CN108517007B - Application of VdPHB gene in verticillium dahliae resistance - Google Patents

Abstract

The invention relates to the field of crop diseases, and provides an application of VdPHB gene in verticillium dahliae resistance, wherein the amino acid sequence of protein coded by the VdPHB gene is shown in SEQ.ID.NO. 2. By measuring colony morphology, growth rate, ectoenzyme activity and pathogenicity of the knocked-out mutant delta Vdplb and comparing and analyzing various indexes of a wild type, the VdpbB gene is determined to be a pathogenic gene of verticillium dahliae, and the harm of the verticillium dahliae can be reduced by inhibiting the expression of the VdpbB gene in the verticillium dahliae.

Description

Application of VdPHB gene in verticillium dahliae resistance

Technical Field

The invention relates to the field of crop diseases, in particular to application of a pathogenic gene VdPHB of verticillium dahliae as a target gene for resisting verticillium dahliae.

Background

During the whole production process of crops, the crops can suffer from various diseases, and great economic loss is caused to the crop production. Among them, fungal diseases are the most serious, and the losses caused by fungal diseases account for about 70-80% of the total losses of crops. The method separates pathogenic genes by researching the pathogenic mechanism of pathogenic fungi, and controls the occurrence and the degree of damage of fungal diseases by inhibiting the expression of the pathogenic genes is a new way for preventing and treating crop diseases.

Cotton verticillium wilt is a soil-borne vascular bundle fungal disease caused by verticillium dahliae. Due to the fact that verticillium dahliae is multiple in physiological type, rapid in mutation and complex in pathogenic mechanism, cotton verticillium wilt is difficult to prevent and treat. In 1935, verticillium wilt of cotton was introduced into China through the introduction of American cotton seed "Sizi cotton". Cotton verticillium wilt rapidly spreads in the fifties of the twentieth century, and cotton verticillium wilt has spread in various cotton areas of China at the end of the eighties. After the ninety years, the cotton verticillium wilt has a large-area outbreak, particularly the cotton verticillium outbreak in China in 1993, the area infected by the verticillium wilt reaches 267 ten thousand hectares, the cotton field causing the dead harvest reaches 13.8 thousand hectares, and about 1 hundred million kilograms of lint is lost. And then again in 2003, 2004, 2006, causing significant losses. According to the report statistics of international verticillium major 2012, the average yield of cotton is 2352 million tons in 2005-2010, the loss caused by cotton verticillium wilt is up to 30%, and the direct economic loss reaches $ 106 hundred million. The total cotton production amount in China accounts for one fourth of the global yield, no means for effectively preventing and treating cotton verticillium wilt exists at present, and once cotton is infected, the cotton yield and the fiber quality are greatly reduced. The cotton verticillium wilt is called 'cancer of cotton', and has become one of the main obstacles for stable, high and excellent cotton yield in China.

Verticillium dahliae Kleb belongs to Deuteromycotina, Moniliales, Achromosporaceae, and Verticillium. Verticillium dahliae can infect over 600 different crops, with a wide host range including vegetables (eggplant, pepper, potato, tomato), fruits (grape, olive and strawberry), ornamental flowers (chrysanthemum), oil seed crops (sunflower), fiber crops (flax) and woody perennial crops. The pathogenesis of verticillium dahliae is the hypothesis of blockage and the hypothesis of toxin. Researchers believe that the thalli invade into the crop body to generate a large amount of hyphae in the conduit and simultaneously stimulate the defense reaction in the crop body to generate colloidal substances in the conduit of the crop. Hyphae and colloidal objects produced by the crops block crop ducts, hinder the transport of water and cause crop wilting.

The theory of toxins suggests that verticillium dahliae, after invading into host plants, will secrete some toxic proteins or secondary metabolites, such as glycoproteins, cell wall degrading enzymes, etc., to inhibit the host defense reaction and thus cause apoptosis of cells, and further cause withering and death of hosts. Researchers add protein degrading enzyme and lipid degrading enzyme into the secretion of the verticillium dahliae coarse extraction respectively, and then send out the extract added with the protein degrading enzyme, so that the extract has no pathogenicity any more, and therefore, the protein component in the pathogenic toxin secreted by the verticillium dahliae can be determined to have important function. Therefore, the harm of cotton verticillium wilt can be effectively reduced by inhibiting the expansion of verticillium wilt.

