CN109234304B

CN109234304B - Cultivation method of colored cotton

Info

Publication number: CN109234304B
Application number: CN201810778979.3A
Authority: CN
Inventors: 孙玉强; 柯丽萍
Original assignee: Individual
Current assignee: Individual
Priority date: 2018-07-16
Filing date: 2018-07-16
Publication date: 2022-08-02
Anticipated expiration: 2038-07-16
Also published as: CN109234304A

Abstract

The invention discloses a cultivation method of colored cotton, which is one of the following methods: (1) hybridizing the purple cotton mutant HS2 serving as a parent with cotton of different varieties to obtain colored cotton; (2) knocking out, editing, interfering or over-expressing key enzyme genes in a cotton anthocyanin biosynthesis metabolic pathway to obtain colored cotton; the key enzyme genes comprise PAL, C4H, 4CL-8, CHS, CHI, F3H, F3 ' H, F3 ' 5 ' H, DFR, LAR, LDOX, ANR, OMT or GST.

Description

Cultivation method of colored cotton

(I) technical field

The invention relates to a breeding method for cultivating colored cotton by utilizing a genetic modification technology of key genes of an anthocyanin metabolic pathway and combining a conventional cross breeding technology.

(II) background of the invention

Cotton is one of the most important economic crops in the world, and china is the largest world in terms of textile production and consumption. In order to meet the requirements of people on the gorgeous and colorful ornaments, the cotton textiles must be subjected to chemical printing and dyeing before being made into finished products. However, in the processing process, various chemical substances are used, which may cause harm to human health; meanwhile, due to the requirements of the printing and dyeing processing technology, a large amount of water is consumed in the processing process of the printing and dyeing cloth, and meanwhile, water pollutants are discharged. According to the production of printing and dyeing cloth in the printing and dyeing industry of China in recent years, the amount of discharged printing and dyeing wastewater is about 20 billion cubic meters and accounts for 35 percent of the whole industrial wastewater, wherein the discharge amount of the printing and dyeing wastewater accounts for 80 percent of the discharge amount of the wastewater in the textile industry, and the printing and dyeing wastewater has the characteristics of difficult decolorization, high organic matter concentration and the like. Due to the continuous development and application of new processes, new raw materials, new dyes and new auxiliaries, wastewater pollutants discharged in the production process become more and more complex, and the treatment difficulty is also increasing (zhang, 2011; handsome in the future, 2004).

With the development and progress of society, people are pursuing health, environmental protection and no pollution of products. The international organic agro-industrial commission predicts that within the next 30 years, the worldwide organic cotton production will account for 30% of the total cotton production, about 400 million tons. But the production of the organic cotton only solves the pollution-free problem of the raw cotton production, and can not avoid the harm of chemicals to the health of people caused by the chemical printing and dyeing of textiles. Therefore, the research and planting of the colorful fibers with various colors are very important, the colorful cotton is cotton with natural fibers and colors, the whole process from planting, spinning to finished products strictly follows the green production standard, and the colorful cotton is not only suitable for people to return to the nature and pursue natural environment-friendly fashion, but also is special cotton which is healthy, harmless and high in ecological benefit. People are called the pet of the 21 st century because of the green, ecological and environmental protection characteristics of natural colored cotton textiles. The formation of colored fibers is mainly due to the accumulation of different anthocyanins and their derivatives, which present different shades. Anthocyanin is a very important secondary metabolite of plants, is one of main pigments for producing colorful leaves, petals and fruit colors of plants, and has very important physiological functions.

The anthocyanin is a very important secondary metabolite of the plant, is one of main pigments for producing colorful leaves, petals and fruit colors of the plant, and has very important physiological functions. Colored cotton is more popular with unique natural, environmentally friendly and colorful fibers, and is formed mainly by the accumulation of anthocyanins and derivatives thereof in the fiber cavity. The colored cotton is a special type of cotton (Wangchend, 2002; Zhang Mg, 2005) containing pigment substances in fiber cells, and because the colored cotton does not need to be printed and dyed in the processing process, the harmful components in chemical dyes are prevented from harming human bodies and damaging the environment. The ecological finishing process of the colored cotton fabric can keep the proteins and vitamins which are beneficial to human health in the colored cotton fibers. The latest experiment shows that the color cotton fiber is faintly acid and is matched with the faintly acid of human skin, so that the color cotton fiber has the functions of health care and skin care on the human skin, and can play the roles of comfort, itching relief and skin affinity when people wear color cotton clothes frequently. (Bide, 2001; Huber pottery, 2004; Zhang Mg, 2005).

In recent years, researchers at home and abroad have conducted some studies on the pigment component in natural colored cotton fibers. Ryser (1983,1985) found tannin precursor catechin and tannin derivatives in brown cotton linters by thin layer chromatography and other experimental methods, and speculated that the color of brown fiber may be related to the action of catechin-derived tannin in vacuole; in addition, the green cotton extract contains organic acid, sterol, coumarin and flavonoid substances according to the color development reaction of the green cotton ethanol extract. Halloin (1982) studies suggest that brown pigment from seed coats of white cotton seed hulls is closely related to oxidation of phenolic substances such as condensed tannins; condensed tannins in cotton varieties are composed of the related multimer protodelphinidinium and protocyaninium in a mixture in a certain ratio (Czochanska et al, 1980; Lane et al, 1981; Chan, 1988). Studies of chloroform/methanol extracts of green cotton by Schmutz (1996) et al have shown that styrenated acids and derivatives thereof are important factors in the color development of green cotton fibers. The results are consistent with a well-known lignan model, but the chemical composition of the aromatic matrix is unknown (Schmutz, 1996; Moire, 1999). Qiu xin cotton, et al (2002) think that the color of natural brown cotton is controlled by multi-pigment through wet treatment of colored cotton; zhao Qian et al (2005) confirmed that the pigment is a flavonoid compound or a flavonol compound having a hydroxyl group at the 3-position but being glycosylated by a glycoside, as a result of color reaction and ultraviolet absorption spectrum analysis of a brown cotton fiber pigment extracted with methanol at room temperature, but the pigment was not purified at the time of identification and analysis; in Boling (2002), the pigment in brown cotton fibers is considered to be an anthocyanin pigment such as delphinidin, but the basis for this is less. Jensenhua et al (2007) use a vanillin method to determine the change rule of the content of condensed tannin in the development process of 4 natural brown cotton seed coat cells and cotton fiber cells to conclude that brown cotton fiber pigment is consistent with white cotton seed shell pigment, and the condensed tannin is considered to be a precursor for synthesizing the brown pigment possibly. In addition, it has been found that the accumulation of colored cotton pigment has a certain influence on the quality and yield of the fiber, which may be the main cause of the decrease in the cellulose content and the deterioration of the quality of the fiber (Kohel, 1985; Hua et al, 2009).

Although the specific pigment components in natural colored cotton fibers are not completely resolved, most reports suggest that the pigment substances in green cotton fibers are fat-soluble, possibly styrene acid and derivatives thereof; while the pigment material in the brown cotton fibers was a water-soluble flavonoid (Ryser,1983,1985; Zhao Yuan et al, 2005; Zhan Shaohua et al, 2004,2007; Hua et al, 2007,2009). In recent years, the mechanism of color cotton formation has begun to be explored by molecular biology means. Xiao et al (2007) cloned GhHI, GhF3H, GhDFR, GhANS and GhANR5 structural genes from brown cotton by cDNA-AFLP method using white cotton and brown cotton recombinant inbred line as material, RT-PCR analysis showed that the expression level of key genes on the flavonoid synthetic pathway in brown cotton fiber is significantly higher than that in white cotton. Through a series of preliminary studies, the research on biochemical, metabolic and molecular mechanisms of the color cotton pigment substance is carried out by a team. Feng et al (2013) research shows that the expression level of key genes in four flavonoid synthesis pathways of GhCHS, GhC4H, GhF3 ' H and GhF3 ' 5 ' H is obviously higher in brown cotton fibers than in white cotton fibers, and HTLC analysis shows that the accumulation level of four flavonoids of citrus (naringenin), quercetin (quercetin), kaempferol (kaempferol) and myricetin (myricetin) in brown fibers is obviously higher than that in white cotton fibers. NMR identification of the extracted and separated brown cotton fiber pigment substances shows that the brown cotton pigment substances are procyanidine, and the main constitutional unit of the procyanidine is epigallocatechin, and a small amount of epicatechin constitutional units are simultaneously found. The average degree of polymerization of this tannin was 5.3 and the average relative molecular mass was 1608.97, calculated by MALDI-TOF mass spectrometry, wherein the epigallocatechin unit accounted for 90.1%. Since the brown cotton fibers are white at an early stage during their development, the fibers do not gradually turn brown until they develop to the stage of dehydration. We conclude that this is related to the oxidative polymerization of procyanidins ().

However, it is known that all natural colored cotton variety resources belong to brown and green series (Du Xiongming, 1997), and the monotonous color, poor fiber quality, insufficient color fastness and color saturation become the technical bottleneck limiting the development of the colored cotton industry (Qiu Xin Cotton, 2004). In recent years, scientific researchers use distant hybridization, compound hybridization and continuous directional breeding to greatly improve the fiber length, strength and yield of the colored cotton. However, because the germplasm resources of other colors except brown and green are lacked in the existing colored cotton, the problems of monotonous color and low color saturation of the existing colored cotton cannot be solved by using the traditional genetic breeding means.

Disclosure of the invention

The invention aims to provide a method for cultivating colored cotton, which is characterized in that a purple mutant of cotton is obtained by inserting T-DNA (deoxyribonucleic acid) and the colored cotton with different colored fibers are hybridized, so that a new material or a new variety of cotton with the colored fibers different from the existing colored fibers is improved and created; the accumulation, oxidation and polymerization of anthocyanin in plants and cotton fibers are changed by manipulating key enzyme genes in an anthocyanin biosynthetic metabolic pathway through genes; furthermore, purple mutants are crossed with transgenic lines of anthocyanin metabolism key genes, or are polymerized for fiber color improvement and new color creation.

