CN106754999A

CN106754999A - A kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment and its application

Info

Publication number: CN106754999A
Application number: CN201710025912.8A
Authority: CN
Inventors: 高俊山; 许磊; 陈文�; 孟艳; 蔡永萍; 林毅
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2017-01-13
Filing date: 2017-01-13
Publication date: 2017-05-31

Abstract

The invention discloses a kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment and its application, the gene has the nucleotide sequence as shown in SEQ ID NO.1 and the amino acid sequence as shown in SEQ ID NO.2.The present invention is by the analysis to the gene coded sequence and genetic transformation arabidopsis, it was found that the gene can control the formation of fiber pigment, improve plant color and luster, reference frame is provided to carry out genetic improvement to brown cotton color proterties using technique for gene engineering, for the brown cotton new varieties for cultivating fiber pigment stabilization provide new approach.

Description

A kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment and its application

Technical field

The present invention relates to the technical field of molecular biology of plants, more particularly to a kind of brown cotton GhTT19 bases Cause and its application.

Background technology

Cotton is Malvaceae cotton, and it is both important fiber crop, is again important oil crops, or is spun Knit, fine chemical material and important strategic materials.Brown cotton is the color cotton that a kind of fiber is presented natural brown, due to it Body carries natural color, in cotton textiles production process, can remove the processes such as bleaching, sterilization, dyeing from, pollutes less, ring Health care health.As environmental protection concept is rooted in the hearts of the people, brown cotton has catered to the demand in market, with wide market prospects.

But, brown cotton is compared with white cotton, and its quality is not ideal enough, exist fiber color it is single, colour uneven, color Fastness and the low problem of color saturation, seriously constrain the production and application of brown cotton.Therefore, it is necessary to parse Cotton Fiber of Natural Brown Cotton color The molecule mechanism of element synthesis, for the brown cotton new varieties for cultivating fiber pigment stabilization lay the foundation, while cotton grower's income can be increased With meet many needs of the national economic development.Forefathers have cloned the structure in proanthocyanidin conjunction approach from Cotton Fiber of Natural Brown Cotton Gene (F3H, DFR, CHI etc.), it is preliminary to infer Cotton Fiber of Natural Brown Cotton color with reference to the qualification result of Cotton Fiber of Natural Brown Cotton pigment chemical property The synthesis precursor of element is condensed tannin, i.e. proanthocyanidin (proanthocyanidins, PA).

TRANSPARENT TESTA19 are a kind of participation OPC, the floating preteins of anthocyanidin transhipment, belong to GST Family.Arabidopsis TT19 genes (AtTT19) encode a kind of flavonoids metabolic pathway necessary to GST families Phi classes transhipment egg In vain, its biological function is that the monomer of the Polyphenols pigments such as the anthocyanidin, the OPC that will synthesize in endochylema is transported to vacuole In Deng subcellular fraction organ, then anthocyanidin develop the color in acid condition or OPC further polymerization after form coloured pigments.

The content of the invention

It is an object of the invention to overcome the deficiencies in the prior art, there is provided a kind of Cotton Fiber of Natural Brown Cotton OPC transports phase The GST GFPs of pass and its application, to provide a kind of new cotton gene related to pigment transhipment, to cultivate fiber pigment The brown cotton new varieties of stabilization lay the foundation.

The present invention is achieved by the following technical solutions：

The invention provides a kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment, the gene has Nucleotide sequence as shown in SEQ ID NO.1, is named as GhTT19, the amino acid sequence such as SEQ ID NO.2 of the albumen It is shown.

Brown cotton is being cultivated present invention also offers the related GST GFPs of above-mentioned Cotton Fiber of Natural Brown Cotton OPC transhipment Application in new varieties.

Present invention also offers a kind of plant expression vector, the plant expression vector contains the former flower of above-mentioned Cotton Fiber of Natural Brown Cotton The related GST GFPs of blue or green element transhipment.

Further, the plant expression vector is the pCambia1301a carriers containing said gene.