In order to further understand the pathogenic mechanism of verticillium dahliae, researchers in various countries around the world have conducted a great deal of research. At present, researchers screen some related pathogenic genes from the established Verticillium dahliae T-DNA insertion mutant library. Of these, one encodes a glutamate-rich protein (VdGARP1), whose deletion was observed to affect melanin production in mutants. Importantly, the Δ VdGARP1 mutant was significantly less pathogenic. Vayg1 is also found to be involved in the generation of melanin in Verticillium dahliae, and the expression conditions of 6 melanin biosynthesis related genes of Verticillium dahliae are analyzed after a conidium is inoculated on a BMM plate by using a delta Vayg mutant, so that the expression quantity of the 6 genes is reduced, and a small amount of microsclerotia and melanin are generated by the delta Vayg mutant. In terms of pathogenicity, the mutant delta Vayg has reduced pathogenicity, the invasion colonization is inhibited when the mutant is colonized, and the pathogenicity is lower than that of the wild type, which indicates that the VAYG is not only involved in the formation of microsclerotia and melanin but also related to the pathogenesis of verticillium wilt. The verticillium dahliae microsclerotia germinate to produce hyphae or germ tubes which extend longitudinally on the surface of the root, and then some swollen hyphae are observed to perforate at the junction of cell epidermis to form a narrow penetrating bolt to help the verticillium dahliae to invade and colonize.

In addition, the investigators found two genes, VdPls1 and VdNoxB, which play a decisive role in formation of the penetrating plug. VdPls1 is an adenosine tetraphosphate, VdNoxB is a membrane-bound NADPH oxidase catalytic subunit for catalytic active oxygen production, and both proteins co-localize to sites at the base of attached branches where active oxygen is produced and the nail is penetrated. When two genes are deleted, the mutant strain can not generate penetrating nails and active oxygen, and the pathogenicity of the mutant is reduced. In further studies, it was found that VdNoxB/VdPls1 increased Ca by mediating the production of active oxygen²⁺Activates the VdCrz1 signal to regulate formation of the penetrating plug. In addition, researchers have found a protein with elicitor activity, verticillium dahliae necrosis ethylene-inducing protein (VdNEP), which is highly homologous to fungal necrosis ethylene-inducing protein. VdNEP is expressed separately and invades tobacco leaves, and the withered symptoms of the tobacco leaves are found. The VdNEP gene is expressed in arabidopsis thaliana, so that the content of active oxygen in arabidopsis thaliana is increased, and the expression of PR gene is improved. Addition of VdNEP protein toThe synthesis of gossypol, terpenes and the like is found in low concentration in the cotton cells cultured in suspension, and the death of the cultured cotton cells can be caused by increasing the concentration of protein. The protein is applied to cotton cotyledons and true leaves, and induces withering and death of the leaves. These results indicate that VdNEP is involved in the pathogenic process of Verticillium dahliae as an inducing factor.

The research results are combined to show that the pathogenic mechanism of the verticillium dahliae is complex, and a plurality of genes play a combined role in the pathogenic process. Interfering with the expression of these pathogenic genes can reduce the occurrence and extent of disease. Therefore, the verticillium dahliae can be effectively prevented from happening by searching for a pathogenic gene of the verticillium dahliae and interfering the pathogenic process of the verticillium dahliae. Up to now, there are few pathogenic genes of verticillium wilt with definite functions, and few target genes for preventing and treating the harm of verticillium wilt.

Disclosure of Invention

The invention aims to solve the technical problem of providing the application of VdPHB gene in cotton verticillium wilt resistance aiming at the defects of the prior art. In particular to clone a new secretory protein gene VdPHB from verticillium dahliae, and the pathogenic function of the gene is identified through deletion and function, thereby providing a target for preventing and treating verticillium wilt of cotton.

The purpose of the invention is realized by the following technical scheme:

in a first aspect, the invention provides an application of VdPHB gene in verticillium dahliae resistance, wherein the amino acid sequence of protein coded by the VdPHB gene is shown in SEQ.ID.NO. 2.

Preferably, the nucleotide sequence of the VdPHB gene is shown in SEQ ID No. 1.