The technical scheme adopted by the invention is as follows:

the invention provides a cultivation method of colored cotton, which is one of the following methods: (1) hybridizing a cotton purple mutant HS2 serving as a parent with different varieties of cotton to obtain colored cotton, wherein the cotton purple mutant HS2 is obtained by inhibiting or knocking out expression of a cotton flavonoid O-methyltransferase gene GhOMT 1; (2) knocking out, editing, interfering or over-expressing key enzyme genes in a cotton anthocyanin biosynthesis metabolic pathway to obtain colored cotton; the key enzyme genes are phenylalanine ammonia lyase gene PAL, cinnamic acid-4-hydroxylase gene C4H, 4-hydroxycinnamoyl coenzyme A ligase gene 4CL-8, chalcone synthase gene GhCHS, chalcone isomerase gene CHI, flavanone 3-hydroxylase gene F3H, flavonoid 3 '-hydroxylase gene F3' H, flavonoid 3 ', 5' -hydroxylase gene F3 '5' H, dihydroflavonol-4-reductase gene DFR, colorless anthocyanin reductase gene GhLAR, colorless anthocyanin dioxygenase gene LDOX, anthocyanin reductase gene GhANR, flavonoid O-methyltransferase gene GhOMT1 or glutathione S-transferase gene GST.

Further, it is preferable that the key enzyme gene in the method (2) is one or more of GhOMT1 (the nucleotide sequence (gDNA) is shown in SEQ ID No.1, the cDNA sequence is shown in SEQ ID No.2, the nucleotide sequence of the upstream core regulatory element of the gene is shown in SEQ ID No.3, the amino acid sequence of the encoded protein is shown in SEQ ID No. 4), GhCHS (the nucleotide sequence is shown in SEQ ID No. 5), ghann (the nucleotide sequence is shown in SEQ ID No. 6) or GhLAR (the nucleotide sequence is shown in SEQ ID No. 7).

Further, the cotton purple mutant HS2 is hybridized with brown cotton to obtain dark brown to orange colored cotton, namely, the color of the original parent is deepened or lightened; hybridizing the cotton purple mutant HS2 with green cotton to obtain color cotton from brown cotton to dark green, i.e. deepening or lightening the color of the original parent; the brown cotton comprises a brown cotton fiber No.1, a new color No.5, a new color 7586, a brown cotton fiber 1-52 light or a brown cotton fiber 1-61 deep; the green cotton comprises a green cotton wool No.1, a new color No.5 or a new color No. 7.

Further, when one or more of the interference or overexpression GhCHS, GhANR or GhLAR is/are adopted, the colored cotton with deepened or lightened cotton fiber color is obtained.

Furthermore, the cotton purple mutant HS2 is used for silencing the expression (namely inhibition or knockout) of a GhOMT1 gene, specifically, a flavonoid O-methyltransferase gene GhOMT1 (flavanoid 0-methyltransferase, FOMT) in a cotton anthocyanin anabolism pathway is knocked out to obtain a mutant of which the whole plant is purple in the whole growth period, and the mutant can be well used for improving color fibers and respectively hybridized with a green catkin No.1 and a new color No.7 to obtain the color fibers such as brown, dark green and the like which are not produced currently. The gene and its various expression vectors simultaneously contain a reporter gene sequence, a screening gene sequence and various endonuclease sites for gene manipulation, and those skilled in the art can understand that the reporter gene, the screening gene and the various gene manipulation sequences can be replaced, and the invention is not limited thereto.

The method for inhibiting or knocking out the expression of GhOMT1 comprises the following steps:

1) operably linking the GhOMT1 gene with a promoter;

2) constructing a plant expression vector containing a GhOMT1 gene and a promoter, wherein the expression vector at least contains an enhanced, constitutive and/or inducible promoter;

3) transforming a host with the plant expression vector to obtain a transformant;

4) and (3) infecting plants by using the transformant to obtain a cotton purple mutant HS 2.

The cDNA sequence of GhOMT1 comprises a 5 '-untranslated region sequence, an Open Reading Frame (ORF) sequence and a 3' -untranslated region sequence, wherein the ORF sequence is a coding sequence, and a genome DNA sequence contains an exon sequence and an intron sequence. The upstream sequence of the GhOMT1 gene, i.e. promoter and core regulatory element, has the DNA sequence shown in SEQ ID NO.3, and those skilled in the art can understand that the expression pattern of the downstream gene can be changed by substituting, deleting or adding several or one segment of nucleotide residues of the DNA sequence of SEQ ID NO.3, or inserting a large segment of DNA sequence, etc., and the like. The protein encoded by the GhOMT1 gene has the amino acid sequence shown in SEQ ID NO.4, and those skilled in the art can understand that the protein sequence derived from SEQ ID NO.4, which is obtained by substituting, deleting or adding one or more amino acid residues to the amino acid residue sequence of SEQ ID NO.4 and has the same biological activity as the amino acid residue sequence of SEQ ID NO.4, also belongs to the above-mentioned range.

In a specific embodiment of the present invention, the GhOMT1 gene or cDNA is inserted forward into the plant expression vector pBI121-35S-NOS, and expression is promoted by CaMV35S promoter, and the plant expression vector pBI21-35S-GhOMT1-NOS containing the GhOMT1 gene is constructed, which has the structure shown in fig. 14, and includes a reporter gene sequence, a selection gene sequence and respective endonuclease sites for gene manipulation, and it is understood by those skilled in the art that the reporter gene, the selection gene and the respective gene manipulation sequences are replaceable, and the present invention is not limited thereto.

In a specific embodiment of the present invention, a GhOMT1 gene fragment is inserted into a plant interference expression vector pB7GWIWG2(II), and CaMV35S promoter is used to promote expression, thus constructing a plant interference expression vector pB7GWIWG2(II) -GhOMT1-F-T35S containing GhOMT1 gene, which has the structure shown in FIG. 15, and the expression vector contains a reporter gene sequence, a screening gene sequence and various endonuclease sites for gene manipulation, and it is understood by those skilled in the art that the reporter gene, the screening gene and various gene manipulation sequences can be replaced, and the present invention is not limited thereto.

Furthermore, the color cotton cultivation method of the invention is to interfere or over-express one or more of GhCHHS, GhANR or GhLAR, and specifically comprises the following steps:

(1) inserting a chalcone synthase gene GhCHS (chalcone synthase) fragment in a cotton anthocyanin anabolism pathway into a plant interference expression vector pB7GWIWG2(II), starting expression by using a CaMV35S promoter, constructing a plant interference expression vector pB7GWIWG2(II) -GhCHS-F-T35S of the GhCHS gene, and transforming a host by using the plant interference expression vector to obtain a transformant; infecting plants with the transformant to obtain colored cotton with changed (deepened or lightened) fiber color; the expression vector contains a reporter gene sequence, a screening gene sequence and each endonuclease site for gene operation, and those skilled in the art can understand that the reporter gene, the screening gene and each gene operation sequence can be replaced, and the invention is not limited thereto.

(2) Inserting an anthocyanin reductase gene GhANR (Anthocynidinium reductase) fragment in a cotton anthocyanin anabolism pathway into a plant interference expression vector pB7GWIWG2(II), starting expression by using a CaMV35S promoter, constructing a plant interference expression vector pB7GWIWG2(II) -GhANR-F-T35S of the GhANR gene, and transforming a host by using the plant interference expression vector to obtain a transformant; infecting plants with the transformant to obtain colored cotton with changed (deepened or lightened) fiber color; the expression vector contains a reporter gene sequence, a screening gene sequence and each endonuclease site for gene operation, and those skilled in the art can understand that the reporter gene, the screening gene and each gene operation sequence can be replaced, and the invention is not limited thereto.

(3) Inserting a colorless anthocyanin reductase gene GhLAR (leucoanthocyanidin reductase) fragment in a cotton anthocyanin anabolism pathway into a plant interference expression vector pB7GWIWG2(II), starting expression by using a CaMV35S promoter, constructing a plant interference expression vector pB7GWIWG2(II) -GhLAR-F-T35S of the GhLAR gene, and transforming a host by using the plant interference expression vector to obtain a transformant; infecting plants with the transformant to obtain colored cotton with changed (deepened or lightened) fiber color; the expression vector contains a reporter gene sequence, a screening gene sequence and each endonuclease site for gene operation, and those skilled in the art can understand that the reporter gene, the screening gene and each gene operation sequence can be replaced, and the invention is not limited thereto.

The method for cultivating the colored cotton changes the key enzyme genes of the anthocyanin anabolism pathway in the cotton body through genetic modification, and changes the gene sequence and the expression mode by methods such as gene interference, gene knock-out, gene editing, site-directed mutagenesis, over-expression and the like, so that the in-vivo anthocyanin anabolism is changed. Firstly, constructing an expression vector containing the key enzyme gene (the expression vector is a plant expression vector and at least contains an enhanced, constitutive and/or inducible promoter), and utilizing upstream core regulatory elements and sequences, or deletion or replacement of the sequences, sequence editing and the like to cause the change of the expression mode of downstream genes. Then the host cell or transformant of the expression vector is transformed into a plant to obtain the transgenic cotton.

The key enzyme gene of the anthocyanin anabolism pathway in cotton provided by the invention is used for creating a cotton plant tissue organ color changing material by utilizing a genetic engineering means, and can also be used for improving and changing the color of cotton fibers.

