CN109234304A

CN109234304A - A kind of breeding method of color cotton

Info

Publication number: CN109234304A
Application number: CN201810778979.3A
Authority: CN
Inventors: 孙玉强; 柯丽萍
Original assignee: Individual
Current assignee: Individual
Priority date: 2018-07-16
Filing date: 2018-07-16
Publication date: 2019-01-18
Anticipated expiration: 2038-07-16
Also published as: CN109234304B

Abstract

The invention discloses a kind of breeding method of color cotton, the method is one of following: (1) being that parent hybridizes with different cultivars cotton with cotton purple mutant HS2, obtain color cotton；(2) it knocks out, edit, the key gene in interference or overexpression cotton anthocyanidin biosynthetic metabolism access, obtaining color cotton；The key gene includes PAL, C4H, 4CL-8, CHS, CHI, F3H, F3 ' H, F3 ' 5 ' H, DFR, LAR, LDOX, ANR, OMT or GST.

Description

A kind of breeding method of color cotton

(1) technical field

The present invention relates to a kind of genetic modification technique of key gene using anthocyanidin metabolic pathway and combine conventional miscellaneous Breeding technique is handed over to cultivate the breeding method of color cotton.

(2) background technique

Cotton is that one of most important industrial crops, China are maximum textile production and consumption in the world in the world State.In order to meet the needs of people are bright and colourful to furnishings, cotton textiles have to pass through chemical printing and dyeing before finished product is made. But in process, a variety of chemical substances have been used, may have been caused damages to human health；Simultaneously as dyeing and printing process The requirement of technique, dyeing cloth needs to consume a large amount of water in process, while discharging water pollutant.It prints and dyes by China in recent years Industry dyeing cloth output calculates, and dyeing year discharges about 20 billion cubic meter of dyeing waste water, accounts for the 35% of entire industrial wastewater, Wherein dyeing waste water discharge capacity accounts for the 80% of textile waste discharge amount again, and dyeing waste water also has decoloration difficulty, contains The features such as organic concentration is high.Since new process, new raw material, reactive monoazo dyestuffs, new auxiliary being continually developed and apply, in production process The Wastewater Pollutant of discharge becomes to become increasingly complex, the difficulty of processing be also increasing (Zhang Bin, 2011；Hou Wenjun, 2004).

With the development and progress of society, people increasingly pursue the health of product, environmental protection, pollution-free.International organic agriculture The prediction of the industry committee, in following 30 years, the yield of the organic cotton in the whole world will account for the 30% of cotton total output, about 400 Ten thousand tons.But the production of organic cotton only solves the pollution-free of Raw cotton production, can't avoid textile chemistry printing and dyeing bring Harm of the chemicals to health of people.So reinforce a variety of color colored fibers research and plantation it is extremely important, color cotton is one The natural colorful cotton of kind of fiber, it all follows strictly green production standard from planting, be woven into finished product whole process, no But it adapts to the mankind to return naturally, pursuing the fashion of natural environmental-protective, and be the special type that a kind of health is harmless, ecological benefits are high Cotton.People are called " favorite of 21 century " because of the green of Natural Colored Cotton Textile, ecology, environmental protection characteristic.Colored fiber It is formed and is mainly accumulated by different anthocyanidin and its derivative and different colors are presented.Anthocyanidin is plant very important time Grade metabolite, is one of the primary pigments that plant generates colourful, bright and colourful blade, petal and fruit color, tool There is very important physiological function.

Anthocyanidin is even more the very important secondary metabolite of plant, is that plant generates colourful, bright and colourful leaf One of piece, petal and primary pigments of fruit color have very important physiological function.Color cotton more with it is unique natural, Environmentally friendly and colourful fiber and by pro-gaze, formed and mainly accumulated by anthocyanidin and its derivative in fiber core. Color cotton be in a kind of fibrocyte containing colors specific type cotton (Wang Xuede, 2002；Zhang Mei, 2005), by It can not need to print and dye in its process, avoid harmful components in chemical dye and broken to the harm of human body and to environment It is bad.The Ecological station technique of color cotton fabric fabric, can be such that the protein being beneficial to health in colorful cotton fibre, vitamin obtains To retain.Newest experiment shows that color cotton fiber is weakly acidic, matches with the faintly acid of the skin of people, therefore to human skin There is health-care and skin-care function, often wears color cotton clothes dress, comfortable antipruritic, affine skin can be played the role of.(Bide,2001；Hu Bai Pottery, 2004；Zhang Mei, 2005).

In recent years, domestic and foreign scholars have carried out some researchs to the pigment composition in natural colorful cotton fibre.Ryser (1983,1985) by test methods such as thin-layer chromatographies, the precursor catechin and tannin of tannin are had found in brown cotton linter Derivative, while speculate brown fibre color may be located at vacuole in it is related by the tannin effect of catechin derivation； In addition, can tentatively judge according to the chromogenic reaction of green cotton ethanolic extract, organic acid, steroid are contained in green cotton extract Alcohol, cumarin and Flavonoid substances.White cotton cotton seed hulls kind skin brown pigment and condensed tannin etc. are thought in Halloin (1982) research The oxidation of phenolic substances is closely related；In cotton variety condensed tannin be by relevant polymer original delphinium grandiflorum indigo and former cyanine indigo by Certain proportion mixing composition (Czochanska et al., 1980；Lane et al.,1981；Chan,1988).Schmutz (1996) etc. to green cotton chloroform/methanol extract studies have shown that styrene acid and its derivative are that green cotton fiber generates color An important factor for.The result matches with famous lignanoid's model, but the chemical composition of aromatic series matrix or unknown (Schmutz,1996；Moire,1999).Qiu Xinmian etc. (2002) passes through the wet process to color cotton, it is believed that natural liquor storeroom color Coloured silk is controlled by polychrom；Zhao Xiangqian etc. (2005) by the chromogenic reaction of Cotton Fiber of Natural Brown Cotton pigment extracted to methanol room temperature and Ultraviolet absorption spectroscopy, it was demonstrated that though the pigment is that flavone compound or 3- have flavonols of the hydroxyl by glucoside Class compound, but in pigment identification and analysis, there is no purify it；Yu Bailing (2002) thinks in Cotton Fiber of Natural Brown Cotton Pigment is the anthocyanidins such as delphinidin, but provide according to less.Zhan Shaohua etc. (2007) determines 4 using vanillin method The changing rule of condensed tannin content infers that brown cotton is fine in kind natural brown cotton seed chrotoplast and cotton fiber cell growth course It is consistent with white cottonseed shell pigment to tie up pigment, it is believed that condensed tannin is likely to the precursor of brown pigment synthesis.In addition, research discovery The accumulation of color cotton pigment has a certain impact to fiber quality, yield, it may be possible to lead to content of cellulose reduction and fabric The main reason for qualitative change is bad (Kohel, 1985；Hua et al.,2009).

Although not parsing completely to the specific pigment composition in natural colorful cotton fibre, majority report is thought, green cotton Coloring matter in fiber is fat-soluble, it may be possible to styrene acid and its derivative；And coloring matter is in Cotton Fiber of Natural Brown Cotton Water-soluble flavone compound (Ryser, 1983,1985；Zhao Xiangqian etc., 2005；Zhan Shaohua etc., 2004,2007；Hua et al.,2007,2009).In recent years, it starts with molecular biology method and seeks color cotton Forming Mechanism.Xiao etc. (2007) with The recombinant inbred strain of white cotton and brown cotton be material, using cDNA-AFLP method, cloned from brown cotton GhCHI, GhF3H, GhDFR, GhANS and GhANR5 structural genes, RT-PCR is analysis shows key on these flavonoids route of synthesis Expression quantity of the gene in Cotton Fiber of Natural Brown Cotton is apparently higher than the expression quantity in white cotton.By a series of early-stage studies, we The biochemistry, metabolic pathway and molecular mechanism of color cotton coloring matter are studied by team.Feng etc. (2013) studies have shown that Table of the key gene in Cotton Fiber of Natural Brown Cotton on tetra- flavonoids route of synthesis of GhCHS, GhC4H, GhF3 ' H and GhF3 ' 5 ' H It is apparently higher than the expression quantity in white cotton up to amount, HTLC is analysis shows naringenin (naringenin), Quercetin (quercetin), four kinds of flavone compounds of Kaempferol (kaempferol) and myricetin (myricetin) are in brown fibre Accumulation be apparently higher than the accumulation in white cotton fiber.Pass through the NMR to extracting and developing Cotton Fiber of Natural Brown Cotton coloring matter Identification, discovery brown cotton colors are procyanidine, and the essential building blocks for constituting procyanidine are epigallocatechins, There is a small amount of epicatechin structural unit simultaneously.The average degree of polymerization of the tannin is calculated by MALDI-TOF mass spectral analysis It is 5.3, average molecular mass 1608.97, wherein epigallocatechin structural unit accounts for 90.1%.Since brown cotton is fine Tie up growth course in, the fiber of early stage brown cotton be it is white, until Fibre Development to dehydration period, fiber is just gradually converted into Brown.It is concluded that this is related () with the oxidation polymerization of procyanidine.

But it is currently known natural color cotton variety source and all belongs to brown and green-series (Du Xiongming, 1997), face Color is dull, fiber quality is poor, color fastness and color saturation deficiency become the technical bottleneck (Qiu Xin for limiting color cotton industry development Cotton, 2004).In recent years, scientific research personnel makes the fibre of color cotton using the method for distant hybridization, composite-crossing and continuously-directional breeding Dimension length, strength and yield are greatly improved.But due in existing color cotton lack except brown, green in addition to its The germ plasm resource of its color can not solve current color cotton color dullness with traditional genetic breeding means and color saturation is low Problem.

(3) summary of the invention

It is an object of the present invention to provide a kind of breeding methods of color cotton, are inserted by T-DNA and obtain cotton purple mutant Hybridize with the color cotton of different colours fiber, improves and create the cotton new material or new product different from now coloured colored fiber Kind；By key gene in genetically manipulated anthocyanidin biosynthetic metabolism access, it is tired to change anthocyanidin in plant and cotton fiber Product, oxidation and polymerization；Furthermore transgenic line hybridization or the pyramiding breeding of purpleization mutant and anthocyanidin metabolism key gene For fiber color improvement and the initiative of new color.