Present invention also offers a kind of genetically engineered host cell, the host cell contains above-mentioned plant expression and carries The related GST GFPs of the Cotton Fiber of Natural Brown Cotton OPC transhipment of external source are integrated with body, or its genome.

Further, the host cell be containing above-mentioned plant expression vector or be integrated with the gene Agrobacterium it is thin Born of the same parents.

Present invention also offers a kind of method of prepare transgenosis plant, the plant is arabidopsis, and methods described includes Following steps：

(1) prepare and infect liquid：Resuspended with buffer solution after the host cell is activated, liquid, the buffer solution are infected in acquisition It is the liquid that infects containing the sucrose and the 1/2MS fluid nutrient mediums of 0.02% Silwet L-77 that mass ratio is 5% OD₆₀₀Be worth is 0.8；

(2) Fruit pod of the arabidopsis seedling of pre-inversion and the flower for having opened all are cut, only stays bud, by whole buds Inversion is immersed in the 45s in liquid that infects of step (1), then is placed in culture one day at dark, and continuation is trained in being subsequently placed in illumination box Support, and it is 16h/ days to control light application time；

(3) every 1 week repeat step (2) once, until seed maturity, obtain T0 for seed；

(4) by T0 for inoculation refers to the MS solid screening and culturing mediums containing 50mg/L hygromycin after seed disinfection in, be placed in light Cultivated according in incubator, and control light application time for 16h/ days, after growing 4-6 piece lotus thrones to seedling, move into continuation in Nutrition Soil T1 is cultivated and harvested for seed, the seed only containing the plant expression vector can be solid in the MS containing 50mg/L hygromycin Grown in body screening and culturing medium, thus can filter out positive plant；

(5) repeat step (4) obtains transfer-gen plant and its offspring of stabilization heredity.

The present invention has advantages below compared to existing technology：The invention provides a kind of transhipment of Cotton Fiber of Natural Brown Cotton OPC Related GST GFPs and its application, by the analysis to the gene coded sequence and genetic transformation arabidopsis, as a result table Bright, the gene can control the formation of fiber pigment, improve plant color and luster, be to brown cotton chromaticity using technique for gene engineering Shape carries out genetic improvement there is provided reference frame, for the brown cotton new varieties for cultivating fiber pigment stabilization provide new approach.

Brief description of the drawings

Fig. 1 is pCambia1301a-GhTT19 vector construction collection of illustrative plates；

Fig. 2 is arabidopsis positive seedling PCR the result figures；

Fig. 3 is to turn GhTT19 gene arabidopsis T₂For plant tissue's chemical staining result figure；

Fig. 4 is GhTT19 relative expression quantity block diagrams during arabidopsis is respectively organized, wherein：r：Transgenic arabidopsis root；s：Turn Gene arabidopsis stem；l：Transgenic arabidopsis leaf；t:Transgenic arabidopsis kind skin；w：Wildtype Arabidopsis thaliana kind skin；

Fig. 5 is that arabidopsis kind skin procyanidin content detects block diagram.

Specific embodiment

Embodiment 1

1st, material

Method therefor is conventional method unless otherwise instructed in following embodiments, and the primer is biological by Shanghai life work Engineering services Co., Ltd synthesizes, and sequencing is carried out by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, PMD-18T, Restriction enzyme BamHI and XbaI, T₄Ligase.RNAprep Pure Plant Kit, FastQuant RT Kit are purchased From TIANGEN companies.DNA glue reclaims kit, plasmid extraction kit purchase, X-Gluc are purchased from Shanghai life work bioengineering skill Art Services Co., Ltd, book is carried out method as directed.

2nd, method

The clone of 2.1GhTT19 and the structure of carrier for expression of eukaryon

2.1.1GhTT19 gene cloning

Brown cotton blade total serum IgE, and reverse transcription are extracted into cDNA, design specificity amplification primer GhTT19-F and GhTT19-R, performing PCR amplification is entered by template of cDNA, and the recovery of PCR primer connects PMD-18T carriers.