The pathogenic gene VdPHB of verticillium dahliae of cotton is cloned and comes from Verticillium dahliae Kleb, and the nucleotide sequence of the gene is SEQ.ID.NO. 1.

Preferably, the application is specifically as follows: the VdPHB gene is knocked out, changed or inhibited by adopting a conventional method, so that the expression level of the VdPHB gene in verticillium dahliae is reduced.

In a second aspect, the present invention provides a VdPHB gene mutant strain obtained by knocking out VdPHB gene in Verticillium dahliae Kleb.

Preferably, the amino acid sequence of the protein coded by the VdPHB gene is shown as SEQ ID No. 2.

Preferably, the nucleotide sequence of the VdPHB gene is shown in SEQ ID No. 1.

In a third aspect, the invention provides a method for constructing a VdPHB gene mutant strain according to claim 4, which comprises the following steps:

A. a primer for amplifying the upstream and downstream genes of a pathogenic related gene VdPHB gene of verticillium dahliae of cotton;

B. constructing a VdPHB gene knockout vector;

C. the VdPHB gene knockout vector is transferred into a wild strain Vd991 by agrobacterium-mediated transformation to obtain a VdPHB gene deletion mutant strain delta Vdphb.

Preferably, the primer comprises a primer pair with sequences shown as SEQ ID No. 5 and SEQ ID No. 9, and a primer pair with sequences shown as SEQ ID No. 6 and SEQ ID No. 10. The method comprises the following specific steps:

upstream primer 1(SEQ ID No: 5):

GTCGACGGTATCGATAAGCTTACGCACCGGTGAATAGC

upstream primer 2(SEQ ID No: 6):

CGACTAGTGCTGAGGCATTATGTGGAAGAGACTGCGGCA

downstream primer 1(SEQ ID No: 9): GCTGGTTATGAAGAGCCAG

Downstream primer 2(SEQ ID No: 10):

GCCCATCGATGATCAGGTCGTCCGTCTAACGGCCAC

in a fourth aspect, the invention provides an application of a VdPHB gene mutant strain in resisting verticillium dahliae.

The pathogenic gene VdPHB is successfully cloned from a wild type strain Vd 991.

The invention constructs a VdPHB knock-out vector, and transfers the vector into a wild type strain Vd991 by agrobacterium-mediated transformation to obtain a deletion mutant delta Vdplb of the VdPHB gene.

The invention measures the colony morphology, growth rate, ectoenzyme activity and pathogenicity of the knock-out mutant delta Vdphb, and compares and analyzes various indexes of the knock-out mutant delta Vdphb with those of a wild type. The results show that: the growth rate of the knockout mutant delta Vdphb is not changed, and the growth rate on the culture medium with different unique carbon sources (sucrose, cellulose and starch) is also not changed. The pathogenicity determination result shows that the pathogenicity of the knockout mutant delta Vdphb is obviously reduced. Therefore, the VdPHB gene is determined to be a pathogenic gene of verticillium dahliae of cotton.

Compared with the prior art, the invention has the following beneficial effects:

1. according to the invention, the colony morphology, the growth rate, the extracellular enzyme activity and the pathogenicity of the knock-out mutant delta Vdplb are measured and compared with various indexes of a wild type for analysis, so that the VdpbB gene is determined to be a pathogenic gene of verticillium dahliae, and the harm of the verticillium dahliae can be reduced by inhibiting the expression of the VdpbB gene in the verticillium dahliae.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1: a schematic diagram of a VdPHB gene knockout vector is constructed;

FIG. 2: PCR molecular detection of VdPHB mutant strain; wherein P represents a knock-out vector; delta Vdphb1-14 and delta Vdphb1-16 are two constructed mutants;

FIG. 3: measuring the transcription level of the VdPHB mutant strain;

FIG. 4: a schematic diagram of the growth of the VdPHB mutant strain on a PDA culture medium and a statistical result; wherein, FIG. 4A is colony morphology on PDA medium of wild type Vd991 and Δ Vdphb mutants; FIG. 4B is a growth curve of wild type Vd991 and Δ Vdphb mutants on PDA medium;

FIG. 5: colony morphology on different carbon source (sucrose, cellulose, starch) culture media of wild type Vd991 and delta Vdphb mutant;