The technical solution adopted by the present invention is that:

The present invention provides a kind of breeding method of color cotton, and the method is one of following: (1) with cotton purple mutant HS2 be parent hybridize with different cultivars cotton, obtain color cotton, the cotton purple mutant HS2 be by inhibition or Knock out what cotton flavonoids O- methyl transferase gene GhOMT1 expression obtained；(2) knock out, edit, interfere or be overexpressed cotton Key gene in anthocyanidin biosynthetic metabolism access obtains color cotton；The key gene phenylalanine lyase Gene PAL, cinnamic acid -4- '-hydroxylase gene C4H, 4- hydroxycinnamoyl CoA ligase gene 4CL-8, chalcone synthase base Because of GhCHS, enzyme, namely chalcone isomerase gene C HI, flavanone 3-hydroxylase gene F3H, flavonoids 3 '-'-hydroxylase gene F3 ' H, class 3 ', 5 '-'-hydroxylase gene of flavones F3 ' 5 ' H, flavanonol-4-reductase gene DFR, leucocyanidin reductase gene GhLAR, leucocyanidin dioxygenase gene LDOX, anthocyanin reductase gene GhANR, flavonoids O- methyl transferase gene GhOMT1 or glutathione S-transferase gene GST.

Further, key gene described in preferred method (2) is that (nucleotide sequence (gDNA) is SEQ ID to GhOMT1 Shown in NO.1, cDNA sequence is shown in SEQ ID NO.2, which is classified as SEQ ID Shown in NO.3, the amino acid sequence for encoding albumen is shown in SEQ ID NO.4), (nucleotides sequence is classified as SEQ ID NO.5 to GhCHS It is shown), GhANR (nucleotides sequence is classified as shown in SEQ ID NO.6) or GhLAR (nucleotides sequence is classified as shown in SEQ ID NO.7) One of or it is a variety of.

Further, the cotton purple mutant HS2 hybridizes with brown cotton, obtains the dark brown brown that arrives to orange colour Cotton by the color burn of former parent or shoals；Cotton purple mutant HS2 hybridizes with green cotton, obtains brown cotton to deeply Green arrives blackish green color cotton, i.e., by the color burn of former parent or shoals；The brown cotton includes palm fibre wadding 1, new coloured silk 5 Number, new coloured silk 7586, palm fibre wadding 1-52 is shallow or palm fibre wadding 1-61 is deep；The green cotton includes green wadding 1, new color No. 5 or new coloured silk 7.

Further, the interference or overexpression interference or overexpression GhCHS, one or more of GhANR or GhLAR When, obtain the color cotton that cotton fiber color is deepened or shoals.

Further, the cotton purple mutant HS2 is the expression (inhibit or knock out) of silencing GhOMT1 gene, tool Body is by flavonoids O- methyl transferase gene GhOMT1 (flavonoid0- in cotton anthocyanidin anabolism access Methyltransferase, FOMT) it knocks out, the mutant that purple is all presented in entire breeding time for whole strain is obtained, it can be well For the improvement of colored fiber, respectively with green wadding 1 and new color No. 7 hybridization, brown no in current production, dark green is obtained The colored fibers such as color, blackish green.The gene and its various expression vectors contain reporter sequences, screening-gene sequence simultaneously With each restriction enzyme site for genetic manipulation, it will be appreciated by persons skilled in the art that above-mentioned reporter gene, screening-gene It can be replaced with each genetic manipulation sequence, the present invention limits not to this.

The method of inhibition of the present invention or knockout GhOMT1 expression, comprising the following steps:

1) GhOMT1 gene is operably connected with promoter；

2) plant expression vector containing GhOMT1 gene and promoter is constructed, the expression vector at least contains enhancing Type, composing type and/or inducible promoter；

3) host is converted with the plant expression vector, obtains transformant；

4) with the transformant infection plant, cotton purple mutant HS2 is obtained.

The cDNA sequence of GhOMT1 of the present invention include 5 '-non-translational region sequences, open reading frame (ORF) sequence and 3 '-non-translational region sequences, wherein open reading frame sequence is coded sequence, and genomic dna sequence contains exon and introne Sequence.GhOMT1 gene upstream sequence, that is, promoter and core controlling element, with DNA sequence dna shown in SEQ ID NO.3, It will be appreciated by persons skilled in the art that the DNA sequence dna of SEQ ID NO.3 is taken by several or one section of nucleotide residue Generation, missing or addition, or insertion large fragment DNA sequence etc. change downstream gene expression mode and similarly belong to above range.By The protein of above-mentioned GhOMT1 gene coding, with amino acid sequence shown in SEQ ID NO.4, those skilled in the art can With understanding, by the amino acid residue sequence of SEQ ID NO.4 by the substitution of one or several amino acid residues, missing or Addition and the protein as derived from SEQ IDNO.4 with bioactivity identical as the amino acid residue sequence of SEQ ID NO.4 Sequence similarly belongs to above range.

In a kind of specific embodiment of the invention, GhOMT1 gene or cDNA forward direction are inserted into plant expression vector In pBI121-35S-NOS, is started with CaMV35S promoter and expressed, construct the plant expression vector containing GhOMT1 gene PBI21-35S-GhOMT1-NOS, with structure as shown in figure 14, which contains reporter sequences simultaneously, Screening-gene sequence and each restriction enzyme site for genetic manipulation, it will be appreciated by persons skilled in the art that above-mentioned report Gene, screening-gene and each genetic manipulation sequence can replace, and the present invention limits not to this.

In a kind of specific embodiment of the invention, GhOMT1 genetic fragment insertion plant is interfered into expression vector In pB7GWIWG2 (II), started with CaMV35S promoter and expressed, constructed the plant interference expression containing GhOMT1 gene and carry Body pB7GWIWG2 (II)-GhOMT1-F-T35S, with structure as shown in figure 15, which contains report simultaneously Gene order, screening-gene sequence and each restriction enzyme site for genetic manipulation, it will be appreciated by persons skilled in the art that Above-mentioned reporter gene, screening-gene and each genetic manipulation sequence can replace, and the present invention limits not to this.

Further, color cotton breeding method of the present invention is one for interfering or being overexpressed in GhCHS, GhANR or GhLAR Or it is multiple, specifically:

(1) by chalcone synthase gene GhCHS (Chalcone synthase) piece in cotton anthocyanidin anabolism access In section insertion plant interference expression vector pB7GWIWG2 (II), is started with CaMV35S promoter and expressed, construct GhCHS gene Plant interfere expression vector pB7GWIWG2 (II)-GhCHS-F-T35S, with the plant interference expression vector convert host, Obtain transformant；With the transformant infection plant, the color cotton that fiber colour changes (deepen or shoal) is obtained；The expression carries Body contains reporter sequences, screening-gene sequence and each restriction enzyme site for genetic manipulation, art technology simultaneously Personnel are it is understood that above-mentioned reporter gene, screening-gene and each genetic manipulation sequence can replace, and the present invention is simultaneously It is limited not to this.

(2) by anthocyanin reductase gene GhANR (Anthocyanidin in cotton anthocyanidin anabolism access Reductase) in segment insertion plant interference expression vector pB7GWIWG2 (II), started with CaMV35S promoter and expressed, structure Plant interference expression vector pB7GWIWG2 (the II)-GhANR-F-T35S for having built GhANR gene, is interfered with the plant and is expressed Carrier converts host, obtains transformant；With the transformant infection plant, the coloured silk that fiber colour changes (deepen or shoal) is obtained Color cotton；The expression vector contains reporter sequences, screening-gene sequence and each restriction endonuclease position for genetic manipulation simultaneously Point, it will be appreciated by persons skilled in the art that above-mentioned reporter gene, screening-gene and each genetic manipulation sequence are that can replace It changes, the present invention limits not to this.

(3) by leucocyanidin reductase gene GhLAR in cotton anthocyanidin anabolism access (Leucoanthocyanidin reductase) segment is inserted into plant interference expression vector pB7GWIWG2 (II), is used The starting expression of CaMV35S promoter constructs plant interference expression vector pB7GWIWG2 (II)-GhLAR-F- of GhLAR gene T35S converts host with plant interference expression vector, obtains transformant；With the transformant infection plant, fiber is obtained The color cotton of color change (deepen or shoal)；The expression vector contains reporter sequences simultaneously, screening-gene sequence and For each restriction enzyme site of genetic manipulation, it will be appreciated by persons skilled in the art that above-mentioned reporter gene, screening-gene and Each genetic manipulation sequence can replace, and the present invention limits not to this.

The breeding method of color cotton of the present invention is to change anthocyanidin anabolism access in cotton body by genetic modification to close Key enzyme gene, including gene interference, gene knock out, the methods of gene editing, direct mutagenesis and overexpression change gene order And expression way, cause internal anthocyanidin anabolism to change.Expression vector (institute of the building containing the key gene first Stating expression vector is plant expression vector, and at least containing enhanced, composing type and/or inducible promoter), utilize upstream core Heart controlling element and sequence or the sequence being deleted or replacing, sequence editor etc., and downstream gene expression mode is caused to change.Again By the host cell of expression vector or transformant transformed plant, transgene cotton is obtained.

Anthocyanidin anabolism access key gene is answered by utilizing genetic engineering means in cotton body of the present invention Cotton plants histoorgan color changing material is created with the gene, can be used for the improvement of cotton fiber color and is changed Become.