The key enzyme genes of the anthocyanin anabolism pathway in cotton provided by the invention comprise:

the plant expression vector at least contains nucleotide and promoter sequences of a gene encoding the anthocyanin anabolism key enzyme of cotton, and is constructed by operably connecting the gene encoding the anthocyanin anabolism key enzyme and the promoter sequences with the plant expression vector. For the purpose of screening and expression, a screening gene sequence, a reporter gene sequence and other various endonuclease sites inserted for the need of genetic engineering manipulation may be optionally contained in the expression vector, and the screening gene and the reporter gene may be selected from gene sequences commonly used in the art. For example, a gene encoding an enzyme or a luminescent compound which can undergo a color change, such as a GUS gene, a GFP gene, a luciferase, etc., which can be expressed in plants, may be added to the expression vector; antibiotic markers with resistance, such as hygromycin markers, anti-kalamycin markers, and the like; chemical reagent resistant marker genes, such as herbicide resistant genes and the like.

The promoter used to construct the plant expression vectors of the present invention can be any promoter, including enhanced, constitutive, tissue-specific, and inducible promoters. When constructing an expression vector, the promoter may be used alone, or may be used in combination with other plant promoters. The promoter used for constructing the plant expression vector of the present invention is preferably a constitutive promoter or a tissue-specific promoter, and more preferably a plant constitutive promoter CaMV35S derived from cauliflower mosaic virus. Typically, the gene is constructed downstream of CaMV 35S.

The starting vector for constructing the plant expression vector can be any binary agrobacterium vector or a plant expression vector for gene gun transformation.

The transformant of the present invention is obtained by transfecting cotton with an expression vector containing the gene of the present invention using a conventional biological method such as Ti plasmid, Ri plasmid, plant or microbial virus vector, direct DNA transformation, microinjection, conductance, or agrobacterium-mediated transformation.

Compared with the prior art, the invention has the following advantages:

at present, it is known that all natural colored cotton variety resources belong to brown and green series (Du Xiongming, 1997), and the monotonous color, poor fiber quality, insufficient color fastness and color saturation become the technical bottleneck limiting the development of the colored cotton industry (Qiu Xin Cotton, 2004). In recent years, scientific researchers use distant hybridization, compound hybridization and continuous directional breeding to greatly improve the fiber length, strength and yield of the colored cotton. However, because the germplasm resources of other colors except brown and green are lacked in the existing colored cotton, the problems of monotonous color and low color saturation of the existing colored cotton cannot be solved by using the traditional genetic breeding means. Therefore, the improvement of the color quality of the colored cotton fiber and the creation of a colored cotton variety with a new color by means of genetic engineering are important ways and methods.

(IV) description of the drawings

FIG. 1 is a picture of the phenotype of purple mutant obtained by knocking out GhOMT1 gene. The CK represents the growth condition of a transgenic cotton purple mutant HS2 plant from non-transgenic cotton C312 (wild type) and GhOMT1 knock-out.

FIG. 2 purple mutant HS2 and colored Cotton boll No.1, and their appearance of hybrid F1 seedling emergence (from left to right HS2 purple mutant, hybrid F1 and Brown boll No.1, respectively).

FIG. 3 cotton leaf anthocyanin content of different hybridization combinations of Green Flock No.1 and purple mutant HS 2; 1: HS 2; 2: c312; 3: no.1 green wadding; 4: green floc No.1 × HS 2; 5: green floc No.1 × HS 2; 6: green floc No.1 × HS 2; 7: HS2 × green floe No. 1; 8: HS2 × green floe No. 1; 9: HS2 × green floe No. 1.

FIG. 4 content of anthocyanin in palm fiber No.1 and purple mutant HS2 hybridized and combined cotton leaf; 1: HS 2; 2: c312; 3: no.1 brown wadding; 4: no.1 of brown cotton multiplied by HS 2; 5: no.1 of brown cotton multiplied by HS 2; 6: no.1 of brown cotton multiplied by HS 2; 7: HS2 Xbrown catkin No. 1; 8: HS2 × brown catkin No. 1; 9: HS2 × brown catkin No. 1.

FIG. 5 Brown Flock No.1 and purple mutant HS2 hybrid combination cotton fiber phenotype; a: c312; b: HS 2; c: HS2 Xbrown catkin No. 1; d: brown cotton No. 1.

FIG. 6 shows cotton fiber phenotypes of stable genetic lines bred by the filial combination of brown cotton seed No.1 and purple mutant HS2 (colored cotton parent brown cotton seed No.1, filial generations ZH016001, ZH016002, ZH016003, ZH016004 and purple mutant HS2 white fibers, respectively, from left to right).

FIG. 7 shows cotton fiber phenotypes of stable genetic lines bred by hybrid combination offspring of green boll No.1 and purple mutant HS2 (from left to right, green boll No.1, LH016001, LH016002, LH016003 and purple mutant HS2 white fibers of colored cotton parents, respectively).

FIG. 8 shows the difference of anthocyanin composition in purple mutant HS2 hybrid progeny line ZH016001 and 15DPA fiber of palm fibre No.1 (the upper figure is purple mutant HS2 hybrid progeny, and the lower figure is parent palm fibre No. 1).

FIG. 9 transgenic interfering cotton plant growth phenotype; GhANR-RNAi transgenic plants; GhLAR-RNAi transgenic plant; GhCHHS-RNAi transgenic plant; D. upland cotton wild type C312WT (left) and GhPDS-RNAi transgenic plant positive control (right).

FIG. 10 shows the phenotype of colored cotton-brown catkin No.1 transgenic interference line when opening the catkin; CHS: a GhCHS-RNAi transgenic plant; ANR is GhANR-RNAi transgenic plant; LAR is GhLAR-RNAi transgenic plant; CK, color cotton palm fiber No.1 (left) and GhPDS-RNAi transgenic plants, positive control (right).

FIG. 11 comparison of color Cotton Brown No.1 (ZX1) interference line with WT, CK, C312, PDS cotton fiber color; CHS: a GhCHS-RNAi transgenic plant; ANR is GhANR-RNAi transgenic plant; LAR is GhLAR-RNAi transgenic plant; c312: cotton wild type C312; WT: color cotton wild type brown cotton No. 1; CK is plant contrast of no-load conversion color cotton palm fiber No. 1; and (2) PDS: GhPDS-RNAi transgenic plants, positive control (right).

FIG. 12 color Cotton wool number 1 (ZX1) cotton bolls and cotton fibers of the transgenic interference line were compared to WT cotton fiber color.

FIG. 13 is a schematic diagram showing the construction of overexpression vectors for the GhCHS, GhANR, and GhLAR genes.

FIG. 14 shows the structure of the plant expression vector pBI121-35S-GhOMT1-N0S, in which NPTII represents the neomycin phosphotransferase gene, having resistance to kanamycin; GhOMT1 represents GhOMT1 gene cDNA or GhOMT1 genome gene; NOS: Nos terminator; 35S plant constitutive promoter from cauliflower mosaic virus; LB is the T-DNA left border; RB T-DNA right border. The plant expression vector is a modified pBI121 vector.

FIG. 15 shows a structure of a plant interference expression vector pB7GWIWG2(II) -GhOMT1 for inhibiting GhOMT1 gene, wherein Bar represents bialaphos resistance gene (herbicide resistance gene); T35S terminator derived from cauliflower mosaic virus; GhOMT1-F represents a characteristic fragment of GhOMT 1; intron represents a segment of non-coding sequence; p35S plant constitutive promoter from cauliflower mosaic virus; LB is the T-DNA left border; RB T-DNA right border. The plant expression vector is a modified pB7GWIWG2(II) vector.

FIG. 16 identification of transgenic cotton, expression analysis of interference-expressing GhOMT1 transgenic cotton, WT (CK): non-transgenic cotton (wild type); RNAi1-4 RNAi interference inhibits GhOMT1 transgenic cotton.

FIG. 17 interferes with the effect of GhOMT1 on cotton growth and development, where A is the growth status of non-transgenic cotton (wild type) and interfering with GhOMT1 transgenic cotton plants; CK WT non-transgenic cotton (wild type); RNAi interference GhOMT1 transgenic cotton, red stem, red leaf stalk, red sepals, red petals and red leaf margin.

Fig. 18 CRISPR/Cas9 expression vector schematic.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the present invention will be described in further detail with reference to the accompanying drawings, but the following description is not intended to limit the present invention, and any modifications and changes may be made thereto without departing from the spirit of the present invention, which is defined in the appended claims.

Reagents and drugs in the examples of the present invention are not specifically described, and they are generally commercially available, and materials and methods are not specifically described, and reference is made to molecular cloning protocols (Sambrook and Russell, 2001).

In the following examples of the present invention, the cotton experimental materials used were cotton of various varieties or lines of upland cotton, i.e., cotton 312(Gossypium hirsutum cv. c312), and cotton-brown cotton-1 (Gossypium hirsutum cv. zx 1).

Example 1 cultivation of New colored Cotton Using upland Cotton purple mutant HS2

1. Acquisition of cotton purple mutant HS2

Transferring the constructed T-DNA expression vector (pBI121) to an agrobacterium LB4404 strain for amplification culture, and respectively culturing the cotton C312 seedling hypocotyl serving as an explant and the agrobacterium LB4404 loaded with the T-DNA vector on a basic induction culture medium (MSB5 culture medium, 2,4-D (2, 4-dichlorophenoxyacetic acid) 0.1mg/L + KT (cytokinin) 0.1mg/L) at 23 ℃ for 36-48 h. The hypocotyls after the co-culture were washed with sterile water containing cefamycin (500mg/L), and then the hypocotyls were cultured on an induction medium (MSB5 medium, 2, 4-D0.1 mg/L + KT0.1mg/L + kanamycin 50mg/L) at 28 ℃ to induce embryogenic calli. Transferring the resistant embryogenic callus to a screening culture medium (MSB5 culture medium, IBA (indoleacetic acid) 0.5mg/L + KT 0.15mg/L + kanamycin 50mg/L) to screen the embryogenic callus which is successfully transformed, respectively inoculating different callus blocks which are differentiated and grown to different subculture culture media (MSB5 culture medium + IBA0.5mg/L + KT 0.2mg/L), subculturing to pick out the embryogenic callus which is successfully transformed, and forming embryoids until a regeneration plant is induced. (for specific methods, refer to Liping Ke, RuiE Liu, Bijue Chu, Xiushhuan Yu, Jie Sun, Brian Jones, Gang Pan, Xiiaofei Cheng, Huizhong Wang, Shuijin Zhu, Yuqiiang Sun cell Suspension Culture-media incorporated of the Rice beer Gene endogenous Cotton, 2012,7(7): e 39974).