The specificity amplification primer GhTT19-F and GhTT19-R is：

SEQ ID NO.3：GhTT19-F：ATGGTAGTGAAAGTGTATGG

SEQ ID NO.4：GhTT19-R：TCAATAATTAGCGAGCTTCA

Specific reactions steps include：Take the total serum IgE of 1 μ g (2 μ L), add 2 μ 5 × gDNA of L Buffer, 2 μ L 10 × Fast RT Buffer, 1 μ L RT Enzyme Mix, 2 μ L FQ-RT Primer Mix, 11 μ L RNase-Free ddH2O, It is careful to mix, 42 DEG C of incubation 15min, then 95 DEG C of incubation 3min, place 5min on ice, that is, obtain corresponding reverse transcription product cDNA.CDNA with reverse transcription synthesis enters performing PCR and expands as template, using primer GhTT19F and GhTT19R.Response procedures are： 94℃5min；94 DEG C of 45s, 54 DEG C of 45s, 72 DEG C of 1min, 35 circulations；72℃10min.PCR primer is through 1% Ago-Gel electricity After swimming detection, purpose fragment is reclaimed, and be connected on carrier PMD-18T, be then transformed into bacillus coli DH 5 alpha impression State cell, entrusts Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to be sequenced after positive clone identification.

Compared using DNAMAN softwares after the completion of sequencing, it is ensured that obtain sequence for purpose sequence.Result shows, is obtained Gene size is 645bp, amino acid sequence such as SEQ ID NO.1, the SEQ ID of the protein of its nucleotide sequence and its coding Shown in NO.2.

2.1.2 the structure of plant expression vector

Primer GhTT19- of the sequences Design with BamHI and XbaI enzyme cutting site according to genes of interest GhTT19 BamHI-F and GhTT19-XbaI-R, is the ORF of template amplification GhTT19 genes with cDNA, and PCR primer is through 1% Ago-Gel After electrophoresis detection, purpose fragment is reclaimed, and be connected on carrier PMD-18T, obtain PMD-18T-GhTT19 plasmids.

The primer GhTT19-BamHI-F and GhTT19-XbaI-R with BamHI and XbaI enzyme cutting site are：

SEQ ID NO.5：GhTT19-BamHI-F：ATGGTAGTGAAAGTGTATGG

SEQ ID NO.6：GhTT19-XbaI-R：TCAATAATTAGCGAGCTTCA

As shown in figure 1, with restriction enzyme BamHI and Xba I respectively to PMD-18T-GhTT19 plasmids and plant table Double digestion is carried out up to carrier pCambia1301a plasmids.Digestion products reclaim purpose fragment with 1% agarose gel electrophoresis GhTT19 and plant expression vector pCambia1301a.The purpose fragment after 2 digestions is connected and is transformed into T4 ligases Bacillus coli DH 5 alpha competent cell, recombinant plasmid is carried out after digestion verification and carries out sequence verification, obtains plant expression vector pCambia1301a-GhTT19。

2.1.3 the structure of host cell

The plant expression vector pCambia1301a-GhTT19 that will be built is transformed into Agrobacterium LBA4404 sense by electricity In by state cell, positive strain is filtered out by kanamycins and streptomysin, obtain host cell.

Meanwhile, the empty carrier pCambia1301a of not connected GhTT19 genes is transformed into agriculture bar by above-mentioned same method In bacterium LBA4404 competent cells, positive strain is filtered out by kanamycins and streptomysin, obtain compared with control cells.

The genetic transformation of 2.2 arabidopsis, screening and identify

2.2.1 prepare and infect liquid：Resuspended with buffer solution after the host cell is activated, liquid, the buffering are infected in acquisition Liquid is the liquid that infects containing the sucrose and the 1/2MS fluid nutrient mediums of 0.02% Silwet L-77 that mass ratio is 5% OD₆₀₀Be worth is 0.8.