FIG. 6: growth curves of wild-type Vd991 and Δ Vdphb mutants on different carbon source (sucrose, cellulose, starch) media;

FIG. 7: the result that the wild Vd991 and the delta Vdphb mutant infect the tobacco leaves;

FIG. 8: determining pathogenicity of cotton infected by the delta Vdphb mutant strain;

FIG. 9: observing the stems of the infected cotton plants and counting disease indexes; wherein: FIG. A is a longitudinal and transverse section of a diseased cotton stalk; and B is the index statistics of the disease condition.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be obvious to those skilled in the art that various changes and modifications can be made without departing from the spirit of the invention. All falling within the scope of the present invention.

In the following examples, the wild type Verticillium dahliae Vd991 strain was provided by the Jianguilian researcher of the institute of plant protection, national academy of agricultural sciences, and Agrobacterium AGL-1 was purchased from Digita Virginiana.

Example 1: construction of VdPHB Gene knockout vector

1.1 construction of VdPHB Gene knockout vector

The VdPHB gene knockout vector is constructed by using a one-step cloning kit. The VdPHB gene sequence is compared with verticillium dahliae genome to obtain the VdPHB gene upstream DNA sequence (SEQ ID No:3) and the VdPHB gene downstream DNA sequence (SEQ ID No: 4). Primer5.0 software is used for primer sequence design of gene upstream and downstream fragment amplification. According to

The VdPHB gene knockout vector is constructed according to the following construction principle: by introducing homologous recombination sequences at the 5' end of the primers, there are completely identical sequences (15bp-20bp) that can be homologously recombined with each other between the amplification products and the linearized cloning vector.

Taking the genome DNA of Verticillium dahliae as a template and a primer (Upstream primer: Upstream-F/R; a downstream primer: downstream F/R) amplifies a fragment of about 1kb in the upstream and Downstream sequences of the target gene. The hygromycin resistance gene cassette with the total length of about 2.5kb is amplified by taking pGKO-HPT plasmid as a template and HYG-BOX-F/R as a primer. The recombinant reaction constructed by the vector uses a Clon express multiple one step Cloning Kit, and the linearized vector pGKO-HPT 200.0ng, the VdPHB gene upstream sequence fragment 20.0ng, the VdPHB gene downstream sequence fragment 20.0ng, HTP-BOX 50.0ng and ddH are added according to the instruction₂O to 20. mu.L. And transforming the obtained knock-out vector into escherichia coli screening positive clone and sequencing to obtain a correct knock-out vector pGKO-VdPHB vector.

The primer sequences are shown in Table 1.

TABLE 1 primer sequence Listing employed in the present invention

The resulting knock-out vector is shown in FIG. 1.

Example 2: obtaining of VdPHB gene knockout mutant

2.1 obtaining VdPHB Gene knockout mutant

The knock-out vector pGKO-VdPHB obtained in example 1 was transferred to Agrobacterium AGL-1 using a freeze-thaw method, and the wild type Verticillium dahliae Vd991 strain was transformed with Agrobacterium AGL-1 containing the knock-out vector pGKO-VdPHB. The transformation method comprises the following steps:

culturing wild type Vd991 strain with potato liquid culture medium for 5-7 days, filtering with sterile gauze to obtain spore, and adjusting spore concentration to 1 × 10⁷CFU/mL. The concentration of Agrobacterium AGL-1 containing the knock-out vector pGKO-VdPHB vector was adjusted to OD 0.5-0.7. Agrobacterium and wild type spores were mixed in equal volumes, 200ul of the mixture was pipetted onto a microfiltration membrane which was spread on IM medium (200. mu. mol/L acetosyringone and 200. mu. mol/L ethanesulfonic acid), and cultured in an incubator at 25 ℃ for 48 h. The above microfiltration membrane was transferred to PDA screening medium (50. mu.g/mL hygromycin and 50. mu. mol/LF2dU) and cultured at 25 ℃ until colonies of transformants appeared. Picking single colony with sterile toothpick, adding into 200ul sterile water, and homogenizing spore liquidCoating on PDA screening culture medium, culturing at 25 deg.C until single colony grows out, and subculturing the single colony on the screening culture medium for three generations.