Purple mutant HS2 (namely flavonoid O-methylated transferase (GhOMT 1 for short) gene is silenced and is not expressed) is obtained from transgenic genetic progeny, under natural conditions, the mutant is purple in all tissues and organs, leaves, stems, leaf stalks, flower organs and the like in the whole growth period from the beginning of seed germination to the death of the plant (figure 1, the wild whole plant is green leaves, sepals and white petals; the purple mutant HS2 plant is purple in the whole plant, dark purple leaves and internal infrared purple in petals), is stably inherited, and the anthocyanin content in the leaves of the whole plant is remarkably accumulated.

2. New colored cotton bred by hybridization of purple mutant HS2 and conventional colored cotton

Purple mutant HS2 and color cotton varieties or strains (green cotton No.1, brown cotton No. 1-61 deep, brown cotton No. 1-52 shallow, new color No.5, new color No.7, and the like) are planted in the middle and the last days of 7 months under normal growth conditions for hybridization, purple mutant HS2 is used as a male parent to pollinate the color cotton varieties respectively, and cotton bolls and seeds are harvested by bagging. At least 50 hybrids were made per line. Bagging and selfing natural color cotton parents, and reserving seeds.

(1) Hybrid combination F1 phenotype

The combination of purple mutant HS2 and different hybrids of colored cotton varieties (Green catkin No.1 (LX1), Brown catkin No.1 (ZX1), Brown catkin No. 1-61 deep (ZX1-61), Brown catkin No. 1-52 shallow (ZX1-52), New color No.5 (XC5) and New color No.7 (XC7)) is F ₁ Will F ₁ Seed, bagging and selfing to obtain F ₂ Observation F ₂ Character segregation ratio. Hybrid plants of generation F1 of different hybridization combinations are consistent with the phenotype of the parental purple mutant HS2, the whole growth period is purple from the emergence of seedlings, the color cotton parent is a green plant (figure 2, leaves and hypocotyls show purple, purple and green phenotypes), and the purple character appears typical dominant inheritance.

(2) Anthocyanin content determination of purple mutant HS2 and different-strain colored cotton hybrid combination

The content of anthocyanins is generally measured by pH differential measurement (Giusti et al, 2001). In the experiment, the content of anthocyanin in cotton leaf slices is measured by using an Uliaceae 2102c ultraviolet spectrophotometer, and the diameter of an experimental cuvette is 1 cm. Before the experiment is started, samples are diluted by 0.4M KC1-HC1 buffer solution (pH4.5) according to the volume ratio of 1:10, 1:50, 1:100, 1:500 and 1: 1000 to ensure that the absorbance of anthocyanin is in the linear measurement range of an ultraviolet spectrophotometer. By ddH ₂ Adjusting the O to zero, and respectively measuring the absorbance values of 530nm, 620nm and 650 nm.

The calculation formula is as follows:

(OD lambda) of anthocyanin optical density value (OD) ₅₃₀ -OD ₆₂₀ )-0.1(OD ₆₅₀ -OD ₆₂₀ )

The anthocyanin content calculation formula is as follows: the anthocyanin content (nmol/g) ═ OD lambda/epsilon x V/m x 10^6

In the formula: OD lambda is the optical density of the anthocyanin at the wavelength of 530 nm; epsilon is anthocyanin molar extinction coefficient of 4.62 multiplied by 10^ 6; v is the total volume (mL) of the extracting solution, and m is the sampling mass (g); 10^6 is a multiple of conversion of the calculation result into nmol.

Note: the absorption peak wavelength of the anthocyanin acid solution is 530 nm; the peak wavelength of the absorption of soluble sugar is 620 nm; the absorption peak wavelength of chlorophyll is 650 nm.

Analyzing the content difference of anthocyanin among different plant leaves with different hybrid combinations and different characters, respectively extracting anthocyanin in young leaves of the hybrid combination No.1 green wadding and the hybrid combination No.1 brown wadding which have character separation, dividing the young leaves into purple, purple and green according to the shade of color in the same combination, and extracting the anthocyanin. The difference in anthocyanin content of cotton leaves subjected to trait segregation was determined by uv spectrophotometry (fig. 3, 4). Purple mutant HS2 and Green Flock No.1 hybrid combination, found in F ₂ Under the condition of occurrence of purple character separation, the content of anthocyanin in the No.1, No.4 and No.7 strains or combinations in the content measurement is obviously higher than that of the No.2, No.3, No.5, No.6 and No. 8 combinations, which indicates that the content of anthocyanin in the hybrid combined leaves of the purple mutant HS2 and the No.1 colored cotton green wadding is higher than that of anthocyanin in the wild type C312 and the No.1 colored cotton parent green wadding, and F ₂ Trait segregation leads to enhanced anthocyanin accumulation in purple-trait plants (figure 3).

Purple mutant HS2 and brown catkin No.1 hybrid combination F ₂ The very obvious trait segregation phenotype also appears, anthocyanin in leaves with different phenotypes is respectively extracted, and the difference of the trait segregation-occurring cotton leaves in anthocyanin content is measured by an ultraviolet spectrophotometry (figure 3). The data of the comparative experiment show that the content of the C312 anthocyanin in the upland cotton is the lowest, and the phenotype is green correspondingly. The anthocyanin content of HS2 Xbrown catkin No.1 purple plant with separated characters is highest, which indicates that the green catkin No.1 hybrid combination is F ₂ Character separation occurs, and the purple character is enhanced. Description in the Brown Flock No.1 hybrid combination F ₂ The key gene for regulating the anabolism and transport accumulation of anthocyanin is over-expressed. The color of the leaf with character separation is observed to be consistent with the measured content of anthocyanin.

(3) Application of purple mutant in improving fiber color and luster

Through comparison of cotton bolls of different strains of plants in the same hybridization combination, the cotton fiber color of the hybridization strain is deeper than that of the purple mutant HS2 and the color cotton parent cotton fiber in the same hybridization combination, and simultaneously, the yield and the fiber length of the cotton fiber are better than those of the color cotton parent. This phenomenon appears in a plurality of hybridization combinations of the group of experiments, which indicates that the excessive anthocyanin accumulated in the leaves by the purple mutant HS2 is partially transferred to the cotton fibers, and the color and quality of the cotton fibers can be effectively improved by the hybridization of the purple mutant HS2 and the colored cotton parents (figure 5).

The fiber color of the HS2 multiplied by the progeny strain of the brown wadding No.1 is obviously deepened compared with the fiber color of the selfing of the brown wadding No.1, and the quality is obviously improved, regardless of the length of the fiber or the density of the fiber. Different hybridization combinations show the same phenomenon, in different hybridization combinations, the color of the hybrid seeds has different differences, but the homogeneous phase has obvious color improvement and quality improvement compared with the parent phase. By comparing the difference between different hybrid combination strains of different varieties, cotton hybrid strains with excellent quality and stable heredity and various fiber colors can be screened out from F2 generation segregation population (figures 6 and 7), and a series of dark brown, green, dark green and dark green color cotton new hybrid combinations are respectively bred. The cotton purple mutant HS2 is hybridized with brown cotton (brown cotton No.1, new color No.5, new color 7586, brown cotton No. 1-52 light, brown cotton No. 1-61 dark, etc.), and colored cotton with dark brown, orange, etc. colored fibers can be obtained; the cotton purple mutant HS2 is hybridized with green fiber colored cotton (green cotton No.1, new color No.5, new color No.7, and the like) to obtain the colored cotton with brown, dark green, and other colored fibers.

The fiber (15-18DPA) anthocyanins of the progeny lines of brown catkin No.1 and HS2 Xbrown catkin No.1 were extracted by acidified methanol method for LC/MS analysis. In order to analyze the difference of anthocyanin components of colored cotton fibers, an LC/MS chromatographic analysis result is obtained by a detection instrument Agilent 6460Triple Quad LC/MS, and the LC/MS chromatographic analysis result shows that the anthocyanin components in the hybrid progeny fibers of the purple mutant HS2 are greatly changed relative to the parent colored cotton parent brown cotton 1 number, new components are newly appeared, the nuclear-to-mass ratios of the components are 117.0, 158.0, 434.2 and the like respectively (figure 8), and the purple mutant HS2 is also shown to be used as a parent to be hybridized with different colored cotton varieties/lines, so that the composition of the anthocyanin in a fiber cavity can be changed, and thus new colors are formed.

Example 2 interference of GhCHS, GhANR, GhLAR genes respectively by RNAi results in color change of colored fiber

Cloning full-length genes GhCHS, GhANR and GhLAR, selecting specific sequence fragments of the genes GhCHS (the nucleotide sequence is shown in SEQ ID NO. 5), GhANR (the nucleotide sequence is shown in SEQ ID NO. 6) and GhLAR (the nucleotide sequence is shown in SEQ ID NO. 7), constructing interference expression vectors of the genes GhCHS, GhANR and GhLAR, and electrically transforming agrobacterium GV3101 by a cotyledon permeation injection method (the method is referred to Fu et al.