2.2.2 the Fruit pod of the arabidopsis seedling of pre-inversion and the flower for having opened all are cut, only stays bud, by whole flowers Flower bud is inverted the 45s in liquid that infects for being immersed in step 2.2.1, then is placed in culture one day at dark, is subsequently placed in illumination box relaying Continuous culture, and it is 16h/ days to control light application time.

2.2.3 every 1 week repeat step 2.2.2 once, until seed maturity, obtains T₀For seed, totally 1200.

2.2.4 by 1200 T₀For being seeded to the MS solid screening and culturing mediums containing 50mg/L hygromycin after seed disinfection In, each culture medium inoculated 200 is placed in illumination box and cultivates, and controls light application time for 16h/ days, as a result such as following table Shown in 1, most of plant yellow simultaneously stops growing, and only 6 plants grow true leaf, are positive transgenic plant, and conversion ratio is 0.50%.

The screening of the arabidopsis resistant plant of table 1

After 6 plants of seedling grow 2-3 piece true leaves, take wherein one plant and enter performing PCR detection, specially：Small part blade is taken, profit The DNA of blade is extracted with EasyPure Plant Genomic DNA Kit, when PCR is identified, using the primer SEQ of genes of interest ID NO.3, SEQ ID NO.4 are detected.Reaction system is 2 μ L, Easytaq buffer of DNA 2.5 μ L, dNTPs2.0 μ L, each μ L of 1.5 μ L, Easytaq 0.25 of upstream and downstream primer, water polishing to 25 μ L.Reaction condition is 94 DEG C of 5min, 94 DEG C of 30s, 55 DEG C 30s, 72 DEG C of 45s, 30 circulations, 72 DEG C of 10min.

Result in positive transgenic arabidopsis as shown in Fig. 2 in figure, amplify the product of expected size 645bp.

After this 6 plants of positive strains grow 4-6 piece lotus thrones, continue to cultivate and harvest T in immigration Nutrition Soil₁For seed.

2.2.5 by T₁Secondary screening is carried out for seed repeat step 2.2.4, the arabidopsis positive strain of inheritance stability is obtained.

The GUS dyeing of 2.3 transgenic Arabidopsis plants

Take arabidopsis positive strain T₂For the seedling of plant, GUS dyeing is carried out to it according to GUS staining kits, observed The tissue expression situation of GhTT19, step is as follows：

(1) pre-process：Arabidopsis is put in 1.5mL centrifuge tubes, adds 90% acetone of precooling that material is completely covered, often Temperature treatment 20-30min.

(2) dye：To be placed in 1.5mL centrifuge tubes after material rinsed clean with distilled water, add the appropriate GUS for having configured Dyeing working solution is wrapped 37 DEG C and is overnight placed to material, masking foil is completely covered.

(3) elute：Eluted with 95% ethanol, shaking table jog.

(4) observe：Naked eyes or basis of microscopic observation, the blue portion in white background are GUS expression sites.

Result finds：All there is not blueness at each position in the arabidopsis cell of conversion empty carrier pCambia1301a, and All there is blueness in the root of the Arabidopsis thaliana Seedlings of conversion pCambia1301a-GhTT19, stem, leaf, show that GhTT19 intends in transgenosis All express at each position of southern mustard.Arabidopsis positive strain T₂For plant GUS coloration results as shown in figure 3, be can be seen that in figure：Intending south All there is blueness in the positions such as the root of mustard, stem and leaf, show that GhTT19 is expressed at each position of transgenic arabidopsis.

2.4 turns of Phenotypic Observations of GhTT19 gene arabidopsis, qRT-PCR analyses and procyanidin content detections

2.4.1 Phenotypic Observation

Take respectively and turn GhTT19 gene arabidopsis positive strains and wildtype Arabidopsis thaliana seed is some, using DMACA decoration methods Dyeing treatment is carried out, is as a result found, turn GhTT19 gene arabidopsis positive strains plants kind skin of the leather dyeing compared with wildtype Arabidopsis thaliana Dyeing is deep, illustrates to turn the procyanidin content during GhTT19 can suitably increase arabidopsis kind skin.