Anthocyanidin anabolism access key gene includes: in cotton body of the present invention

Plant expression vector of the present invention, at least containing coding cotton anthocyanidin anabolism key gene nucleotide and Promoter sequence, the plant expression vector will be by that will encode anthocyanidin anabolism key gene, promoter sequence and plant Object expression vector is operably connected and constructs.For the needs for screening and expressing, sieve is also optionally included in expression vector The various restriction enzyme sites for selecting gene order, reporter sequences and other needs for genetic engineering operation and being inserted into, Screening-gene and reporter gene can be selected from gene order commonly used in the art.For example, can be in the expression vector The enzyme of color change or the gene of luminophor can occur for the coding that being added can express in plant, such as gus gene, GFP base Cause, luciferase etc.；Resistant antibiotic marker, such as hygromycin marker, anti-kalamycin marker；Anti- chemistry Reagent marker gene, such as anti-herbicide gene.

Promoter for constructing plant expression vector of the present invention can be any one promoter, including enhanced, group Molding, organizing specific type and inducible promoter.When construction of expression vector, the promoter be can be used alone, can be with It is used in combination with other plant promoters.Promoter for constructing plant expression vector of the present invention preferably constitute type promoter or Tissue-specific promoter more preferably derives from the plant constitutive promoter CaMV35S of cauliflower mosaic virus.In general, will The gene constructed downstream in CaMV35S.

The carrier that sets out for constructing plant expression vector of the present invention can be any one double base agrobacterium vector or It can be used for the plant expression vector of via Particle Bombardment Transformation.

Transformant of the present invention is turned by using Ti-plasmids, Ri plasmid, plant or microbiosis poisonous carrier, direct DNA The conventional biology methods such as change, microinjection, conductance or mediated by agriculture bacillus transfect the expression vector containing gene of the present invention Cotton and obtain transformant.

The present invention has the following advantages compared with the prior art:

It is currently known natural color cotton variety source and all belongs to brown and green-series (Du Xiongming, 1997), color list Adjust, fiber quality is poor, color fastness and color saturation deficiency become limit color cotton industry development technical bottleneck (Qiu Xinmian, 2004).In recent years, scientific research personnel makes the fiber of color cotton using the method for distant hybridization, composite-crossing and continuously-directional breeding Length, strength and yield are greatly improved.But it is other in addition to brown, green due to lacking in existing color cotton The germ plasm resource of color can not solve current color cotton color dullness with traditional genetic breeding means and color saturation is low asks Topic.So improveing colorful cotton fibre Color Quality by genetic engineering means and creating the colored cotton variety of new color is weight The approaches and methods wanted.

(4) Detailed description of the invention

Fig. 1 GhOMT1 gene knocks out the phenotype photo for obtaining purpleization mutant.Wherein CK: non-transgenic cotton C312 is (wild Raw type) and GhOMT1 knock out the upgrowth situation of transgene cotton purple mutant HS2 plant.

Fig. 2 purple mutant HS2 and color cotton palm fibre are wadded a quilt with cotton No. 1, and its performance that hybridization F1 comes up (is from left to right distinguished It is HS2 purple mutant, Hybrids F1 and palm fibre wadding 1).

The cotton blade anthocyanidin content of the green wadding of Fig. 31 and purpleization mutant HS2 Different Cross Combinations；1:HS2；2:C312； 3: green wadding 1；4: No. 1 × HS2 of green wadding；5: No. 1 × HS2 of green wadding；6: No. 1 × HS2 of green wadding；7:HS2 × green wadding 1；8:HS2 × Green wadding 1；9:HS2 × green wadding 1.

Fig. 4 palm fibre wadding 1 and purpleization mutant HS2 cross combination cotton blade anthocyanidin content；1:HS2；2:C312；3: palm fibre wadding No. 1；4: No. 1 × HS2 of palm fibre wadding；5: No. 1 × HS2 of palm fibre wadding；6: No. 1 × HS2 of palm fibre wadding；7:HS2 × palm fibre is wadded a quilt with cotton No. 1；8:HS2 × palm fibre wadding 1 Number；9:HS2 × palm fibre is wadded a quilt with cotton No. 1.

Fig. 5 palm fibre wadding 1 and purpleization mutant HS2 cross combination cotton fiber phenotype；A:C312；B:HS2；C:HS2 × palm fibre wadding 1 Number；D: palm fibre wadding 1.

The strain cotton fiber phenotype for stablizing heredity of Fig. 6 palm fibre wadding 1 and purpleization mutant HS2 cross combination progeny selection (it is from left to right that color cotton parent palm fibre is wadded a quilt with cotton No. 1, filial generation ZH016001, ZH016002, ZH016003, ZH016004 respectively, it is purple Change mutant HS2 white fiber).

The strain cotton fiber phenotype for stablizing heredity of the green wadding of Fig. 71 and purpleization mutant HS2 cross combination progeny selection It (is from left to right the green wadding No. 1, LH016001, LH016002, LH016003 of color cotton parent respectively, purpleization mutant HS2 white is fine Dimension).

Anthocyanidin composition is poor in No. 1 15DPA fiber of Fig. 8 purple mutant HS2 filial generation strain ZH016001 and brown wadding Different (upper figure is purpleization mutant HS2 filial generation, and the following figure is that parent palm fibre is wadded a quilt with cotton No. 1).

Fig. 9 transgenosis interferes cotton plants growth and development phenotype；A.GhANR-RNAi transgenic plant；B.GhLAR-RNAi Transgenic plant；C.GhCHS-RNAi transgenic plant；D. upland cotton wild type C312WT (left side) and GhPDS-RNAi transgenosis Plant positive control (right side).

Phenotype when No. 1 transgenosis interference strain blow-of-cottons of Figure 10 color cotton palm fibre wadding；CHS:GhCHS-RNAi transgenic plant； ANR:GhANR-RNAi transgenic plant；LAR:GhLAR-RNAi transgenic plant；CK: color cotton palm fibre wad a quilt with cotton No. 1 (left side) and GhPDS-RNAi transgenic plant, positive control (right side).

Figure 11 color cotton palm fibre wads a quilt with cotton No. 1 (ZX1) interference strain compared with WT, CK, C312, PDS cotton fiber color；CHS: GhCHS-RNAi transgenic plant；ANR:GhANR-RNAi transgenic plant；LAR:GhLAR-RNAi transgenic plant；C312: Upland cotton wild type C312；WT: color cotton wild type palm fibre is wadded a quilt with cotton No. 1；CK: the plant pair of zero load conversion color cotton palm fibre wadding 1 is shone； PDS:GhPDS-RNAi transgenic plant, positive control (right side).

The cotton boll and cotton fiber and WT cotton fiber color ratio of the transgenosis interference strain of Figure 12 color cotton palm fibre wadding 1 (ZX1) Compared with.

The building schematic diagram of Figure 13 GhCHS, GhANR, GhLAR gene overexpression carrier.

Figure 14 plant expression vector pBI121-35S-GhOMT1-N0S structure chart, wherein NPTII represents neomycin phosphoric acid and turns Enzyme gene is moved, there is kalamycin resistance；GhOMT1 represents GhOMT1 gene cDNA or GhOMT1 genomic gene；NOS:Nos Terminator；35S: from the plant composition promoter of cauliflower mosaic virus；LB:T-DNA left margin；On the right of RB:T-DNA Boundary.Plant expression vector is the pBI121 carrier of transformation.

Figure 15 inhibits GhOMT1 gene plant to interfere expression vector pB7GWIWG2 (II)-GhOMT1 structure chart, wherein Bar Bialaphos resistance gene (bialaphos resistance gene) is represented, there is Herbicid resistant；T35S: from flower The terminator of cauliflower mosaic virus；GhOMT1-F represents GhOMT1 characteristic fragments；Intron represents one section of non-coding sequence； P35S: from the plant composition promoter of cauliflower mosaic virus；LB:T-DNA left margin；RB:T-DNA right margin.It plants Object expression vector is pB7GWIWG2 (II) carrier of transformation.

The identification of Figure 16 transgene cotton, the expression analysis of interference expression GhOMT1 transgene cotton, WT (CK): non-to turn base Because of cotton (wild type)；RNAi1-4:RNAi interference inhibits GhOMT1 transgene cotton.

Figure 17 interferes influence of the GhOMT1 to Developmental of Cotton, wherein A: non-transgenic cotton (wild type) and interference The upgrowth situation of GhOMT1 transgenic cotton plant；CK WT: non-transgenic cotton (wild type)；RNAi: interference GhOMT1 turns base Because of cotton, red shank, red autumnal leaves handle, red sepal, safflower valve, red autumnal leaves edge.

Figure 18 CRISPR/Cas9 expression vector schematic diagram.

(5) specific embodiment

The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:

Below in conjunction with attached drawing, the present invention is further described in detail, but following explanation does not limit the present invention Fixed, any pair of deformation and change of the invention, as long as it does not depart from the spirit of the invention, should belong to appended claims of the present invention Defined range.

Reagent chemicals in present example do not do illustrate be it is common commercially available, MATERIALS METHODS does not illustrate Refer to " Molecular Cloning:A Laboratory guide " (Sambrook and Russell, 2001).

In following examples of the invention, cotton experimental material used is upland cotton different cultivars or strain jade-like stone word cotton 312 (Gossypium hirsutum cv.C312), No. 1 (Gossypium hirsutum cv.ZX1) of color cotton palm fibre wadding.