The cDNA sequence of the target gene is found in NCBI, virus interference primers of GhPDS, GhCHS, GhANR and GhLAR are designed by using software Primer Express 5.0 software, enzyme cutting sites and protective bases of SpeI and AscI are respectively added at two ends of the primers, and PCR amplification is carried out (Table 1).

TABLE 1 amplification and detection primer list for target genes

1. The GV3101 strain Agrobacterium containing pCLCrVA, pCLCrVB, target gene reconstruction pCLCrVA-CHS, pCLCrVA-ANR, pCLCrVA-LAR and pCLCrVA-PDS is activated in the afternoon of the same day respectively, and specifically comprises: mu.L of each of the above-mentioned bacterial solutions was added to 10mL of LB liquid medium containing kanamycin (50mg/L) and shake-cultured at 220rpm and 28 ℃ for 24 hours to obtain an activated bacterial solution.

2. And (3) adding 50 mu L of the activated bacterial liquid obtained in the step (1) into 25mL of kanamycin (50mg/L) resistant liquid LB for propagation, and performing shaking table overnight culture at 220rpm and 28 ℃ to obtain bacterial liquid with an OD value of 1.0-1.5.

3. And (3) taking 5mL (OD value is 1.0-1.5) of each bacterial liquid (containing pCLCrVA, reconstructed pCLCrVA-CHS of a target gene, pCLCrVA-ANR, pCLCrVA-LAR and GV3101 strain agrobacterium of pCLCrVA-PDS) in the step (2), taking 25mL of bacterial liquid containing pCLCrVB, centrifuging at the room temperature of 4000rpm for 5min, discarding supernatant, respectively adding an isovolumetric liquid LB culture medium, and sucking suspended bacteria.

4. After standing for 3 hours at room temperature, the mixture is respectively and uniformly mixed with pCLCrVB liquid LB culture medium according to the volume ratio of 1:1 to be used as injection.

5. When the cotton seedling grows to two cotyledons which are completely unfolded and the true leaf is not drawn out (about 10 days), sucking the injection by using an injector, punching holes on the back of the cotyledons (avoiding main leaf veins) for injection until the injection permeates to most of the area of the cotyledons, and culturing the injected plant in a greenhouse under the conditions of 21-23 ℃ and 14h light/10 h dark culture.

The cotton material is upland cotton C312, No.1 brown cotton (ZX1), purple mutant HS2, No.1 brown HS2(ZH) and No.1 HS2 brown cotton (HZ), which are positively and negatively hybridized for F3 generation. The interference experiment is repeated at least 3 times, the interference efficiency is 80% each time, and the phenotype of the transgenic plant and the cotton fiber is relatively stable.

Transgenic cotton with interference of ANR, LAR and CHS genes has similar growth vigor and consistent growth period among plants compared with WT (upland cotton C312) in seedling stage, and has no obvious difference (figure 9). The leaves, stems and bolls of the PDS positive control plants showed obvious white spots. After the transgenic interference plants opened cotton bolls, the cotton fiber color appeared to be obviously different (figure 10).

Repeated experiments show that the brown cotton fiber No.1 (ZX1) interfering with ANR, LAR and CHS genes respectively has different degrees of lightening in color (figures 11 and 12), wherein the ANR color is changed most obviously and is lightest obviously, and secondly, compared with WT, the cotton fiber of the LAR and CHS interference plants also has a lightening phenotype. The ANR, LAR and CHS genes which show the synthesis and transport of anthocyanin in cotton have important functions in an anthocyanin synthesis pathway and are very important for the synthesis, transport and accumulation of cotton fiber pigment.

Example 3 cultivation of Red Cotton Using RNAi interference with the GhOMT1 Gene

(1) The GhOMT1 gene (shown in SEQ ID NO. 1) was inserted into the plant expression vector pBI121-35S-NOS in the forward direction, and expression was initiated using the CaMV35S promoter, thereby constructing a plant expression vector pBI21-35S-GhOMT1-NOS containing the GhOMT1 gene, as shown in FIG. 14.

The GhOMT1 gene fragment (shown in SEQ ID NO. 1) is inserted into a plant interference expression vector pB7GWIWG2(II), and expression is promoted by a CaMV35S promoter, so that the plant interference expression vector pB7GWIWG2(II) -GhOMT1-F-T35S containing the GhOMT1 gene is constructed, as shown in FIG. 15.

The constructed vector is transformed into DH-5 alpha colibacillus competence by a hot shock method, and the process uses LB kanamycin selective culture medium to culture recombinants. Plasmid pB7GWIWG2(II) -GhOMT1 extracted from Escherichia coli DH-5 alpha for transforming GhOMT1 gene is introduced into Agrobacterium LB4404 by electric shock method, and the specific operation steps are as follows: cleaning a 0.1cm electric shock cup with pure alcohol for 2-3 times, drying the electric shock cup on a workbench, cooling the electric shock cup on ice, and unfreezing the electric shock cup on agrobacterium LB4404 competent ice; adding 1-2 μ l plasmid into thawed LB4404, sucking gently, mixing well, and ice-cooling for 5-8 min; transferring the above product into an electric shock cup, adjusting the electric converter to AGR level, and adding 600. mu.l SOC culture medium (20g/L tryptone, 5g/L yeast extract, 5g/L NaCl, 2.5mM KCl, 10mM MgCl) by electric shock ₂ Deionized water, ph7.0), pipetting to mix the broth into the medium thoroughly, and aspirating into a 1.5ml centrifuge tube. Shaking the bacteria for 1h at 28 ℃ and 220 rpm; spreading on a plate of double-antibody screening LB culture medium containing Spec (100mg/L) and Rif (25mg/L), and culturing in a constant temperature incubator at 28 ℃ for 1-2 d; and (4) selecting spots, detecting and shaking bacteria, adding glycerol into the positive clone bacteria liquid, storing at-80 ℃ for infection.

(2) Streaking the positive clone strain of step (1) on double antibody screening LB culture medium (Spec 100mg/L, Rif 25mg/L), dark culturing at 26.5 deg.C for 36-48hr, finishing culturing until enough colony grows out, scraping the colony on the surface of culture medium into MGL culture medium (tryptone 5g/L, sodium chloride 5g/L, MgSO 5G/L) in triangular flask ₄ ·7H ₂ O 0.1g/L，KH ₂ PO ₄ 0.25g/L, mannitol 5g/L, glycine 1.0g/L, deionized water as solvent, pH7.0), shaking at 27 deg.C and 200rpm for 2hr, and OD value of 0.5-1.5. Collecting cotton C312 seedling hypocotyl in sterile triangular flask, pouring activated bacteria liquid into the flask, covering the surface, stirring, standing for 5-10 min, and pouringAnd (3) removing bacteria liquid, sucking residual bacteria liquid by using filter paper, blowing for 5 minutes to slightly dry the surface, dispersing and distributing the bacteria liquid in a thin layer in a co-culture medium (MSB5 culture medium +2, 4-D0.1 mg/L + KT0.1mg/L + glucose 30g/L + phytagel2.5g/L) filled with the filter paper, carrying out dark culture at the temperature of 19-21 ℃ for 36-48 hours, and finishing the co-culture when few colonies which are not obvious appear on the callus surface. The co-cultured hypocotyls were washed with sterile water containing cefamycin (500 mg/L). Transferring the washed hypocotyls to a resistance screening Culture medium (MSB5 Culture medium +2, 4-D0.1 mg/L + KT0.1mg/L + glucose 30g/L + phytogel 2.5g/L + herbicide BASTA75mg/L) to induce callus to embryogenic callus, screening the embryogenic callus with successful transformation, inoculating different callus pieces with differentiation growth to a secondary Culture medium (MSB5 Culture medium + IBA0.5mg/L + KT 0.2mg/L + herbicide BASTA75mg/L), selecting embryogenic callus with successful transformation, culturing to form embryoid, until regeneration plants are induced (refer to Liping Ke, RuiE Liu, Bijue Chou, Xihuanang Yuan, Jie Sun, Jones, GangPan Pan, Xiiang Cheng Hua, Wang Huing, and Yang, and cell filtration, cell Culture, 2012,7(7): e 39974).

In the transgenic line interfered by the GhOMT1 gene, the expression level of the GhOMT1 gene is extremely reduced (figure 16), and in the growth period of the transgenic plant, the plant stems, branches and leaf stalks are red from the seedling stage, and the leaf margin is red, so the inheritance is stable; at the flowering stage, the calyx, flower buds and petals were all red (FIG. 17). The interference strain has stable phenotype heredity and can be well applied to hybrid seedling stage selection of hybrid breeding.

Example 4 knock-out GhOMT1 gene by CRISPR-Cas9 technology to cultivate red and purple cotton

1. CRISPR/Cas9 system gene knockout vector of cotton GhOMT1 gene

1) In order to obtain the target gene GhOMT1 sequence 18-23bp guideeRNA, firstly, the only restriction conditions for determining the target site according to the CRISPR/Cas9 system are the PAM site at the 3' end and the gRNA sequence 18-22bp at the front end of the PAM. A23 bp site was sought and the standard recognition site format was GN19NGG, which is a PAM sequence required for protein binding to the genome, and which need not be present on the constructed vector, but which need only be placed 20bp of GN19 in front of the NGG. The first G of GN19 is the initiation signal required for transcription of small RNAs.

GuideRNA (gttccttttagtaaggcata) of the target gene GhOMT1 sequence, and upstream and downstream primers (5 '-GATTGN 19-3', 3 '-CN 19 CAAA-5') were synthesized so that they could form small fragments with linkers after annealing.

AtU6-26SK+：

5’-GATTGN19-3’：5’-GATTGttccttttagtaaggcata-3’；

3’-CN19CAAA-5’：3’-CaaggaaaatcattccgtatCAAA-5’。

The upstream and downstream primers were diluted to 10M with water, 10ul of each primer was blown and mixed well, and the mixture was programmed in a PCR apparatus (95 ℃ for 3min, 22 ℃ C.)