2.4.2qRT-PCR analyze

Respectively from turning GhTT19 gene arabidopsis T₂Plant skin and its plant tissue's organ, the kind skin of wildtype Arabidopsis thaliana Extract RNA and carry out qRT-PCR analyses, as a result as shown in Figure 4.Result shows in transgenic arabidopsis that GhTT19 is in kind of skin Expression quantity is higher, and the expression quantity of GhTT19 is higher than wildtype Arabidopsis thaliana in transgenic arabidopsis kind skin.

2.4.3 the detection of skin procyanidin content is planted

Take and turn GhTT19 gene arabidopsis T₂The kind skin of seed and wildtype Arabidopsis thaliana seed, carries according to Ikegami et al. Method (Ikegami A, Akagi T, Potter D, the et al.Molecular identification of 1-Cys of confession peroxiredoxin and anthocyanidin/flavonol 3-O-galactosyltransferase from proanthocyanidin-rich young fruits of persimmon(Diospyros kaki Thunb.)[J] .Planta,2009,230(4):Arabidopsis kind skin OPC (PA) 841-855.) is extracted, PAs extract solutions is obtained, using just Butanol-hydrochloric acid method, takes 400 μ L PAs extract solutions, adds 1.5mL n-butanols (containing 5% hydrochloric acid), boiling water bath 20min, in 550nm Place's mensuration absorbance, reference standard curve, acquisition turns GhTT19 gene arabidopsis T₂The kind of seed and wildtype Arabidopsis thaliana seed PA contents in skin.Result is as shown in figure 4, as can be seen that the total PA contents turned in GhTT19 gene arabidopsis kind skins are wild in figure 1.32 times of raw type.These results illustrate that GhTT19 is played a role in the transhipment of OPC or accumulation.

It is above a kind of detailed implementation method of the invention and specific operating process, is with technical solution of the present invention as preceding Put and implemented, but protection scope of the present invention is not limited to the above embodiments.

SEQUENCE LISTING

<110>Agricultural University Of Anhui

<120>A kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment and its application