Embodiment 1 cultivates new color cotton using upland cotton purple mutant HS2

1, the acquisition of cotton purple mutant HS2

The T-DNA expression vector (pBI121) built is gone into Agrobacterium LB4404 bacterial strain and expands culture, utilizes cotton C312 seedling hypocotyl is explant, and the Agrobacterium LB4404 with loading T-DNA carrier is in basic induced medium (MSB5 respectively Culture medium, 2,4-D (2,4- dichlorphenoxyacetic acid) 0.1mg/L+KT (basic element of cell division) 0.1mg/L) upper 23 DEG C of co-incubation 36- 48h.Hypocotyl after being trained altogether with the sterile water wash containing cephalosporin (500mg/L), then hypocotyl is in induced medium On (MSB5 culture medium, 2,4-D 0.1mg/L+KT 0.1mg/L+ kanamycins 50mg/L), 28 DEG C of cultures induce embryo callus subculture Tissue.Resistance embryo callus subculture is transferred to screening and culturing medium (MSB5 culture medium, IBA (heteroauxin) 0.5mg/L+KT 0.15mg/L+ kanamycins 50mg/L) on screening convert successful embryo callus, by the different callus of differential growth Block is inoculated on different subculture mediums (MSB5 culture medium+IBA 0.5mg/L+KT 0.2mg/L) respectively, and subculture, which is chosen, to be turned Change successful embryo callus, the formation of embryoid, until regeneration induction plant.(specific method refers to Liping Ke, RuiE Liu,Bijue Chu,Xiushuang Yu,Jie Sun,Brian Jones,Gang Pan,Xiaofei Cheng, Huizhong Wang,Shuijin Zhu,Yuqiang Sun.Cell Suspension Culture-Mediated Incorporation of the Rice Bel Gene into Transgenic Cotton.PLoS ONE,2012,7(7): e39974)。

Purpleization mutant HS2 (i.e. flavonoids O- methylated transferase (abbreviation is obtained from transgene genetic offspring GhOMT1) gene, which is silenced, no longer expresses), under field conditions (factors), the mutant is dead to plant since being sprouted seed, whole All histoorgan of a breeding time, blade, stem, petiole, floral organ etc. are all presented purple (Fig. 1, the whole strain of wild type are green Blade, sepal and white petal；The purpleization whole strain of mutant HS2 plant is purple, and darkviolet blade, petal is interior infrared purple), and Stablize heredity, the extremely significant accumulation of anthocyanidin content in the blade of entire plant.

2, hybridize the new color cotton of cultivation with Conventional color cotton using purpleization mutant HS2

(green wadding 1, palm fibre wadding 1, palm fibre wadding 1-61 be deep, palm fibre wadding 1-52 for purpleization mutant HS2 and colored cotton variety or strain Shallowly, newly color No. 5, it is new No. 7 color etc.) be planted in mid-July in normal growing conditions and the last ten-days period are hybridized, with purpleization mutant HS2 is male parent, and respectively to color cotton variety pollination, bagging harvests cotton boll and seed.Each strain at least does 50 plants of hybrid strains.It is natural The selfing of color cotton parent's bagging, reserves seed for planting.

(1) cross combination F1 phenotype

Purpleization mutant HS2 and colored cotton variety (green wadding 1 (LX1), palm fibre wadding 1 (ZX1), the deep (ZX1- of palm fibre wadding 1-61 61), palm fibre wadding 1-52 shallow (ZX1-52), new color No. 5 (XC5), new color No. 7 (XC7)) Different Cross Combinations are F₁, by F₁Under kind and cover Bag selfing, obtains F₂, observe F₂Trait segregation ratio.The F1 generation hybrid plant of Different Cross Combinations all with parent's purple mutant HS2 Phenotype is consistent, and purple is all presented in entire breeding time since emergence, and color cotton parent is green plant (Fig. 2, blade and hypocotyl Purple, purple and green phenotype is presented), there is typical dominant inheritance in purpleization character.

(2) purpleization mutant HS2 and the measurement of the anthocyanidin content of different lines color cotton cross combination

The general content (Giusti et al., 2001) for showing poor method measurement anthocyanidin using pH.This experiment will use outstanding vertical Section's 2102c ultraviolet specrophotometer is measured anthocyanidin content in cotton leaf, colorimetric cup diameter 1cm.Experiment is opened Before beginning, need to first with sample diluting liquid 0.4M KC1-HC1 buffer (pH4.5) by sample 1:10,1:50,1:100 by volume, 1:500,1:1 000 dilutes, it is ensured that linear determination range of the absorbance of anthocyanidin in ultraviolet specrophotometer.With ddH₂O tune Zero, 530nm, 620nm, 650nm absorbance value are measured respectively.

Calculation formula are as follows:

Anthocyanidin OD value (OD λ)=(OD₅₃₀-OD₆₂₀)-0.1(OD₆₅₀-OD₆₂₀)

Anthocyanidin content calculation formula: anthocyanidin content (nmol/g)=OD λ/ε × V/m × 10^6

In formula: OD λ is optical density of the anthocyanidin under 530nm wavelength；ε is 4.62 × 10^ of anthocyanidin molar extinction coefficient 6；V is extracting solution total volume (mL), and m is sampling quality (g)；10^6 is the multiple of calculated result conversion nmol.

Note: the absorption peak wavelength of anthocyanidin acid solution is 530nm；It is 620nm that soluble sugar, which absorbs peak wavelength,；Leaf The absorption peak wavelength of green element is 650nm.

Anthocyanidin content difference between analysis Different Cross Combinations various trait plant leaf, is extracted character point occurs respectively From No. 1 cross combination of green wadding, palm fibre wadding No. 1 cross combination spire in anthocyanidin, according to the depth of color in same combination Shallowly it is divided into purple, purplish red and green, and extracts anthocyanidin.Trait segregation cotton blade occurs in flower with determined by ultraviolet spectrophotometry Difference (Fig. 3,4) on green cellulose content.In No. 1 cross combination of purpleization mutant HS2 and green wadding, find in F₂There is purpleization character Under conditions of separation, No. 1, No. 4 and No. 7 strain or combination are significantly higher than 2,3,5,6 and No. 8 combinations in anthocyanidin content measurement, Illustrate that the content of anthocyanidin in No. 1 cross combination blade of purpleization mutant HS2 and the color green wadding of cotton is higher than wild type C312 and colour The green wadding 1 of cotton parent, F₂Trait segregation makes the anthocyanidin accumulation of Purpled traits plant be strengthened (Fig. 3).

No. 1 cross combination F of purpleization mutant HS2 and palm fibre wadding₂Also there is obviously trait segregation phenotype, mention respectively The anthocyanidin in different phenotype blades is taken, trait segregation cotton blade occurs on anthocyanidin content with determined by ultraviolet spectrophotometry Difference (Fig. 3).Comparative test data discovery, the content of upland cotton C312 anthocyanidin is minimum, and phenotype corresponds to green.And occur The HS2 of trait segregation × palm fibre No. 1 purpleization plant anthocyanidin content highest of wadding, illustrates No. 1 cross combination of green wadding in F₂Having occurred property Shape separation, purpleization character are enhanced.Illustrate in No. 1 cross combination F of palm fibre wadding₂Middle regulation anthocyanidin anabolism and transhipment are accumulated Key gene overexpression.Observation obtains the leaf color that trait segregation occurs and measured anthocyanidin content is consistent 's.

(3) application of the purpleization mutant in improvement fiber colour

By the comparison of same cross combination different lines plant cotton boll, the crosses in same cross combination are found Cotton fiber color than the color of purpleization mutant HS2 and color cotton parent's cotton fiber depth, while the yield of cotton fiber and fine It is again better than color cotton parent to tie up length.There is this phenomenon in multiple cross combinations of this group experiment, illustrates purpleization mutant The excessive cyanine that HS2 is accumulated in blade is known as part and has been transferred in cotton fiber, passes through purpleization mutant HS2 and color cotton parent Hybridization can effectively improve cotton fiber color and quality (Fig. 5).

HS2 × palm fibre No. 1 lines progeny of wadding fiber colour is significantly deepened than the fiber colour of palm fibre No. 1 selfing of wadding, quality It significantly improves, either the length of fiber or the density of fiber.Identical phenomenon is all presented in Different Cross Combinations, different In cross combination, the color of cenospecies has different difference, but has obvious color promotion and quality for comparing parent It is promoted.By the difference between comparison different cultivars Different Cross Combinations strain, from F2 for quality can be filtered out in segregating population The cotton hybrid strain (Fig. 6 and 7) of the fiber colour multiplicity of excellent stabilization heredity, distinguishes a series of dark-brown of breeding, Brown, and green, bottle green and blackish green color cotton new cross combination.(palm fibre is wadded a quilt with cotton for cotton purple mutant HS2 and brown cotton No. 1, new No. 5 color, new coloured silk 7586, palm fibre wadding 1-52 is shallow, and palm fibre wadding 1-61 is deep etc.) hybridization, dark brown, brown, the face such as orange can be obtained The color cotton of color fibre；Cotton purple mutant HS2 and green fiber color cotton (green wadding 1, new No. 5 color, new coloured silk 7 etc.) are miscellaneous It hands over, the color cotton of the colors fiber such as brown, bottle green, blackish green can be obtained.

Palm fibre wadding 1 and HS2 × palm fibre No. 1 lines progeny of wadding fiber (15-18DPA) anthocyanidin are extracted using acidified methanol method It is analyzed for LC/MS.In order to analyze the difference in color cotton fiber anthocyanidin component, LC/MS chromatography is the result is that pass through detection Instrument Agilent 6460Triple Quad LC/MS is obtained, and LC/MS chromatography is the result shows that miscellaneous in purpleization mutant HS2 Anthocyanidin composition is very big relative to No. 1 variation of wadding of parent coloured silk cotton parent palm fibre in friendship offspring's fiber, new component, component newly occurs Nucleocytoplasmic ratio is respectively 117.0,158.0 and 434.2 etc. (Fig. 8), also indicates that purpleization mutant HS2 as parent and different color cottons Kind/incross, thus it is possible to vary the composition of anthocyanidin in fiber core, to form new color.

Embodiment 2 interferes GhCHS, GhANR, GhLAR gene to lead to colored fiber color change respectively using RNAi

GhCHS, GhANR, GhLAR gene of Cloning of full length, selecting the gene GhCHS, (nucleotides sequence is classified as SEQ ID Shown in NO.5), GhANR (nucleotides sequence is classified as shown in SEQ ID NO.6), (nucleotides sequence is classified as SEQ ID NO.7 institute to GhLAR Show) distinguished sequence segment, the interference expression vector of GhCHS, GhANR, GhLAR gene is constructed, injection method (side is permeated by cotyledon Method refers to Fu et al.Acyl-CoA N-acyltransferase influences fertility by regulating lipid metabolism and jasmonic acid biogenesis in cotton.Scientific Reports, 2015,5:11790) electricity turns Agrobacterium GV3101.