1min, ramrate 0.1 ℃/s, Hold at 22 ℃), and slowly cooled to obtain double-stranded guideRNA with BbsI cohesive ends.

2) AtU6-26SK + vector BbsI enzyme digestion reaction

AtU6-26SK + vector BbsI enzyme digestion system

The enzyme is NEB BbsI and the corresponding enzyme digestion buffer, and the temperature of the enzyme digestion buffer is 37 ℃ and the enzyme digestion buffer is subjected to thermostatic water bath for 8-12 h.

3) And (3) recovering an enzyme digestion product:

and (3) carrying out 30ul enzyme digestion system agarose gel electrophoresis, separating target bands, irradiating the bands dug out of the gel by an ultraviolet lamp, storing the bands into a prepared 1.5ml centrifugal tube, weighing and metering. The agarose gel concentration used for recovery was 1.2%. Electrophoresis procedure: the voltage is 100V, 45-50 min. The Queen recovery kit is used for recovering and recovering the target fragment agarose gel, and the concentration is measured by a spectrophotometer and marked as AtU6 BbsI-for later use.

AtU6BbsI-guideRNA ligation:

ligation was carried out overnight at 4 ℃.

4) Cloning and verification of a connecting vector: propagation of Escherichia coli DH5 alpha strain transformed by heat shock at 37 DEG C

Taking out competent cells of Escherichia coli DH5 alpha strain at-80 deg.C, standing on ice for freeze thawing, adding the vector to be transformed into 50ul of competent cells, gently sucking, stirring, standing on ice for 20min, adjusting water bath to 42 deg.C, heat shocking at 4 deg.C for 90s, standing on quick ice for 2min, adding thawed SOC recovery medium (20g/L tryptone, 5g/L yeast extract, 5g/L NaCl, 2.5mM KCl, 10mM MgCl) ₂ Deionized water as solvent, pH7.0), and shaking for resuscitation at 37 deg.C for 1 hr.

5) Resistant plates screening for clones of interest:

coating an ampicillin resistance plate (LB + Spec 100mg/L + Rif 25mg/L) with a heat shock transformation product, carrying out dark culture at 37 ℃ for 12h, selecting a monoclonal, carrying out shake propagation on an LB culture medium for 4-6h, carrying out PCR amplification detection on a vector primer, preliminarily determining a positive clone, sampling, sending to a sequencing company for sequencing inspection, determining a target positive clone, carrying out thallus propagation, and storing at 50% glycerol at-20 ℃. Vector construction guideRNA introduction into the expression vector was done in the first step and is denoted as A + X vector (X stands for different guideRNAs).

AtU6-guideRNA vector positive clone screening PCR amplification system

PCR procedure: 4min at 95 ℃; 30s at 95 ℃; 1min at 57 ℃; 32 cycles; 10min at 72 ℃; storing at 4 ℃.

Since the pCAMBIA1300 vector is required for expression vector construction, the complete expression vector is constructed by taking the pCAMBIA1300 vector as a mediator. The A + X vector constructed in the first step is introduced into a pCAMBIA1300 vector: selecting two proper enzyme cutting sites according to the specific enzyme cutting sites: KpnI and SalI, respectively carrying out the same double enzyme digestion reaction on the pCAMBIA1300 vector and the A + X vector to obtain enzyme digestion products with the same cohesive ends so as to complete the connection reaction of the two vectors.

Firstly, preparing two carrier plasmid DNAs, respectively using LB culture media with corresponding resistance to expand and culture a large number of carrier strains, carrying out small extraction on the Axygene plasmid small extraction kit plasmid, marking the plasmid concentration, simultaneously detecting the plasmid extraction quality by an agarose gel experiment, taking part for later use, and storing the rest at-20 ℃.

A + X vector and pCAMBIA1300 vector KpnI and SalI double enzyme digestion system

And (4) carrying out constant-temperature water bath at 37 ℃ for 1h, and recovering the agarose gel.

The target recovery fragments of the two vectors subjected to double enzyme digestion are respectively as follows: the A + vector is 645bp, and the pCAMBIA1300 is in a linear plasmid size. The target band was scooped up with the aid of an ultraviolet lamp and stored in a prepared 1.5ml centrifuge tube. Also, the agarose gel concentration used for recovery was 1.2%. Electrophoresis procedure: the voltage is 100V, 45-50 min.

And (3) recovering and recovering the agarose gel of the target fragment by using the Queen recovery kit, measuring the concentration by using a spectrophotometer, and respectively marking the product as an A + X vector KpnI SalI double-restriction enzyme product and a pCAMBIA1300 vector KpnI and SalI double-restriction enzyme product for later use.

6) And (3) carrying out ligation reaction on the A + vector KpnI SalI double-enzyme digestion product and the pCAMBIA1300 vector KpnI, SalI double-enzyme digestion product:

a + X vector, pCAMBIA1300 vector KpnI and SalI double-restriction enzyme digestion product connecting system

Ligation was carried out overnight at 4 ℃.

Cloning and verification of a connecting vector: the Escherichia coli DH5 alpha strain was transformed by heat shock at 37 ℃ for propagation.

Taking out competent cells of Escherichia coli DH5 alpha strain from a refrigerator at low temperature of-80 ℃, standing on ice until freezing and thawing, adding a vector to be transformed into 50ul of competence, slightly sucking, uniformly mixing, standing on ice for 20min, adjusting a water bath kettle to 42 ℃ for later use, thermally shocking at 4 ℃ for 90s, standing on ice rapidly for 2min, adding a thawed SOC recovery culture medium, and performing shake recovery culture at 37 ℃ for 1 h.

Resistant plates screening for clones of interest: coating a kana resistant plate with a heat shock transformation product, culturing at 37 ℃ in a dark environment for 12h, selecting a monoclonal antibody, carrying out shake propagation on an LB (Luria Bertani) culture medium for 4-6h, carrying out PCR (polymerase chain reaction) amplification detection on a vector primer, primarily determining a positive clone, sampling, sending to a sequencing company for sequencing inspection, determining a target positive clone, carrying out thallus propagation, and storing at 50% glycerol at-20 ℃. Vector construction the A + X vector was ligated to the pCAMBIA1300 vector and was designated as A + X-1300 vector (X represents different guideRNA).

A + X-1300 vector positive clone screening PCR amplification system

Detecting with carrier specific primer and combined primer respectively, annealing at 57 deg.C and 59 deg.C, and extending for 1min and 2 min.

7) Cas9 protein expression vector and pCAMBIA 1300-AtU 6-vector ligation:

because of the ligation reaction requirement, the double enzyme digestion reaction is carried out on two vectors respectively: KpnI and EcoRI. Preparing two carrier plasmid DNAs, respectively using a kanamycin-resistant LB culture medium to carry out mass propagation culture on carrier strains, carrying out plasmid miniextraction by using an Axygene plasmid miniextraction kit, marking the plasmid concentration, simultaneously detecting the plasmid extraction quality by using an agarose gel experiment, taking a part for later use, and storing the rest at-20 ℃.

A + X-1300 vector and Cas9 vector KpnI, EcoRI double enzyme digestion system

Performing 30ul agarose gel electrophoresis of the enzyme digestion system, separating target bands, irradiating the gel by an ultraviolet lamp to dig out the target bands, wherein the target bands are respectively 5.8k and the linear size of the original carrier, storing the target bands in a prepared 1.5ml centrifuge tube, and similarly, the concentration of the recovered agarose gel is 1.2%. Electrophoresis procedure: the voltage is 100V, 45-50 min.

And (3) recovering and recovering the target fragment agarose gel by using the Queen recovery kit, measuring the concentration by using a spectrophotometer, and respectively marking as an A + X-1300 vector KpnI EcoRI double enzyme digestion product and a Cas9 vector KpnI EcoRI double enzyme digestion product for later use.

8) And (3) carrying out ligation reaction on the A + X-1300 vector KpnI EcoRI double-restriction enzyme product and the Cas9 vector KpnI EcoRI double-restriction enzyme product:

a + X-1300 vector, Cas9 vector KpnI and SalI double-enzyme digestion product connecting system

Ligation was carried out overnight at 4 ℃.

Cloning and verification of a connecting vector: propagation of Escherichia coli DH5 alpha strain transformed by heat shock at 37 DEG C

Taking out competent cells of Escherichia coli DH5 alpha strain at-80 ℃, standing on ice until freezing and thawing, adding a vector to be transformed into 50ul of competent cells, slightly sucking and beating the competent cells uniformly, standing on ice for 20min, adjusting a water bath kettle to 42 ℃ for later use, thermally shocking at 4 ℃ for 90s, standing on quick ice for 2min, adding a thawed SOC recovery culture medium, and performing shake recovery culture at 37 ℃ for 1 h.

Resistant plates screening for clones of interest: and (3) coating the heat shock transformation product on a kanamycin-resistant plate, carrying out dark culture for 12h at 37 ℃, selecting a monoclonal, carrying out shake propagation for 4-6h in an LB (Luria Bertani) culture medium, carrying out PCR (polymerase chain reaction) amplification detection on a vector primer, preliminarily determining a positive clone, and sampling to send to a sequencing company for sequencing inspection.

A + X-1300-C vector positive clone screening PCR amplification system

Determining target positive clone, expanding thallus, and storing at 50% glycerol-20 deg.C. The construction of the vector is completed by connecting the A + X-1300 vector with the Cas9 vector, and is marked as the completion of the construction of the expression vector of the CRISPR/Cas9 of the A + X-1300-C vector (X represents different guideeRNA).