<130> /

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 645

<212> DNA

<213>Brown cotton

<400> 1

atggtagtga aagtgtatgg tccaatcaag gcagcttgcc ctcaaagggt attggcatgc 60

cttcttgaga aagaggttga atttcagatc gtcgacgtcg atctcgaagc cggcgatcat 120

aaaaaacccg atttcctcct ccgtcaaccg tttggacaag tcccagctat agaggatggc 180

gacttcaaac tttttgagtc tagggcaatc ataaggtact atgcagccaa atatgaaaag 240

caaggtacaa acctacttgg aaactcattg gaagaacgag caatggtgga tcaatggcta 300

gaagtagaag cccacaactt caacgatttg gcctacactt tggtgtttca actgttgatc 360

ctcccacgaa tgggcaagca gggtgatacg gccttagtgc tcagctgcca acaaaagctg 420

gaaaaagtgt tggacatcta cgagcaacgc ttgtccacca ccgcctatct tgctggagat 480

tcattcacct tggccgacct tagccatcta cccgctcttc gatacttggt cgacgatgtt 540

gggatgtggc acatggtgtc tcaacggaag catgtaaatg catggcggga gaccatttct 600

aaccgagctg cttggaagaa actcatgaag ctcgctaatt attga 645

<210> 2

<211> 214

<212> PRT

<213>Brown cotton

<400> 2

Met Val Val Lys Val Tyr Gly Pro Ile Lys Ala Ala Cys Pro Gln Arg

1 5 10 15

Val Leu Ala Cys Leu Leu Glu Lys Glu Val Glu Phe Gln Ile Val Asp

20 25 30

Val Asp Leu Glu Ala Gly Asp His Lys Lys Pro Asp Phe Leu Leu Arg

35 40 45

Gln Pro Phe Gly Gln Val Pro Ala Ile Glu Asp Gly Asp Phe Lys Leu

50 55 60

Phe Glu Ser Arg Ala Ile Ile Arg Tyr Tyr Ala Ala Lys Tyr Glu Lys

65 70 75 80

Gln Gly Thr Asn Leu Leu Gly Asn Ser Leu Glu Glu Arg Ala Met Val

85 90 95

Asp Gln Trp Leu Glu Val Glu Ala His Asn Phe Asn Asp Leu Ala Tyr

100 105 110

Thr Leu Val Phe Gln Leu Leu Ile Leu Pro Arg Met Gly Lys Gln Gly

115 120 125

Asp Thr Ala Leu Val Leu Ser Cys Gln Gln Lys Leu Glu Lys Val Leu

130 135 140

Asp Ile Tyr Glu Gln Arg Leu Ser Thr Thr Ala Tyr Leu Ala Gly Asp

145 150 155 160

Ser Phe Thr Leu Ala Asp Leu Ser His Leu Pro Ala Leu Arg Tyr Leu

165 170 175

Val Asp Asp Val Gly Met Trp His Met Val Ser Gln Arg Lys His Val

180 185 190

Asn Ala Trp Arg Glu Thr Ile Ser Asn Arg Ala Ala Trp Lys Lys Leu

195 200 205

Met Lys Leu Ala Asn Tyr

210

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

atggtagtga aagtgtatgg 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

tcaataatta gcgagcttca 20

<210> 5

<211> 35

<212> DNA

<213>Artificial sequence

<400> 5

cgggatccat ggtagtgaaa gtgtatggtc caatc 35

<210> 6

<211> 35

<212> DNA

<213>Artificial sequence

<400> 6

gctctagaat aattagcgag cttcatgagt ttctt 35

Claims

1. a kind of Cotton Fiber of Natural Brown Cotton OPC transports related GST GFPs, it is characterised in that the gene has such as Nucleotide sequence shown in SEQ ID NO.1.

2. a kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment as claimed in claim 1 are cultivating brown Application in cotton variety.

3. a kind of Cotton Fiber of Natural Brown Cotton OPC transports related GST albumen, it is characterised in that the albumen has such as SEQ ID Amino acid sequence shown in NO.2.

4. a kind of plant expression vector, it is characterised in that the plant expression vector contains brown cotton as claimed in claim 1 The related GST GFPs of fiber OPC transhipment.

5. plant expression vector according to claim 4, it is characterised in that the plant expression vector is to contain above-mentioned base The pCambia1301a carriers of cause.

6. a kind of genetically engineered host cell, it is characterised in that the host cell contains as described in claim 4,5 The Cotton Fiber of Natural Brown Cotton OPC as claimed in claim 1 transhipment of external source is integrated with plant expression vector, or its genome Related GST GFPs.

7. host cell according to claim 5, it is characterised in that the host cell is to contain such as claim 4,5 Described plant expression vector or the agrobatcerium cell of the gene as claimed in claim 1 for being integrated with external source.

8. a kind of method of prepare transgenosis plant, the plant is arabidopsis, it is characterised in that methods described includes following step Suddenly：

(1) prepare and infect liquid：It is resuspended with buffer solution after by the host cell activation as described in claim 6,7, infected Liquid, the buffer solution is to contain the sucrose and the 1/2MS fluid nutrient mediums of 0.02% Silwet L-77 that mass ratio is 5%, institute State the OD for infecting liquid₆₀₀Be worth is 0.8；

(2) Fruit pod of the arabidopsis seedling of pre-inversion and the flower for having opened all are cut, only stays bud, whole buds are inverted The 45s in liquid that infects of step (1) is immersed in, then is placed in culture one day at dark, continuation is cultivated in being subsequently placed in illumination box, and It is 16h/ days to control light application time；

(4) by T0 for inoculation refers to the MS solid screening and culturing mediums containing 50mg/L hygromycin after seed disinfection in, be placed in illumination training Culture in case is supported, and controls light application time for 16h/ days, after growing 4-6 piece lotus thrones to seedling, continuation is cultivated in moving into Nutrition Soil And T1 is harvested for seed；