2.2 detection of VdPHB Gene mutants

The obtained colonies are continuously subcultured for 3 times, after the third generation, a punch is used for punching a bacterial cake, the bacterial cake is added into a Chachi liquid culture medium, the culture is carried out for 5-7 days under the conditions of 25 ℃ and 150rpm, and then sterile gauze is used for filtering and collecting thalli to extract genome and RNA. The VdPHB gene is detected by designing a primer Test-PHB1-F/R according to the VdPHB gene sequence, and the hygromycin gene is detected by designing a primer Test-HPh-F/R according to the hygromycin sequence. Meanwhile, the Test-UP-F/Test-down-R is used as a primer for detection, a band with the total length of about 2.8kb can be obtained when the DNA of the deletion mutant is used as a template, and a band with the total length of about 1.4kb can be obtained when the genome of the wild type VD991 is used as a template. When VdPHB and hygromycin genes are detected, a wild VD991 genome and a knockout vector pGKO-VdPHB vector are respectively used as controls.

The results obtained from the agarose gel electrophoresis results were (FIG. 2): (1) when hygromycin fragments are detected, hygromycin genes cannot be detected in the genome of the wild VD991, can be detected in the vector, and can be detected in the deletion mutant; (2) when the VdPHB gene is detected, a band can be detected in wild type VD991, and the band can not be detected in a vector and a mutant; (3) when Test-UP-F/Test-down-R is used as a primer for detection, a band with the length of about 2.8kb can be obtained when a knockout vector and a deletion mutant gene are respectively used as templates, and a band with the length of about 1.4kb can be obtained when a wild-type VD991 genome is used as a template. The combination of the above results indicates that VdPHB gene has been knocked out in the mutant.

A fluorescent quantitative primer RT-VdPHB-F/R for detecting the expression condition of the VdPHB gene is designed according to the VdPHB gene sequence, the expression condition of the VdPHB in a wild type and a mutant is detected by taking a Vdelf gene as an internal reference primer, and the VdPHB gene is normally expressed in the wild type and hardly expressed in the deletion mutant as can be seen from a figure 3. This result again indicates that VdPHB gene has been successfully knocked out in the mutant.

The primers are shown in a sequence table 1.

The electrophoresis results of the obtained knockout mutant are shown in FIG. 2.

Example 3: biological character analysis of VdPHB gene mutant

3.1 colony growth Rate Observation of VdPHB Gene mutant

In order to determine whether the growth speed of verticillium dahliae is affected after the VdPHB gene is deleted, a puncher is adopted to respectively obtain the bacterial cakes of wild VD991 and delta Vdphb mutants with the diameter of 5mm, and the bacterial cakes are transferred into a culture medium of PDA. Colony diameters were measured every three days after 3d inoculation, 3 replicates for each strain. The data obtained are shown in FIG. 4, and there is no difference in growth rate between wild-type VD991 and Δ Vdplb mutants, indicating that the growth of Δ Vdplb mutant strain is not affected after the VdpB gene is deleted.

3.2 determination of the extracellular enzyme Activity

In order to investigate whether the deletion of VdPHB affects the utilization of starch, sucrose and pectin by Verticillium dahliae, a medium containing a unique carbon source such as starch, sucrose and pectin was prepared on the basis of a Chaudhuri medium. 5mm fungus cakes of wild type VD991 and delta Vdphb mutant strains were obtained separately using a punch, inoculated onto media containing only 3 single carbon sources, repeated 3 times, and the colony diameters were measured every 3 days since 3 days of inoculation. The results are statistically shown in FIGS. 5 and 6, which show that there is not much difference in the growth diameters of the wild type and the mutant on the medium containing 3 unique carbon sources, indicating that the utilization rate of sucrose, starch and pectin is not decreased after the VdPHB gene is deleted.