The cDNA sequence that target gene is found in NCBI utilizes 5.0 software design of software Primer Express The viral interference primer of GhPDS, GhCHS, GhANR, GhLAR, primer both ends add respectively Spe I and Asc I restriction enzyme site and Protect base, PCR amplification (table 1).

The amplification of 1 target gene of table and detection primer table

1. reconstruct pCLCrVA-CHS, pCLCrVA-ANR, pCLCrVA-LAR containing pCLCrVA, pCLCrVB, target gene And the GV3101 strain Agrobacterium of pCLCrVA-PDS, it is activated respectively at that afternoon, specifically: the above-mentioned each bacterium of 100 μ L Liquid is added 10mL and contains kanamycins (50mg/L) resistance LB liquid medium, and 220rpm, 28 DEG C of shaking table cultures for 24 hours, are activated Bacterium solution.

2. take step 1 50 μ L activate bacterium solution, be added 25mL kanamycins (50mg/L) resistance liquid LB in expand it is numerous, 220rpm, 28 DEG C of shaking tables are incubated overnight, and obtain the bacterium solution of OD value 1.0-1.5.

3. take step 2 bacterium solution (containing pCLCrVA, target gene reconstruct pCLCrVA-CHS, pCLCrVA-ANR, The GV3101 strain Agrobacterium of pCLCrVA-LAR and pCLCrVA-PDS) each 5mL (OD value 1.0-1.5), take bacterium containing pCLCrVB Liquid 25mL, room temperature 4000rpm are centrifuged 5min, abandon supernatant, are separately added into isometric LB liquid medium, and suspension thalline is beaten in suction.

4. 1:1 is uniformly mixed by volume with pCLCrVB LB liquid medium respectively, as note after placing 3h at room temperature Penetrate liquid.

5. being drawn and being infused with syringe when cotton seedling length is fully deployed to two panels cotyledon and does not extract true leaf out (about 10d) Liquid is penetrated, hole injection (avoiding main lobe arteries and veins) is pricked at the cotyledon back side, until injection infiltrates into most of area of cotyledon, after injection Plant, cultivated in greenhouse in 21-23 DEG C, 14h illumination/10h dark culturing condition.

Cotton material is upland cotton C312, palm fibre wadding No. 1 (ZX1), purpleization mutant HS2 and brown No. 1 × HS2 (ZH), HS2 of wadding a quilt with cotton × palm fibre No. 1 (HZ) positive and negative hybridization F3 generation of wadding.Interference experiment is at least repeated 3 times, each interference efficiency 80%, and transgenic plant It is more stable with cotton fiber phenotype.

The transgene cotton of interference ANR, LAR and CHS gene compared with WT (upland cotton C312), is grown between plant in seedling stage Gesture is similar, growth period is consistent, without apparent difference (Fig. 9).Blade, stalk and the cotton boll of PDS positive control plant are shown Apparent hickie.Transgenosis interferes plant after cotton boll blowing, and apparent difference (Figure 10) occurs in cotton fiber color.

By test discovery is repeated several times, interfere palm fibre No. 1 (ZX1) cotton fiber of wadding of ANR, LAR and CHS gene in color respectively Occur shoal in various degree (Figure 11,12) on pool, wherein ANR color change is the most significant, hence it is evident that color is most shallow, followed by The cotton fiber of LAR, CHS interference plant also has desalination phenotype compared with WT.Show the synthesis of anthocyanidin in cotton body and transhipment ANR, LAR and CHS gene play an important role in anthocyanidin synthesis access, for cotton fiber pigment synthesis, transhipment and product Tire out extremely important.

Embodiment 3 cultivates red cotton using RNAi interference GhOMT1 gene

(1) GhOMT1 gene (shown in SEQ ID NO.1) forward direction is inserted into plant expression vector pBI121-35S-NOS, Started with CaMV35S promoter and expressed, constructs the plant expression vector pBI21-35S-GhOMT1- containing GhOMT1 gene NOS, such as Figure 14.

GhOMT1 genetic fragment (shown in SEQ ID NO.1) insertion plant is interfered in expression vector pB7GWIWG2 (II), Started with CaMV35S promoter and expressed, constructs plant interference expression vector pB7GWIWG2 (II)-containing GhOMT1 gene GhOMT1-F-T35S, such as Figure 15.

The carrier thermal shock method conversion DH-5 α E. coli competent built, this process are selectively trained with LB kanamycins Support base culture recon.The plasmid pB7GWIWG2 (II)-extracted from the Escherichia coli DH-5 α of conversion GhOMT1 gene GhOMT1, electric shocking method are imported into Agrobacterium LB4404, specific steps are as follows: 0.1cm shocks by electricity, cup cleans 2-3 with absolute alcohol It is secondary, it is put on workbench and dries up, be placed in cooled on ice, while Agrobacterium LB4404 competence is thawed on ice；1-2 μ l plasmid is added Into the LB4404 of defrosting, gently inhales and beat mixing, ice bath 5-8min；Above-mentioned product is gone in electric shock cup, electric converter is adjusted to AGR grades, 600 μ l SOC culture medium (20g/L tryptone, 5g/L yeast extract, 5g/L NaCl, 2.5mM are added in electric shock KCl, 10mM MgCl₂, solvent is deionized water, pH7.0), suction beat, be sufficiently mixed to bacterium solution in culture medium, suction in In 1.5ml centrifuge tube.28 DEG C, 220rpm shakes bacterium 1h；It is coated on the dual anti-screening containing Spec (100mg/L) and Rif (25mg/L) On the plate of LB culture medium, it is placed in 28 DEG C of constant incubator culture 1-2d；It chooses spot detection and shakes bacterium, positive colony bacterium solution glycerol adding - 80 DEG C are stored in, it is standby to infect use.

(2) by step (1) positive colony bacterial strain on dual anti-screening LB culture medium (Spec 100mg/L, Rif 25mg/L) Scribing line, 26.5 DEG C of dark culture 36-48hr are cultivated to the end of growing enough bacterium colonies in ware, media surface bacterium colony are scraped into three MGL culture medium (tryptone 5g/L, sodium chloride 5g/L, MgSO in the bottle of angle₄·7H₂O 0.1g/L, KH₂PO₄0.25g/L, Mannitol 5g/L, glycine 1.0g/L, solvent are deionized water, pH value 7.0) in, 27 DEG C, 200rpm shake 2hr, OD value is in 0.5- It can be used to infect between 1.5.Cotton C312 seedling hypocotyl is collected in sterile triangular flask, activated bacterium solution is poured into it In, just having covered surface is advisable, and stirs evenly, and stands 5-10 minutes, outwells bacterium solution, filter paper blots remaining bacterium solution, and blowing 5 minutes makes surface slightly For drying, thin layer dispersion is distributed in co-cultivation base (MSB5 culture medium+2, the 4-D 0.1mg/L+KT0.1mg/L+ grape for being lined with filter paper Sugared 30g/L+phytagel2.5g/L) in, 19-21 DEG C dark culture 36-48 hours, to small part callus surface occur it is less obvious Bacterium colony terminate to co-culture.The hypocotyl trained altogether with the sterile water wash containing cephalosporin (500mg/L).Under after cleaning Plumular axis is transferred to resistance screening culture medium (MSB5 culture medium+2,4-D 0.1mg/L+KT0.1mg/L+ glucose 30g/L+ Phytagel 2.5g/L+ herbicide BASTA75mg/L) on evoked callus to embryo callus, screening conversion is successful Embryo callus, the different callus lines of differential growth are inoculated on subculture medium respectively (MSB5 culture medium+ IBA0.5mg/L+KT 0.2mg/L+ herbicide BASTA75mg/L), subculture chooses the successful embryo callus of conversion, culture Formed embryoid, until regeneration induction plant (specific method refer to Liping Ke, RuiE Liu, Bijue Chu, Xiushuang Yu,Jie Sun,Brian Jones,Gang Pan,Xiaofei Cheng,Huizhong Wang,Shuijin Zhu,Yuqiang Sun.Cell Suspension Culture-Mediated Incorporation of the Rice Bel Gene into Transgenic Cotton.PLoS ONE,2012,7(7):e39974)。

In the transgenic line of GhOMT1 gene interference, the extremely significant decline (Figure 16) of the expression of GhOMT1 gene, And this breeding time of transgenic plant, plant stalk, branch, petiole since seedling stage, leaf margin are all red, inheritance stabilities； Florescence, calyx, bud and petal are all red (Figure 17).The phenotypic genetic of the interference strain is stablized, and can be applied to very well The cenospecies nursery selection of crossbreeding.

Embodiment 4 knocks out GhOMT1 gene using CRISPR-Cas9 technology and cultivates red and aubergine cotton

1. the CRISPR/Cas9 system gene knockout carrier of cotton GhOMT1 gene

1) true first, in accordance with CRISPR/Cas9 system in order to obtain target gene GhOMT1 sequence 18-23bp guideRNA The unique restriction condition in targeting site is exactly the gRNA sequence in the site PAM of 3 ' ends and the 18-22bp of the front end PAM.It finds The recognition site form in the site of 23bp, standard is GN19NGG, and wherein NGG is PAM sequence required for protein binding genome Column, do not need to appear on the carrier of building, need to be put into only GN19 this 20bp before NGG of carrier.The first of GN19 The G of position is initial signal required for tiny RNA is transcribed.

The guideRNA (gttccttttagtaaggcata) of target gene GhOMT1 sequence synthesizes upstream and downstream primer (5 '- GATTGN19-3 ', 3 '-CN19CAAA-5 '), the small fragment of shape belt lacing is capable of after so that them is annealed.

AtU6-26SK+:

5 '-GATTGN19-3 ': 5 '-GATTGttccttttagtaaggcata-3 '；

3 '-CN19CAAA-5 ': 3 '-CaaggaaaatcattccgtatCAAA-5 '.