9) And (3) performing ligation reaction on the A + X-1300 vector KpnI EcoRI double enzyme digestion product and the Cas9 vector KpnI EcoRI double enzyme digestion product to determine a target positive clone, performing thallus propagation, and storing at the temperature of 50% glycerol and 20 ℃. Vector construction the A + X-1300 vector was ligated to Cas9 vector, and the construction of CRISPR/Cas9 expression vector was completed as A + X-1300-C vector (X represents different guiderRNA) (FIG. 18).

Genetic transformation of cotton embryogenic callus with CRISPR/Cas9 expression vector

Transferring the CRISPR/Cas9 vector of the GhOMT1 constructed in the step 1 to agrobacterium LB4404 strain for amplification culture, respectively placing the embryonic callus and the expression vector on a basic induction culture medium (MSB5 culture medium +2, 4-D0.1 mg/L + KT0.1 mg/L), and co-culturing for 36-48h at 23 ℃. The embryogenic callus was then washed with sterile water containing cefamycin (500 mg/L). The washed embryogenic callus is transferred to a resistance screening culture medium (MSB5 culture medium, 2, 4-D0.1 mg/L + KT0.1mg/L + glucose 30g/L + phytagel2.5g/L + herbicide BASTA75mg/L) to screen the embryogenic callus which is successfully transformed. And (4) carrying out subculture to pick out the embryogenic callus which is successfully transformed, and culturing to form embryoid until a regeneration plant is induced. During this transformation, the red or purple phenotype is exhibited from callus, embryogenic callus, to somatic embryos and seedlings.

Sequence listing

<110> Sun Yuqiang

<120> cultivation method of colored cotton

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2470

<212> DNA

<213> Unknown (Unknown)

<400> 1

agattaaaaa attaaaaaat tccatgaatt agattaacat tagattcggc cgtttgaaat 60

gcagataagg tctcaaaatt ttggtaaagc gaaacaacca gaaacaggcg ctgagaaaga 120

aaccatgtct caagaagatc aagaggaaga agttgggaaa ctggccgtcc gcctagccaa 180

cgccgtggta cttccaatgg tcttgaaatc agccttggag ctgaacataa ttgacacaat 240

cttagccgct ggtgacggcg cgtttctgtc accttcccag attgcgagtg cccttccttc 300

aaagaatcct gacgcaccag tgctactaga tcgaatgcta cgcctgttgg ccagccattc 360

cattctcaaa tgcgcagtaa aagcaaagga aaaagaagaa attgaaagac tgtacggtgc 420

aggcccacta tgcaagttcc ttgttaagaa tcaagatgga gggtcgattg cacctctcct 480

tttgttgcac catgaccaag tcttcatgca aagctggtac catttaaatg atgctatact 540

agaaggaggg gttcctttta gtaaggcata cgggatgaca gcatttgaat atccaggaac 600

tgatcaacga ttcaatagag tatttaacca ggcaatgtca aatcatactg ctttgataat 660

gaggaagatt gttgatgttt acaaagggtt tgatgggttg aaagtgttgg ttgatgtggg 720

tggtgggatt ggggttgctc tcagttttat tacttcaaag tatcctcaaa tcaagggcat 780

caactttgat ctgcctcatg ttttggctga tgcacccact tattcaggtt ctataccaat 840

cactcccttt tatctcttga acagatttct ctgaaatcta tatgaaatta tgggatactt 900

gttagtccaa tctgatatga gtgtgtgtta atttaaagca ttgccatcgc tgggaaatgc 960

ttttagttgt gctgttttct ctttacatgc cttaacagta agcacttgaa accacaagca 1020

aactagagaa caatatcatt ttctttcttg tttaagtcta tctaattcta tctgctatta 1080

atttatgata aacgaattca tctcaattta tgttctgcag ggtagttggc aaagttgagt 1140

aaacccacat tgctaagaaa tgaacaagtt aaaatattta tacatggtgt tcgtttattg 1200

attttcatgt ctagctcatc taaagaggga gatatatatt tgagatatat atttgaggat 1260

aagcactttg gtttgagttt agtggtgtaa ttattttttt atattataat tattatattc 1320

aggggaaggg aggggcaggg ctctagcctt caaaatggaa aattgctaat ctctcaaaaa 1380

ttataaaatt ttaagttaat atgtggtaaa gttataattt gctccccaaa tgttagaatt 1440

tcaatctaat cctttcaaaa cctatcaaaa tataaacgaa tacagtgata aaattaaatt 1500

ttaactttta tgaaaatata taacttaatt tcaaccactc taaaaaatgt tctaccttta 1560

cacatataat tttaccaaaa gtaattgcat acatgaataa ttacattgcc aaaactgcat 1620

gcatgaataa ttacgttaag gtaatctatt aacagggtta acctttttga aaagatgtga 1680

aataacacat cttttgccga ataaaaagtg tttgttcttg aacagatccc ttttttgtgg 1740

cttataccaa aaaaaaaaaa atacatattg atataccttt tgctactctg ctctattgtt 1800

ttgacttgtt gtatcttaga gggaaactta tagcattaaa gaaagtgatt acgcatcttg 1860

ttctaaattt ttctttctta cctcacatat ttttctaaca atataggtgt tgagcatgtt 1920

ggcggagata tgtttgaaag tgttccaaaa ggtgatgcta ttttcttaaa ggtaagcctt 1980

tatgtcctat agcttggtaa atggagaact ttttttctat tttcttatca taattgatac 2040

atgtagaagt tgtggaatct gtttagctta gtaactttat gaaacttgca gtggatactc 2100

catgattgga gtgatgaaca ttgcttgaag cttctcaaga actgttggga agctctccct 2160

aatggtggga aagtgattat tgtggaatct atcttacccg aggttcccga taccagtgtt 2220

tcttcaaaca ttgtctgtga acaagatctg tttatgttag ctcaaaaccc ggggggcaaa 2280

gagagaaccc taaaggaata tgaggactta gctttaaaaa caggtttctc tgggtgtgaa 2340

gtaatctgct gtgcttataa cagctgggtc atgcaaatgg agaaaagggc aatttattga 2400

agttctattg gaagcttcca tttcctttca tctaccccaa caggaggatt caacataatg 2460

tttacttttt 2470

<210> 2

<211> 1077

<212> DNA

<213> Unknown (Unknown)

<400> 2

atgtctcaag aagatcaaga ggaagaagtt gggaaactgg ccgtccgcct agccaacgcc 60

gtggtacttc caatggtctt gaaatcagcc ttggagctga acataattga cacaatctta 120

gccgctggtg acggcgcgtt tctgtcacct tcccagattg cgagtgccct tccttcaaag 180

aatcctgacg caccagtgct actagatcga atgctacgcc tgttggccag ccattccatt 240

ctcaaatgcg cagtaaaagc aaaggaaaaa gaagaaattg aaagactgta cggtgcaggc 300

ccactatgca agttccttgt taagaatcaa gatggagggt cgattgcacc tctccttttg 360

ttgcaccatg accaagtctt catgcaaagc tggtaccatt taaatgatgc tatactagaa 420

ggaggggttc cttttagtaa ggcatacggg atgacagcat ttgaatatcc aggaactgat 480

caacgattca atagagtatt taaccaggca atgtcaaatc atactgcttt gataatgagg 540

aagattgttg atgtttacaa agggtttgat gggttgaaag tgttggttga tgtgggtggt 600

gggattgggg ttgctctcag ttttattact tcaaagtatc ctcaaatcaa gggcatcaac 660

tttgatctgc ctcatgtttt ggctgatgca cccacttatt caggtgttga gcatgttggc 720

ggagatatgt ttgaaagtgt tccaaaaggt gatgctattt tcttaaagtg gatactccat 780

gattggagtg atgaacattg cttgaagctt ctcaagaact gttgggaagc tctccctaat 840

ggtgggaaag tgattattgt ggaatctatc ttacccgagg ttcccgatac cagtgtttct 900

tcaaacattg tctgtgaaca agatctgttt atgttagctc aaaacccggg gggcaaagag 960

agaaccctaa aggaatatga ggacttagct ttaaaaacag gtttctctgg gtgtgaagta 1020

atctgctgtg cttataacag ctgggtcatg caaatggaga aaagggcaat ttattga 1077

<210> 3

<211> 540

<212> DNA

<213> Unknown (Unknown)

<400> 3

tgttatcctt cggttagcta ttcaacacct agatgactaa aaaaacatca tcttaaatag 60

ttggatgact taattgtaat tttttaaaat taaataacta aaataaaaac ttaaatataa 120

ttaaatgact agtaatataa tttactcttt gaaaaaattt attcaaaaaa agtcaaggag 180

agggcaataa acgattatgg gcacaggtaa agcttttagt gctgcaaata gttgagtgac 240

cgagtatttt aattttggtt aaaattaaat taattgatct aattcagtta atcagttggt 300

taataaattt aagttaaaag attttttaaa attttgatta atgatttatt cggtttaaaa 360

ttaaataatt agttgaactt aataaattat attaatatta tatatattag gctattacta 420

gttctgtaaa ttcggttaat aattaatttt ttaaaaataa ttttaattta attattagtt 480

aaaggattaa aaatttgatt aatactaagt caattagatt aactcctcgt ttgaacaccc 540

<210> 4

<211> 357

<212> PRT

<213> Unknown (Unknown)