Example 4: pathogenicity determination of VdPHB gene mutant

4.1 measurement of leaf infectivity by delta Vdphb mutant

To determine whether the mutant Δ Vdphb has a changed virulence in tobacco, wild-type and Δ Vdphb mutants were cultured using Chachi's liquid medium for 4-7 days, respectively, and the number of spores of the wild-type and Δ Vdphb mutants was adjusted to 10⁷The spores were injected into tobacco leaves grown for 4 weeks from the back side of the tobacco leaves using a 1ml syringe and marked, and the tobacco leaves were observedPhenotype. From the results in FIG. 7, it can be seen that the lesion spots of the tobacco leaves injected with the mutant were light and small, while the lesion spots of the tobacco leaves injected with the wild type were deep and large. The mutant is found to have less pathogenicity than the wild type by comparing the infection degree of tobacco leaves.

4.2 determination of cotton infectivity by delta Vdphb mutant

To determine whether there is a change in the pathogenicity of the Δ Vdphb mutant to cotton, the wild-type and Δ Vdphb mutants were cultured for 5-7 days using a liquid medium, spores were obtained by filtration with sterile gauze, and the number of spores of the wild-type and Δ Vdphb mutants was adjusted to 10⁷And a piece of true-leaf upland cotton Coker312 is infected by using a root dipping method, and then the physiological phenotype of the cotton plant is observed and analyzed to calculate the pathogenicity. The cotton stalks infected by the wild type and the delta Vdphb mutant are longitudinally and transversely cut respectively, and the infection condition is observed.

After 21 days of inoculation, the cotton plants inoculated with the wild type VD991 and the delta Vdphb mutant both showed symptoms of disease, but the cotton plants inoculated with the wild type VD991 showed severe symptoms of disease, whereas the cotton plants inoculated with the delta Vdphb mutant were slightly infected and some plants did not develop disease. Statistical disease index of cotton plants inoculated with different strains the disease index of the inoculated wild type was about 74, whereas the disease index of the inoculated mutant was about 7. The pathogenicity of the delta Vdppb mutant is obviously weakened. As shown in fig. 8 and 9.

The research shows that VdPHB gene participates in the pathogenic process of verticillium dahliae in the cotton infection process of verticillium dahliae, and the harm of verticillium dahliae on cotton can be reduced by inhibiting the expression of the VdPHB gene.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention. The embodiments and features of the embodiments of the present application may be combined with each other arbitrarily without conflict.

Sequence listing

<110> Shanghai university of transportation

Application of VdPHB gene in resisting verticillium dahliae of cotton

<130>DAG34351

<160>20

<170>SIPOSequenceListing 1.0

<210>1

<211>1004

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atggccgccg ctctcaactt catctccaag gcggcagtgc cggccttctt cggtgccagt 60

ctcctctcaa ccgccatcta cgatgtccgt ggcggttcca gggcagtcat cttcgacaga 120

gtgcagggtg tgaaggatga ggtcatcaac gagggcaccc acttcctcat cccctggctg 180

cagaagagca tcgttttcga cgtgcgcacc aagcccagga gcatcgccac catgacgggc 240

agcaaggact tgcagatggt cagcctgacg ttgagggtgc tgcacaggcc agaagtcaag 300

gcgttgccca agatctacca agtatgtgcc cttttagtcc cggctcgttc ttccagaaaa 360

attatagttc taatcgcctg tttgcgtttc tccagaatct cggcgccgat tatgatgagc 420

gcgtcctccc ctccatcggc aacgaagtcc tcaagtccat cgtcgcccag tttgacgccg 480

ccgagctcat cacccagcgt gaggccgtct ctcagcgcat ccgctccgac ctcacccgcc 540

gcgccgccga gttcaacatt gctctcgaag acgtgtccat cacccacatg accttcggca 600

aggagttcac caaggccgtc gagcagaagc agattgccca gcaggatgcc gagcgtgcgc 660

gcttcatcgt cgagaaggcc gagcaggagc gccaggccaa cgtcatccgt gccgagggcg 720

aggccgagag tgccgacgcc atcgccaagg ccatttccaa gtctggcgac ggcctcatcc 780

agatccgtaa gattgaggcg agcagggaga tcgcgtccac actgtcttcc aaccccaacg 840

ttgtgtacct gcccggtggt ggcaagtctg gcggcagcca gatgcttctg aacgttggcc 900

ggtaatcagc ttggtggatg atatttgtaa cagtattaag gccaaaaggt ggccgcggct 960

ggacgccact taaatgagtg taattctacg tatatcccct ttcc 1004

<210>2

<211>276

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Ala Ala Ala Leu Asn Phe Ile Ser Lys Ala Ala Val Pro Ala Phe