Upstream and downstream primer is diluted with water to 10M, take respectively 10ul piping and druming mix, PCR instrument program setting (95 DEG C of 3min, 22℃

1min, ramprate0.1 DEG C/s, 22 DEG C of Hold), slow cooling obtains the double-strand with BbsI cohesive end guideRNA。

2) AtU6-26SK+ carrier B bsI endonuclease reaction

AtU6-26SK+ carrier B bsI digestion system

Enzyme used is NEB BbsI and corresponding digestion buffer, 37 DEG C, water bath with thermostatic control 8-12h.

3) digestion products recycle:

30ul digestion system agarose gel electrophoresis, separates purpose band, and the band that ultraviolet light irradiation gel takes saves To ready 1.5ml centrifuge tube, weigh, metering.Recycling Ago-Gel concentration used is 1.2%.Electrophoretic procedures: voltage 100V, 45-50min.Queen QIAquick Gel Extraction Kit carries out the recycling recycling of target fragment Ago-Gel, and spectrophotometer measures dense Degree, it is spare labeled as AtU6BbsI-.

AtU6BbsI-guideRNA connection reaction:

4 DEG C, connection is overnight.

4) connection carrier cloning verifying: 37 DEG C of thermal shock conversion e.colistraindh5αs expand numerous

- 80 DEG C of taking-up e.colistraindh5α competent cells, stand on ice to freeze thawing, conversion carrier will be needed to be added to In 50ul competence, gently inhales and plays mixing, stand 20min on ice, while water-bath is adjusted to 42 DEG C of spare, 4 DEG C of thermal shock 90s, 2min is quickly stood on ice, and SOC recovery medium (20g/L tryptone, 5g/L yeast extract, the 5g/L to have thawed is added NaCl, 2.5mM KCl, 10mM MgCl₂, solvent is deionized water, pH7.0), 37 DEG C of concussion recovery culture 1h.

5) resistant panel screening purpose clone:

Thermal shock converted product smears ammonia benzyl resistant panel (LB+Spec 100mg/L+Rif 25mg/L), 37 DEG C of dark cultures Numerous 4-6h is expanded in 12h, picking monoclonal, the concussion of LB culture medium, and the detection of vector primer PCR amplification primarily determines positive clone, sampling is sent Sequencing company sequencing is examined, and determines that target positive colony, thallus expand numerous, 50% -20 DEG C of glycerol preservation.Vector construction guideRNA It imports the expression vector first step to complete, is denoted as A+X carrier (X represents different guideRNA).

AtU6-guideRNA carrier positive colony screens PCR amplification system

PCR program: 95 DEG C of 4min；95℃30s；57℃1min；32 circulations；72℃10min；4 DEG C of preservations.

Since expression vector establishment needs pCAMBIA1300 carrier, complete expression vector is constructed as mediator.Needing will The A+X vector introduction pCAMBIA1300 carrier that the first step is built: according to distinctive restriction enzyme site, suitable two enzymes are chosen Enzyme site: KpnI and SalI carries out identical double enzyme digestion reaction to pCAMBIA1300 carrier and A+X carrier respectively, is had The digestion products of identical cohesive end, to complete the connection reaction of two carriers.

It is the preparation of two vector plasmid DNAs first, largely expands numerous culture carrier with the LB culture medium of corresponding resistance respectively Bacterial strain, the small extraction reagent kit plasmid of Axygene plasmid is small to be mentioned, marker plasmid concentration, while Ago-Gel experiment detection plasmid mentions Quality is taken, and takes part spare, other -20 DEG C preservations.

A+X carrier and pCAMBIA1300 carrier KpnI, SalI double digestion system

37 DEG C of waters bath with thermostatic control, 1h, Ago-Gel recycling.

This time the purpose recycling segment of two carriers of double digestion is respectively: A+ carrier 645bp, pCAMBIA1300 line taking Plasmid size.Take purpose band under ultraviolet light irradiation auxiliary, is saved in ready 1.5ml centrifuge tube.Equally, institute is recycled It is 1.2% with Ago-Gel concentration.Electrophoretic procedures: voltage 100V, 45-50min.

Queen QIAquick Gel Extraction Kit carries out the recycling recycling of target fragment Ago-Gel, and spectrophotometer measures concentration, respectively It is spare labeled as A+X carrier KpnI SalI double enzyme digestion product and pCAMBIA1300 carrier KpnI, SalI double enzyme digestion product.

6) A+ carrier KpnI SalI double enzyme digestion product and the connection of pCAMBIA1300 carrier KpnI, SalI double enzyme digestion product are anti- It answers:

A+X carrier, pCAMBIA1300 carrier KpnI, SalI double enzyme digestion product linked system

4 DEG C, connection is overnight.

Connect carrier cloning verifying: 37 DEG C of thermal shock conversion e.colistraindh5αs expand numerous.

E.colistraindh5α competent cell is taken out from -80 DEG C of low temperature refrigerator refrigerators, is stood on ice to freeze thawing, it need to Conversion carrier is added in 50ul competence, is gently inhaled and is played mixing, stands 20min on ice, at the same by water-bath be adjusted to 42 DEG C it is standby With 4 DEG C of thermal shock 90s quickly stand 2min on ice, and the SOC recovery medium to have thawed, 37 DEG C of concussion recovery culture 1h are added.

Resistant panel screens purpose clone: thermal shock converted product, which is smeared, blocks that resistant panel, and 37 DEG C, dark culture 12h, picking Numerous 4-6h is expanded in monoclonal, the concussion of LB culture medium, and the detection of vector primer PCR amplification primarily determines positive clone, and sequencing company is sent in sampling Sequencing is examined, and determines that target positive colony, thallus expand numerous, 50% -20 DEG C of glycerol preservation.The connection of vector construction A+X carrier PCAMBIA1300 carrier is completed, and A+X-1300 carrier is denoted as (X represents different guideRNA).

A+X-1300 carrier positive colony screens PCR amplification system

Respectively with vector specific primer and combination primer detection, annealing temperature is 57 DEG C and 59 DEG C, extension of time point respectively It is not 1min and 2min.

7) Cas9 protein expression vector connects reaction with pCAMBIA1300-AtU6-carrier:

Since connection reaction needs, respectively to two carrier double enzyme digestion reactions: KpnI, EcoRI.Two vector plasmid DNAs Preparation, largely expand numerous culture carrier bacterial strain, the small extraction reagent kit plasmid of Axygene plasmid with the LB culture medium of card that resistance respectively It is small to mention, marker plasmid concentration, while Ago-Gel experiment detection plasmid extracts quality, and takes part spare, other -20 DEG C guarantors It deposits.

A+X-1300 carrier and Cas9 carrier KpnI, EcoRI double digestion system

37 DEG C of waters bath with thermostatic control, 1h, Ago-Gel recycling.

30ul digestion system agarose gel electrophoresis, separates purpose band, and ultraviolet light irradiation gel takes purpose band, mesh Marking stripe size is respectively 5.8k and the linear size of original carrier, is saved in ready 1.5ml centrifuge tube, equally, recycles institute It is 1.2% with Ago-Gel concentration.Electrophoretic procedures: voltage 100V, 45-50min.

Queen QIAquick Gel Extraction Kit carries out the recycling recycling of target fragment Ago-Gel, and spectrophotometer measures concentration, respectively It is spare labeled as A+X-1300 carrier KpnI EcoRI double enzyme digestion product and Cas9 carrier KpnI EcoRI double enzyme digestion product.

8) A+X-1300 carrier KpnI EcoRI double enzyme digestion product is connected with Cas9 carrier KpnI EcoRI double enzyme digestion product Reaction:

A+X-1300 carrier, Cas9 carrier KpnI, SalI double enzyme digestion product linked system

4 DEG C, connection is overnight.

Connect carrier cloning verifying: 37 DEG C of thermal shock conversion e.colistraindh5αs expand numerous

- 80 DEG C of taking-up e.colistraindh5α competent cells, stand on ice to freeze thawing, conversion carrier will be needed to be added to In 50ul competence, gently inhales and plays mixing, stand 20min on ice, while water-bath is adjusted to 42 DEG C of spare, 4 DEG C of thermal shock 90s, 2min is quickly stood on ice, and the SOC recovery medium to have thawed, 37 DEG C of concussion recovery culture 1h are added.

Resistant panel screens purpose clone: thermal shock converted product, which is smeared, blocks that resistant panel, and 37 DEG C, dark culture 12h, picking Numerous 4-6h is expanded in monoclonal, the concussion of LB culture medium, and the detection of vector primer PCR amplification primarily determines positive clone, and sequencing company is sent in sampling Sequencing is examined.

A+X-1300-C carrier positive colony screens PCR amplification system

Determine that target positive colony, thallus expand numerous, 50% -20 DEG C of glycerol preservation.The connection of vector construction A+X-1300 carrier Cas9 carrier is completed, and it is complete to be denoted as A+X-1300-C carrier (X represents different guideRNA) CRISPR/Cas9 expression vector establishment At.

9) A+X-1300 carrier KpnI EcoRI double enzyme digestion product is connected with Cas9 carrier KpnI EcoRI double enzyme digestion product Reaction determines that target positive colony, thallus expand numerous, 50% -20 DEG C of glycerol preservation.Vector construction A+X-1300 carrier connects Cas9 Carrier is completed, and the completion of A+X-1300-C carrier (X represents different guiderRNA) CRISPR/Cas9 expression vector establishment is denoted as (Figure 18).

2.CRISPR/Cas9 expression vector genetic transformation Cotton Embryogenic Callus

The CRISPR/Cas9 carrier for the GhOMT1 that step 1 is built is gone into Agrobacterium LB4404 bacterial strain and expands culture, Embryo callus is placed on basic induced medium (MSB5 culture medium+2,4-D 0.1mg/L+KT with expression vector respectively On 0.1mg/L), 23 DEG C of co-incubation 36-48h.Then with the sterile water wash embryo callus subculture for containing cephalosporin (500mg/L) Tissue.Embryo callus subculture after cleaning is transferred to resistance screening culture medium (MSB5 culture medium, 2,4-D 0.1mg/L+KT0.1mg/ L+ glucose 30g/L+phytagel 2.5g/L+ herbicide BASTA 75mg/L) on screening convert successful embryo callus subculture group It knits.Subculture chooses the successful embryo callus of conversion, and culture forms embryoid, until regeneration induction plant.The conversion process In, from callus, embryo callus arrives somatic embryo and seedling, all shows as red or aubergine phenotype.