<400> 4

Ser Gln Glu Asp Gln Glu Glu Glu Val Gly Lys Leu Ala Val Arg Leu

1 5 10 15

Ala Asn Ala Val Val Leu Pro Met Val Leu Lys Ser Ala Leu Glu Leu

20 25 30

Asn Ile Ile Asp Thr Ile Leu Ala Ala Gly Asp Gly Ala Phe Leu Ser

35 40 45

Pro Ser Gln Ile Ala Ser Ala Leu Pro Ser Lys Asn Pro Asp Ala Pro

50 55 60

Val Leu Leu Asp Arg Met Leu Arg Leu Leu Ala Ser His Ser Ile Leu

65 70 75 80

Lys Cys Ala Val Lys Ala Lys Glu Lys Glu Glu Ile Glu Arg Leu Tyr

85 90 95

Gly Ala Gly Pro Leu Cys Lys Phe Leu Val Lys Asn Gln Asp Gly Gly

100 105 110

Ser Ile Ala Pro Leu Leu Leu Leu His His Asp Gln Val Phe Met Gln

115 120 125

Ser Trp Tyr His Leu Asn Asp Ala Ile Leu Glu Gly Gly Val Pro Phe

130 135 140

Ser Lys Ala Tyr Gly Met Thr Ala Phe Glu Tyr Pro Gly Thr Asp Gln

145 150 155 160

Arg Phe Asn Arg Val Phe Asn Gln Ala Met Ser Asn His Thr Ala Leu

165 170 175

Ile Met Arg Lys Ile Val Asp Val Tyr Lys Gly Phe Asp Gly Leu Lys

180 185 190

Val Leu Val Asp Val Gly Gly Gly Ile Gly Val Ala Leu Ser Phe Ile

195 200 205

Thr Ser Lys Tyr Pro Gln Ile Lys Gly Ile Asn Phe Asp Leu Pro His

210 215 220

Val Leu Ala Asp Ala Pro Thr Tyr Ser Gly Val Glu His Val Gly Gly

225 230 235 240

Asp Met Phe Glu Ser Val Pro Lys Gly Asp Ala Ile Phe Leu Lys Trp

245 250 255

Ile Leu His Asp Trp Ser Asp Glu His Cys Leu Lys Leu Leu Lys Asn

260 265 270

Cys Trp Glu Ala Leu Pro Asn Gly Gly Lys Val Ile Ile Val Glu Ser

275 280 285

Ile Leu Pro Glu Val Pro Asp Thr Ser Val Ser Ser Asn Ile Val Cys

290 295 300

Glu Gln Asp Leu Phe Met Leu Ala Gln Asn Pro Gly Gly Lys Glu Arg

305 310 315 320

Thr Leu Lys Glu Tyr Glu Asp Leu Ala Leu Lys Thr Gly Phe Ser Gly

325 330 335

Cys Glu Val Ile Cys Cys Ala Tyr Asn Ser Trp Val Met Gln Met Glu

340 345 350

Lys Arg Ala Ile Tyr

355

<210> 5

<211> 1170

<212> DNA

<213> Unknown (Unknown)

<400> 5

atggtgaccg tggaagaagt tcgtaaggct caacgtgccc aaggccctgc caccgtgttg 60

gccatcggca catcaacccc gcctaattgt gttgatcaga gcacataccc tgactactat 120

ttccgtatca caaatagtga gcacaaaacc gagttgaaag agaagttcaa gcgcatgtgt 180

gaaaaatcga tgatcaagaa gcgatacatg taccttacag aagagatttt gaaagagaat 240

cccaatgtat gtgaatacat ggctccttca ctggacgcta ggcaagatat ggtggtagtt 300

gaggtgccaa agctaggcaa agaagcagcc accaaggcca ttaaggagtg gggccagccc 360

aagtccaaga tcacccacct tgtcttttgc accactagcg gtgtggacat gcctggggct 420

gactaccagc tcaccaagct tttaggcctc cgcccctccg ttaagcgcct catgatgtac 480

caacaaggtt gcttcgcagg ggggacggtg ctccgagtgg ctaaggactt agctgagaac 540

aacaaaggtg ctcgtgtact tgttgtgtgc tcggagatta ctgctgttac ctttcgtgga 600

cctagtgaca ctcacctaga cagtcttgtg ggccaagcat tgtttggtga tggtgccgca 660

gctgttataa tcggggcaga ccccgtgccc gaaatcgaga agcccatgtt tgaaatagtc 720

tcagtagccc aaacgatctt gccagatagt gatggtgcga ttgatggtca ccttcgtgaa 780

gttgggctta catttcacct tcttaaggat gttccggggc ttatttcgaa gaatatagaa 840

aagagcctgg tagaagcatt tcaaccattg ggcatatccg attggaactc ccttttttgg 900

attgctcatc ctggtggtcc agcaatatta gatcaagtag aagccaaatt agcactgaag 960

ccagagaagc tacgagccac aaggcacgtt ctttcagagt atggtaacat gtcaagtgct 1020

tgtgttctat ttattttgga tgagatgagg aagaaatcaa gggaagatgg gcttcagacc 1080

acaggagaag gattggagtg gggagtgctc tttgggtttg gacctggcct cactgttgag 1140

actgttgtgc tccatagtgt tgctgcttaa 1170

<210> 6

<211> 1011

<212> DNA

<213> Unknown (Unknown)

<400> 6

atggccagcc agatcgtagg aacaaagaaa gcttgtgtcg tgggtggcag cggattcgtt 60

gcgtcattgc tggtcaagtt gttgctcgag aagggttacg ccgttaacac tacagtcagg 120

gaccctgaca accagaagaa gatctctcac cttgtaacac tacaagagtt gggagacttg 180

aaaatctttc aggcggattt aactgatgaa gggagctttg atgcccctat tgctggttgt 240

gaccttgtct tccatgttgc gacacccgtt aactttgctt ctgaagatcc agagaatgac 300

atgatcaaac cagcgaccca aggagtggtg aacgttttga aagcttgtgc caaagcaaaa 360

acagttaaac gtgtcgtctt gacatcatct gccgcagctg tgtctatcaa cacactgaat 420

gggacagatc tggtcatgac agagaaagac tggaccgata tcgagttctt atcatcagca 480

aagccaccaa cttgggggta ccctgcatcc aagacgttgg ctgaaaaggc agcttggaaa 540

tttgctgaag aaaacaacat tgatctcatt acagttatcc cttctctcat gactggtcct 600

tccctcaccc caattgtccc cagcagcata ggccttgcta catctttgat ttcaggcaat 660

gaattcctca taaatgcttt gaaaggaatg cagatgctgt caggttcgat ctctatcaca 720

catgtggaag acgtatgccg agcccatgtt tttctggctg aaaaagaatc tgcatcgggt 780

cgatatatat gcagtgctgt caataccagt gtgccagaac tagctaagtt cctcaacgaa 840

agataccctg acttcaaagt ccctaccgat tttggagatt tcccctccaa acccaagttg 900

atcatttcct cagagaagct tattagcgaa aggttcagct ttaagtatgg gatcgaggaa 960

atctacgacc aaaccgtgga atatttgaag tctaaggggc tgctcaagtg a 1011

<210> 7

<211> 1080

<212> DNA

<213> Unknown (Unknown)

<400> 7

atgaaatcaa cacaaatgaa tggttcatat ccaaatgagt cagaggccgg tcagactgta 60

gttatcggtt caagtgggtt cataggtcgg ttcattaccg aggcctgtct agactcaggc 120

cggccaacgt atatcttagt ccgctctagt tcaaactctc cctccaaagc ttccaccatt 180

aagtttcttc aagacaaagg agccatcgtt atatatggtt ctatcaccga ccaagaattc 240

atggagaaag ttctgagaga atataagata gaagttgtaa tatctgctgt aggaggggag 300

agcatcttgg accagctcag tctaatagag gctattaaga atgtaaacac tgtgaagagg 360

tttgtaccgt cggaatttgg tcatgacata gatagggcga aaccggtgga accggggctg 420

accatgtatg agcaaaagag caagattagg aggcagatag aggaatgcgg gatcccgtac 480

agttacatat gctgcaactc cattgctgct tggccctacc atgacaacac tcatccagca 540

gatgttctac caccccttga taggttccaa atctatggtg atggcgctgt caaagcatac 600

tttgtggcgg gttccgatat tggaaagttc actgtcatgt ccactgatga tgatcgaaca 660

ctaaacaaaa ccgtccattt tcaacctcca agtaacctat taaacatgaa cgaaatggct 720

tcactatggg agacaaagat cggccgcgtg ctgcctaggg taactatcac agaacaagat 780

ctgctccagc gggctcaaga gatgcggatc ccgcagagtg tggttgctgc aataactcat 840

gacattttca taaatggctg tcaaataaac ttcagcttgg acaaaactac tgatgttgaa 900

atctgctctc tctatccgaa cacttcattt cggaccattg cggagtgctt cgacgatttt 960

gccaagaaga tatcagataa tgaaaaagca gtgagcaagc cagtgactgc aagcaacact 1020

gacatttttg tgcccactgc taaaccagaa gcattggcta tcaccgcgat atgcacatga 1080

Claims

1. A method for cultivating colored cotton is characterized in that the method is to inhibit or knock out flavonoid O-methyltransferase geneGhOMT1Expressing;GhOMT1the nucleotide sequence is shown as SEQ ID NO. 1;

inhibition or knock-out of flavonoid O-methyl transferEnzyme genesGhOMT1The expression method is one of the following methods: 1) will be provided withGhOMT1The gene or cDNA is inserted into plant expression vector pBI121-35S-NOS in forward direction, and expression is promoted by CaMV35S promoter to construct a gene containingGhOMT1A plant expression vector pBI21-35S-GhOMT1-NOS of the gene, and a host is transformed by the plant expression vector to obtain a transformant; infecting plants with the transformant to obtain a cotton purple mutant HS 2; 2) will be provided withGhOMT1Inserting the gene segment into a plant interference expression vector pB7GWIWG2(II), starting expression by using a CaMV35S promoter, constructing a plant interference expression vector pB7GWIWG2(II) -GhOMT1-F-T35S containing a GhOMT1 gene, and transforming a host by using the plant expression vector to obtain a transformant; and (3) infecting plants by using the transformant to obtain a cotton purple mutant HS 2.