1 5 10 15

Phe Gly Ala Ser Leu Leu Ser Thr Ala Ile Tyr Asp Val Arg Gly Gly

20 25 30

Ser Arg Ala Val Ile Phe Asp Arg Val Gln Gly Val Lys Asp Glu Val

35 40 45

Ile Asn Glu Gly Thr His Phe Leu Ile Pro Trp Leu Gln Lys Ser Ile

50 55 60

Val Phe Asp Val Arg Thr Lys Pro Arg Ser Ile Ala Thr Met Thr Gly

65 70 75 80

Ser Lys Asp Leu Gln Met Val Ser Leu Thr Leu Arg Val Leu His Arg

85 90 95

Pro Glu Val Lys Ala Leu Pro Lys Ile Tyr Gln Asn Leu Gly Ala Asp

100 105 110

Tyr Asp Glu Arg Val Leu Pro Ser Ile Gly Asn Glu Val Leu Lys Ser

115 120 125

Ile Val Ala Gln Phe Asp Ala Ala Glu Leu Ile Thr Gln Arg Glu Ala

130 135 140

Val Ser Gln Arg Ile Arg Ser Asp Leu Thr Arg Arg Ala Ala Glu Phe

145 150 155 160

Asn Ile Ala Leu Glu Asp Val Ser Ile Thr His Met Thr Phe Gly Lys

165 170 175

Glu Phe Thr Lys Ala Val Glu Gln Lys Gln Ile Ala Gln Gln Asp Ala

180 185 190

Glu Arg Ala Arg Phe Ile Val Glu Lys Ala Glu Gln Glu Arg Gln Ala

195 200 205

Asn Val Ile Arg Ala Glu Gly Glu Ala Glu Ser Ala Asp Ala Ile Ala

210 215 220

Lys Ala Ile Ser Lys Ser Gly Asp Gly Leu Ile Gln Ile Arg Lys Ile

225 230 235 240

Glu Ala Ser Arg Glu Ile Ala Ser Thr Leu Ser Ser Asn Pro Asn Val

245 250 255

Val Tyr Leu Pro Gly Gly Gly Lys Ser Gly Gly Ser Gln Met Leu Leu

260265 270

Asn Val Gly Arg

275

<210>3

<211>1000

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

acgcaccggt gaatagccca gtccatggcg tagtaggcga caaccagagg agggacgacg 60

tagaggacgg agccgcggaa gcggcggaag gtgttgaaca cggcatcgtg gccggcgccg 120

gcaaagggat tctggcggtt ggcagagaca ccgaatgtga tgatgccacg ctgcttctcg 180

ccacctgttt gtttgtttgt tagaaaggtg ttcatctcaa gtatttccac tcaacccctg 240

gctcgttgcg tgtggacctg ggcggcaagc tctctccgtc gccatcgaag tccgctgtcc 300

cgtgtgtttc tgacgagctt cgaatccatt gtccatcgta tgacgttgtg tcgttgtgtc 360

gttgcgtcgg ggaaagaaag gcggtactaa ccaatgttgc cccagtcacc gaggtagctg 420

cgaggtcagt tagcattgga actcgagaga acaattggca aacaaaagac ccgggcaatc 480

gtcggtcacg actgttcgcc ctggacgaaa agccgcaccg cgcccgggcc aattgcgccc 540

agcgcaaatc gtcttactgg ttgaatttgc ccttggggac gccgccgccg ccgagcagga 600

tctgggaagg tctcatgttg tcgaatcggg ggagtgacgc acgaggtctg tgtcggggat 660

tgaaggtgct tggagggtcg aagaggatca ttcgggtgag gttcgaaatc ctgtcgaggt 720

tcttgccgaa gtgcacccga aatggtttag cgcccccttt gctacaatag ccccggtttg 780

tgtcacctcc gggcgagaat ttccatgacg ggtcggcgca gaagcacctt cgtaagctcc 840

acctcaggtt cgaacgtgcg tgcaactgga gcttttgagc agtgcagctt ccaaccttct 900

gacaacggat caccagctcc ttcttctgtc gtaatcgcac cgaccccgcc gactacagtc 960

tcgctctgcc catcgcgccg gtgccgcagt ctcttccaca 1000

<210>4

<211>1000

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

aatatgtgct ggttatgaag agccagtcag ggttctctct tcccactaac agcctgttgg 60

ctgttcctgc tcagcgcatg aaacccaact accaagaacg aaaggcgctg gtccaagatg 120

tcatatgaca cattacgcat gtcactccta ttatagagag gatgggatcg atgtgcgaat 180

cgtcagttgt ttattgccca gatgtggcat gaactaccga gtagctcgcg cgtaccgcga 240

tcatgtcaaa gtggctagcc aggacggcca gcatcgctac taccgaagtg atcctcggga 300

gatgacgcgg gcggcattga ctctgaaatc aatgtgcagc ctctaggaac tccacagtca 360

acttggtgtc gtcaattcca ccgttggtgc cactgctcga agcgtctttc ggtggaacca 420

tgtcgcctgt agtcttctcc aaagtccagc ctttgaatcg catgttctgc cactcttcca 480