Sequence table

<110>Sun Yuqiang

<120>a kind of breeding method of color cotton

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2470

<212> DNA

<213>unknown (Unknown)

<400> 1

agattaaaaa attaaaaaat tccatgaatt agattaacat tagattcggc cgtttgaaat 60

gcagataagg tctcaaaatt ttggtaaagc gaaacaacca gaaacaggcg ctgagaaaga 120

aaccatgtct caagaagatc aagaggaaga agttgggaaa ctggccgtcc gcctagccaa 180

cgccgtggta cttccaatgg tcttgaaatc agccttggag ctgaacataa ttgacacaat 240

cttagccgct ggtgacggcg cgtttctgtc accttcccag attgcgagtg cccttccttc 300

aaagaatcct gacgcaccag tgctactaga tcgaatgcta cgcctgttgg ccagccattc 360

cattctcaaa tgcgcagtaa aagcaaagga aaaagaagaa attgaaagac tgtacggtgc 420

aggcccacta tgcaagttcc ttgttaagaa tcaagatgga gggtcgattg cacctctcct 480

tttgttgcac catgaccaag tcttcatgca aagctggtac catttaaatg atgctatact 540

agaaggaggg gttcctttta gtaaggcata cgggatgaca gcatttgaat atccaggaac 600

tgatcaacga ttcaatagag tatttaacca ggcaatgtca aatcatactg ctttgataat 660

gaggaagatt gttgatgttt acaaagggtt tgatgggttg aaagtgttgg ttgatgtggg 720

tggtgggatt ggggttgctc tcagttttat tacttcaaag tatcctcaaa tcaagggcat 780

caactttgat ctgcctcatg ttttggctga tgcacccact tattcaggtt ctataccaat 840

cactcccttt tatctcttga acagatttct ctgaaatcta tatgaaatta tgggatactt 900

gttagtccaa tctgatatga gtgtgtgtta atttaaagca ttgccatcgc tgggaaatgc 960

ttttagttgt gctgttttct ctttacatgc cttaacagta agcacttgaa accacaagca 1020

aactagagaa caatatcatt ttctttcttg tttaagtcta tctaattcta tctgctatta 1080

atttatgata aacgaattca tctcaattta tgttctgcag ggtagttggc aaagttgagt 1140

aaacccacat tgctaagaaa tgaacaagtt aaaatattta tacatggtgt tcgtttattg 1200

attttcatgt ctagctcatc taaagaggga gatatatatt tgagatatat atttgaggat 1260

aagcactttg gtttgagttt agtggtgtaa ttattttttt atattataat tattatattc 1320

aggggaaggg aggggcaggg ctctagcctt caaaatggaa aattgctaat ctctcaaaaa 1380

ttataaaatt ttaagttaat atgtggtaaa gttataattt gctccccaaa tgttagaatt 1440

tcaatctaat cctttcaaaa cctatcaaaa tataaacgaa tacagtgata aaattaaatt 1500

ttaactttta tgaaaatata taacttaatt tcaaccactc taaaaaatgt tctaccttta 1560

cacatataat tttaccaaaa gtaattgcat acatgaataa ttacattgcc aaaactgcat 1620

gcatgaataa ttacgttaag gtaatctatt aacagggtta acctttttga aaagatgtga 1680

aataacacat cttttgccga ataaaaagtg tttgttcttg aacagatccc ttttttgtgg 1740

cttataccaa aaaaaaaaaa atacatattg atataccttt tgctactctg ctctattgtt 1800

ttgacttgtt gtatcttaga gggaaactta tagcattaaa gaaagtgatt acgcatcttg 1860

ttctaaattt ttctttctta cctcacatat ttttctaaca atataggtgt tgagcatgtt 1920

ggcggagata tgtttgaaag tgttccaaaa ggtgatgcta ttttcttaaa ggtaagcctt 1980

tatgtcctat agcttggtaa atggagaact ttttttctat tttcttatca taattgatac 2040

atgtagaagt tgtggaatct gtttagctta gtaactttat gaaacttgca gtggatactc 2100

catgattgga gtgatgaaca ttgcttgaag cttctcaaga actgttggga agctctccct 2160

aatggtggga aagtgattat tgtggaatct atcttacccg aggttcccga taccagtgtt 2220

tcttcaaaca ttgtctgtga acaagatctg tttatgttag ctcaaaaccc ggggggcaaa 2280

gagagaaccc taaaggaata tgaggactta gctttaaaaa caggtttctc tgggtgtgaa 2340

gtaatctgct gtgcttataa cagctgggtc atgcaaatgg agaaaagggc aatttattga 2400

agttctattg gaagcttcca tttcctttca tctaccccaa caggaggatt caacataatg 2460

tttacttttt 2470

<210> 2

<211> 1077

<212> DNA

<213>unknown (Unknown)

<400> 2

atgtctcaag aagatcaaga ggaagaagtt gggaaactgg ccgtccgcct agccaacgcc 60

gtggtacttc caatggtctt gaaatcagcc ttggagctga acataattga cacaatctta 120

gccgctggtg acggcgcgtt tctgtcacct tcccagattg cgagtgccct tccttcaaag 180

aatcctgacg caccagtgct actagatcga atgctacgcc tgttggccag ccattccatt 240

ctcaaatgcg cagtaaaagc aaaggaaaaa gaagaaattg aaagactgta cggtgcaggc 300

ccactatgca agttccttgt taagaatcaa gatggagggt cgattgcacc tctccttttg 360

ttgcaccatg accaagtctt catgcaaagc tggtaccatt taaatgatgc tatactagaa 420

ggaggggttc cttttagtaa ggcatacggg atgacagcat ttgaatatcc aggaactgat 480

caacgattca atagagtatt taaccaggca atgtcaaatc atactgcttt gataatgagg 540

aagattgttg atgtttacaa agggtttgat gggttgaaag tgttggttga tgtgggtggt 600

gggattgggg ttgctctcag ttttattact tcaaagtatc ctcaaatcaa gggcatcaac 660

tttgatctgc ctcatgtttt ggctgatgca cccacttatt caggtgttga gcatgttggc 720

ggagatatgt ttgaaagtgt tccaaaaggt gatgctattt tcttaaagtg gatactccat 780

gattggagtg atgaacattg cttgaagctt ctcaagaact gttgggaagc tctccctaat 840

ggtgggaaag tgattattgt ggaatctatc ttacccgagg ttcccgatac cagtgtttct 900

tcaaacattg tctgtgaaca agatctgttt atgttagctc aaaacccggg gggcaaagag 960

agaaccctaa aggaatatga ggacttagct ttaaaaacag gtttctctgg gtgtgaagta 1020

atctgctgtg cttataacag ctgggtcatg caaatggaga aaagggcaat ttattga 1077

<210> 3

<211> 540

<212> DNA

<213>unknown (Unknown)

<400> 3

tgttatcctt cggttagcta ttcaacacct agatgactaa aaaaacatca tcttaaatag 60

ttggatgact taattgtaat tttttaaaat taaataacta aaataaaaac ttaaatataa 120

ttaaatgact agtaatataa tttactcttt gaaaaaattt attcaaaaaa agtcaaggag 180

agggcaataa acgattatgg gcacaggtaa agcttttagt gctgcaaata gttgagtgac 240

cgagtatttt aattttggtt aaaattaaat taattgatct aattcagtta atcagttggt 300

taataaattt aagttaaaag attttttaaa attttgatta atgatttatt cggtttaaaa 360

ttaaataatt agttgaactt aataaattat attaatatta tatatattag gctattacta 420

gttctgtaaa ttcggttaat aattaatttt ttaaaaataa ttttaattta attattagtt 480

aaaggattaa aaatttgatt aatactaagt caattagatt aactcctcgt ttgaacaccc 540

<210> 4

<211> 357

<212> PRT

<213>unknown (Unknown)

<400> 4

Ser Gln Glu Asp Gln Glu Glu Glu Val Gly Lys Leu Ala Val Arg Leu

1 5 10 15

Ala Asn Ala Val Val Leu Pro Met Val Leu Lys Ser Ala Leu Glu Leu

20 25 30

Asn Ile Ile Asp Thr Ile Leu Ala Ala Gly Asp Gly Ala Phe Leu Ser

35 40 45

Pro Ser Gln Ile Ala Ser Ala Leu Pro Ser Lys Asn Pro Asp Ala Pro

50 55 60

Val Leu Leu Asp Arg Met Leu Arg Leu Leu Ala Ser His Ser Ile Leu

65 70 75 80

Lys Cys Ala Val Lys Ala Lys Glu Lys Glu Glu Ile Glu Arg Leu Tyr

85 90 95

Gly Ala Gly Pro Leu Cys Lys Phe Leu Val Lys Asn Gln Asp Gly Gly

100 105 110

Ser Ile Ala Pro Leu Leu Leu Leu His His Asp Gln Val Phe Met Gln

115 120 125

Ser Trp Tyr His Leu Asn Asp Ala Ile Leu Glu Gly Gly Val Pro Phe

130 135 140

Ser Lys Ala Tyr Gly Met Thr Ala Phe Glu Tyr Pro Gly Thr Asp Gln

145 150 155 160

Arg Phe Asn Arg Val Phe Asn Gln Ala Met Ser Asn His Thr Ala Leu

165 170 175

Ile Met Arg Lys Ile Val Asp Val Tyr Lys Gly Phe Asp Gly Leu Lys

180 185 190

Val Leu Val Asp Val Gly Gly Gly Ile Gly Val Ala Leu Ser Phe Ile

195 200 205

Thr Ser Lys Tyr Pro Gln Ile Lys Gly Ile Asn Phe Asp Leu Pro His

210 215 220

Val Leu Ala Asp Ala Pro Thr Tyr Ser Gly Val Glu His Val Gly Gly

225 230 235 240

Asp Met Phe Glu Ser Val Pro Lys Gly Asp Ala Ile Phe Leu Lys Trp

245 250 255

Ile Leu His Asp Trp Ser Asp Glu His Cys Leu Lys Leu Leu Lys Asn

260 265 270

Cys Trp Glu Ala Leu Pro Asn Gly Gly Lys Val Ile Ile Val Glu Ser

275 280 285

Ile Leu Pro Glu Val Pro Asp Thr Ser Val Ser Ser Asn Ile Val Cys

290 295 300

Glu Gln Asp Leu Phe Met Leu Ala Gln Asn Pro Gly Gly Lys Glu Arg

305 310 315 320

Thr Leu Lys Glu Tyr Glu Asp Leu Ala Leu Lys Thr Gly Phe Ser Gly

325 330 335

Cys Glu Val Ile Cys Cys Ala Tyr Asn Ser Trp Val Met Gln Met Glu

340 345 350

Lys Arg Ala Ile Tyr

355

<210> 5

<211> 1170

<212> DNA

<213>unknown (Unknown)

