GGCCAAGTTT

541 TCGCCCGTGG TTTAATCCCT CAACTTTACG CATTCGCCAT AAGTTGCCCC ATGCAAAGGT

601 TCCTTCAAGC TCAAAACATA GTGAATCCTT TGGCTTATAT CTCCGTTGGG GTATTTTTGC

661 TCCACATTCT TCTTACTTGG CTTGCCGTTG ATGTATTGGG ATATGGTCTT CTTGGGGCAT

721 CTTTGACATT AAGTCTTTCA TGGTGGATTC TTACTATTCT TAATGGACTT TACATTGTTT

781 TAAGTCCTTC CTGTAAAGAG ACTTGGACTG GTTTGTCTAC TAAAGCTCTT AAAGGGATTT

841 GGCCTTATTT CAAGATTACT GCTGCTTCTG CTGTTATGCT TTGCTTGGAG ATATGGTATA

901 ACCAAGGACT GGTGCTTATA TCTGGTCTTC TTCCTAATGC AGCAATTGCA CTAGACTCCA

961 TTTCTATTTG CATGAACTAC TGGAACTGGG ATATCAACTT TGTTTTAGGC TTTAGTGCAG

1021 CAGCCAGTGT GCGAGTGAGT AATGAGCTAG GGGCAGGGCA TCCCAAGCTG ACCAAATTTT

1081 CAGTCATAGT AGTGAATGCT ACCAGCATTT TCATTAGTAC AGTTTTCACT GCCATTGTTA

1141 TCATATGTCG ATCCCTATTA ATCAAAGCTT TCTCAACCGA CGCTGAAGTT ATACAAGCTG

1201 GTTCCAGTTT GATTCCATTG CTTGCCATCT CCATTTTCTT GAATGGAATC CAGCCCATTC

1261 TCTCAGGAGT GGCCATTGGG AGTGGATGGC AACATATAGT AGCATATGTC AACCTCACTA

1321 CATATTACAT TATTGGTCTT CCAATTGGAT GTGTTCTTGG ATTCAAATTA GGCTTAGGAG

1381 TAGAAGGTAT ATGGTGGGGG ATGGTAGTTG GGGTTCTTCT ACAAACAATA ACTCTAATCA

1441 TTCTCACTGC CAGAACAAAC TGGGACTTGG AGGTTGAAAA AGCTGCGGAT CGGTTGAGGA

1501 AATCAGCCAA TGAAGAGACA TTACATTTGA TTACTGATTA GAGGTAGATG GCACTTGAGA

1561 TGTAGTCAAA TAAACATTAC ATACATTTAG TTCTCTCTTT TCTTAGTTTT ATTTTTTTTA

1621 ATATAAATCT GTTTGCCAAA AAAAAAAAAA AAAA

 

<210> 2

<211> 499

<212> amino acid

<213> cotton

<400> 2

1 MGSEEQRPLL RISELSSDAI EEVFESGDGG GGVGWWVRLV AWESRILWLL SGASIIVSVF

61 NYMLTFVTLM FTGHLNALEL AGASIASVGI QGLAYGIMLG MASAVQTVCG QAYGAKKYAA

121 MGIICQRAIV LHIGASVILT FLYWYSDTVL QAIGQSASIA EQGQVFARGL IPQLYAFAIS

181 CPMQRFLQAQ NIVNPLAYIS VGVFLLHILL TWLAVDVLGY GLLGASLTLS LSWWILTILN

241 GLYIVLSPSC KETWTGLSTK ALKGIWPYFK ITAASAVMLC LEIWYNQGLV LISGLLPNAA

301 IALDSISICM NYWNWDINFV LGFSAAASVR VSNELGAGHP KLTKFSVIVV NATSIFISTV

361 FTAIVIICRS LLIKAFSTDA EVIQAGSSLI PLLAISIFLN GIQPILSGVA IGSGWQHIVA

421 YVNLTTYYII GLPIGCVLGF KLGLGVEGIW WGMVVGVLLQ TITLIILTAR TNWDLEVEKA

481 ADRLRKSANE ETLHLITD

 

<210> 3

<211> 420

<212> DNA

<213> cotton

<400> 3

1 TGAAAAGTAG AAGCGAGATG AGGGATGTGC ATCGCTAAAA TTTCATCACA CAAATTTAAA

61 CAATGTTAAA TAAATATACT GAACATTATA TGGATTATTA TTAGTTATAG TGGTAGTTGA

121 CAGTTGGTTT TTGAAAGCTA TCATGTGCTT TTAATTAGTT TTTTTATATA TTTAAAAAAA

181 ATAATATAAG AATACTTGAT AATTTCTGAA ATTTGCTTGT GCAGTTTTTT TAATTTCATT

241 CTTAATATGC AACTTAATTA TCCTATGTTT AAATACAATT AAATATATTT AATGTATGTT

301 TTGAATGTTG ACATATTTAA TTATATTTAT GAAATTGATA TGAAAATAAT ACGAGACATA

361 GAACACAGTT ACAAATCGTC GAATCTGGGT AATATCATTT TCATGCGAAG GATTCAAACA

 

Claims (6)

1. cotton ghMATE1gene, is characterized in that: the nucleotide sequence of this gene is as shown in SEQ ID NO.1.

2. cotton described in claim 1 ghMATE1the plant positive sense complementary binary expression vector of gene, it is characterized in that: this expression vector with plant binary vector pFGC5941 for skeleton carrier, choose nucleotide sequence shown in SEQ ID NO.1 as the just expression structure of this gene, and introduce BamHI and XhoI restriction enzyme site respectively, thus construct and contain ghMATE1the sense expression vector of gene.

3. a host cell, is characterized in that: this host cell adopts expression vector according to claim 2 to transform.

4. host cell according to claim 3, is characterized in that: the bacterial strain transformed adopts Agrobacterium EHA105.

5. a protein, is characterized in that the aminoacid sequence of this protein is as shown in SEQ ID NO.2.

6. the application of gene according to claim 1 in improvement cotton brown fibre color and luster.