tgaccttaag cagagccagt tctccggcag cccgagcatc ctccgccgag tcgtgtccct 540

ggatcttgcc tcctgtctcc atctggattt tgcggttcag cagcgtttcc atgagcattt 600

tgaggccatg tcgataaggt aggccgtgct tgtgagggtt cagtaggaca gtatcgacga 660

gtgtcgggtg gataatgcgg acagagttta gatcgttttc caagccatgt ccgatgaggg 720

gtgtattagg ggcgagtaga gagaagagaa ggtcgcgtgc ggcgtgtggt gatggaacga 780

ttctcagcgc agccttttga tgaccgtccg aatttttggt gttggtgcta atagcgacgg 840

ggggtatctc tatgctggtc caaggctgag ctcgcgacat atcctcgggc cagacgcccg 900

agaatcgcga gttgaggtcg aggatttcgc ccagcggttg cacaagtaca tccaacatga 960

tgtcgccgct gggccaggca gtggccgtta gacggacgag 1000

<210>5

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gtcgacggta tcgataagct tacgcaccgg tgaatagc 38

<210>6

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cgactagtgc tgaggcatta tgtggaagag actgcggca 39

<210>7

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttaatgcctc agcactagtc g 21

<210>8

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ctggctcttc ataaccagcc ctcgacagaa gatgatattg aagg 44

<210>9

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gctggttatg aagagccag 19

<210>10

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gcccatcgat gatcaggtcg tccgtctaac ggccac 36

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gttccagggc agtcatcttc 20

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

tgccgccaga cttgccacca 20

<210>13

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cttctgcggg cgatttgt 18

<210>14

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gtggatatgt cctgcgggta a 21

<210>15

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tcctgtcgag gttcttgc 18

<210>16

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ttcttggtag ttgggtttca t 21

<210>17

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gccttcttcg gtgccagtc 19

<210>18

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gtgggtgccc tcgttgat 18

<210>19

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

ccattgatat cgcactgtgg 20

<210>20

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

tggagatacc agcctcgaac 20

Claims (2)

1. A kind ofVdPHBA genetic mutant strain characterized in that it is obtained by knocking out a gene in Verticillium dahliaeVdPHBObtaining a gene;

saidVdPHBThe construction method of the gene mutant strain comprises the following steps:

A. amplification of pathogenic related genes of verticillium dahliaeVdPHBPrimers for genes upstream and downstream of the gene;

B. construction ofVdPHBA gene knockout vector;

C. using Agrobacterium-mediated transformationVdPHBGene knockout vector transferred wild strainVd991In (1) obtainingVdPHBGene deletion mutant strainsΔVdphb；

The above-mentionedVdPHBThe amino acid sequence of the gene coded protein is shown in SEQ.ID.NO. 2;

the above-mentionedVdPHBThe nucleotide sequence of the gene is shown in SEQ.ID.NO. 1;

the primer comprises a primer pair with sequences shown as SEQ ID No. 5 and SEQ ID No. 9, and a primer pair with sequences shown as SEQ ID No. 6 and SEQ ID No. 10.

2. A process as claimed in claim 1VdPHBThe gene mutant strain is applied to resisting verticillium dahliae of cotton.

Images