<400> 5

atggtgaccg tggaagaagt tcgtaaggct caacgtgccc aaggccctgc caccgtgttg 60

gccatcggca catcaacccc gcctaattgt gttgatcaga gcacataccc tgactactat 120

ttccgtatca caaatagtga gcacaaaacc gagttgaaag agaagttcaa gcgcatgtgt 180

gaaaaatcga tgatcaagaa gcgatacatg taccttacag aagagatttt gaaagagaat 240

cccaatgtat gtgaatacat ggctccttca ctggacgcta ggcaagatat ggtggtagtt 300

gaggtgccaa agctaggcaa agaagcagcc accaaggcca ttaaggagtg gggccagccc 360

aagtccaaga tcacccacct tgtcttttgc accactagcg gtgtggacat gcctggggct 420

gactaccagc tcaccaagct tttaggcctc cgcccctccg ttaagcgcct catgatgtac 480

caacaaggtt gcttcgcagg ggggacggtg ctccgagtgg ctaaggactt agctgagaac 540

aacaaaggtg ctcgtgtact tgttgtgtgc tcggagatta ctgctgttac ctttcgtgga 600

cctagtgaca ctcacctaga cagtcttgtg ggccaagcat tgtttggtga tggtgccgca 660

gctgttataa tcggggcaga ccccgtgccc gaaatcgaga agcccatgtt tgaaatagtc 720

tcagtagccc aaacgatctt gccagatagt gatggtgcga ttgatggtca ccttcgtgaa 780

gttgggctta catttcacct tcttaaggat gttccggggc ttatttcgaa gaatatagaa 840

aagagcctgg tagaagcatt tcaaccattg ggcatatccg attggaactc ccttttttgg 900

attgctcatc ctggtggtcc agcaatatta gatcaagtag aagccaaatt agcactgaag 960

ccagagaagc tacgagccac aaggcacgtt ctttcagagt atggtaacat gtcaagtgct 1020

tgtgttctat ttattttgga tgagatgagg aagaaatcaa gggaagatgg gcttcagacc 1080

acaggagaag gattggagtg gggagtgctc tttgggtttg gacctggcct cactgttgag 1140

actgttgtgc tccatagtgt tgctgcttaa 1170

<210> 6

<211> 1011

<212> DNA

<213>unknown (Unknown)

<400> 6

atggccagcc agatcgtagg aacaaagaaa gcttgtgtcg tgggtggcag cggattcgtt 60

gcgtcattgc tggtcaagtt gttgctcgag aagggttacg ccgttaacac tacagtcagg 120

gaccctgaca accagaagaa gatctctcac cttgtaacac tacaagagtt gggagacttg 180

aaaatctttc aggcggattt aactgatgaa gggagctttg atgcccctat tgctggttgt 240

gaccttgtct tccatgttgc gacacccgtt aactttgctt ctgaagatcc agagaatgac 300

atgatcaaac cagcgaccca aggagtggtg aacgttttga aagcttgtgc caaagcaaaa 360

acagttaaac gtgtcgtctt gacatcatct gccgcagctg tgtctatcaa cacactgaat 420

gggacagatc tggtcatgac agagaaagac tggaccgata tcgagttctt atcatcagca 480

aagccaccaa cttgggggta ccctgcatcc aagacgttgg ctgaaaaggc agcttggaaa 540

tttgctgaag aaaacaacat tgatctcatt acagttatcc cttctctcat gactggtcct 600

tccctcaccc caattgtccc cagcagcata ggccttgcta catctttgat ttcaggcaat 660

gaattcctca taaatgcttt gaaaggaatg cagatgctgt caggttcgat ctctatcaca 720

catgtggaag acgtatgccg agcccatgtt tttctggctg aaaaagaatc tgcatcgggt 780

cgatatatat gcagtgctgt caataccagt gtgccagaac tagctaagtt cctcaacgaa 840

agataccctg acttcaaagt ccctaccgat tttggagatt tcccctccaa acccaagttg 900

atcatttcct cagagaagct tattagcgaa aggttcagct ttaagtatgg gatcgaggaa 960

atctacgacc aaaccgtgga atatttgaag tctaaggggc tgctcaagtg a 1011

<210> 7

<211> 1080

<212> DNA

<213>unknown (Unknown)

<400> 7

atgaaatcaa cacaaatgaa tggttcatat ccaaatgagt cagaggccgg tcagactgta 60

gttatcggtt caagtgggtt cataggtcgg ttcattaccg aggcctgtct agactcaggc 120

cggccaacgt atatcttagt ccgctctagt tcaaactctc cctccaaagc ttccaccatt 180

aagtttcttc aagacaaagg agccatcgtt atatatggtt ctatcaccga ccaagaattc 240

atggagaaag ttctgagaga atataagata gaagttgtaa tatctgctgt aggaggggag 300

agcatcttgg accagctcag tctaatagag gctattaaga atgtaaacac tgtgaagagg 360

tttgtaccgt cggaatttgg tcatgacata gatagggcga aaccggtgga accggggctg 420

accatgtatg agcaaaagag caagattagg aggcagatag aggaatgcgg gatcccgtac 480

agttacatat gctgcaactc cattgctgct tggccctacc atgacaacac tcatccagca 540

gatgttctac caccccttga taggttccaa atctatggtg atggcgctgt caaagcatac 600

tttgtggcgg gttccgatat tggaaagttc actgtcatgt ccactgatga tgatcgaaca 660

ctaaacaaaa ccgtccattt tcaacctcca agtaacctat taaacatgaa cgaaatggct 720

tcactatggg agacaaagat cggccgcgtg ctgcctaggg taactatcac agaacaagat 780

ctgctccagc gggctcaaga gatgcggatc ccgcagagtg tggttgctgc aataactcat 840

gacattttca taaatggctg tcaaataaac ttcagcttgg acaaaactac tgatgttgaa 900

atctgctctc tctatccgaa cacttcattt cggaccattg cggagtgctt cgacgatttt 960

gccaagaaga tatcagataa tgaaaaagca gtgagcaagc cagtgactgc aagcaacact 1020

gacatttttg tgcccactgc taaaccagaa gcattggcta tcaccgcgat atgcacatga 1080

Claims

1. a kind of breeding method of color cotton, it is characterised in that the method is one of following: (1) with cotton purple mutant HS2 is that parent hybridizes with different cultivars cotton, obtains color cotton；(2) knock out, edit, interfere or be overexpressed cotton cyanine Key gene in plain biosynthetic metabolism access obtains color cotton；The key gene includes phenylalanine lyase Gene PAL, cinnamic acid -4- '-hydroxylase gene C4H, 4- hydroxycinnamoyl CoA ligase gene 4CL-8, chalcone synthase base Because of GhCHS, enzyme, namely chalcone isomerase gene C HI, flavanone 3-hydroxylase gene F3H, flavonoids 3 '-'-hydroxylase gene F3 ' H, class 3 ', 5 '-'-hydroxylase gene of flavones F3 ' 5 ' H, flavanonol-4-reductase gene DFR, leucocyanidin reductase gene GhLAR, leucocyanidin dioxygenase gene LDOX, anthocyanin reductase gene GhANR, flavonoids O- methyl transferase gene GhOMT1 or glutathione S-transferase gene GST.

2. the breeding method of color cotton as described in claim 1, it is characterised in that the key gene be GhOMT1, GhCHS, One of GhANR or GhLAR or a variety of.

3. the breeding method of color cotton as claimed in claim 2, it is characterised in that the cotton purple mutant HS2 is to pass through suppression System knocks out what flavonoids O- methyl transferase gene GhOMT1 expression obtained.

4. the breeding method of color cotton as claimed in claim 2, it is characterised in that the method is to interfere or be overexpressed GhCHS, One or more of GhANR or GhLAR.

5. the breeding method of color cotton as described in claim 1, it is characterised in that the different cultivars cotton include it is green wadding No. 1, Palm fibre wadding 1, palm fibre wadding 1-61 are deep, palm fibre wadding 1-52 is shallow, color No. 5 or new No. 7 color new.

6. the breeding method of color cotton as claimed in claim 5, it is characterised in that the cotton purple mutant HS2 and brown cotton Hybridization obtains dark brown to orange color cotton；Cotton purple mutant HS2 hybridizes with green cotton, obtains brown to blackish green Color cotton；The brown cotton includes palm fibre wadding 1, new No. 5 color, new coloured silk 7586, and palm fibre wadding 1-52 is shallow or palm fibre wadding 1-61 is deep；The green Cotton includes green wadding 1, new color No. 5 or new coloured silk 7.

7. the breeding method of color cotton as claimed in claim 4, it is characterised in that it is described interference or overexpression GhCHS, GhANR or When one or more in GhLAR, the color cotton that cotton fiber color is deepened or shoals is obtained.