CN109384837B

CN109384837B - Poplar drought-resistant gene and application thereof

Info

Publication number: CN109384837B
Application number: CN201811523555.9A
Authority: CN
Inventors: 夏新莉; 周扬颜; 刘超; 尹伟伦; 韩潇; 张月
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2018-12-13
Filing date: 2018-12-13
Publication date: 2021-07-13
Anticipated expiration: 2038-12-13
Also published as: CN109384837A

Abstract

The invention discloses a poplar gene, the nucleic acid sequence of which is shown as SEQ ID NO.5, and the protein sequence of which is shown as SEQ ID NO. 6. The invention also discloses a method for preparing transgenic poplar, which comprises the step of transferring the gene sequence shown in SEQ ID NO.5 into poplar by a leaf disc transformation method, wherein the transgenic poplar has drought resistance (a) relative to wild poplar; (b) carbon dioxide assimilation rate; (c) the growth speed; (d) root respiration rate; (e) root water conductivity; (f) the growth of roots, (g) the lignin concentration and structure of roots, etc. are obviously improved.

Description

Poplar drought-resistant gene and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a poplar drought-resistant gene and application thereof.

Background

The forest covers about 30 percent of the total land area of the world, is a main component of the land ecosystem of the earth, is an important renewable natural resource, and has irreplaceable status and function on human life, carbon cycle of the nature and maintenance of ecological balance. Under natural conditions, forest plants are often subjected to many abiotic stresses such as drought, water damage, salt damage, low temperature, high temperature and the like during the growth and development process, and the growth and development of the forest plants, the yield of wood, the quality of the wood and the like are adversely affected. Among them, drought is the most prevalent stress factor in environmental stress. The global drought problem is becoming more serious, and the areas of arid and semi-arid regions are increasing, which has caused adverse effects on the forestry production and ecological environment in the world. The frequency and intensity of drought events are significantly increased under the influence of global warming, and have had a great impact on the health, distribution, structure, composition and ecological diversity of forest ecosystems. According to incomplete statistics, over seventy percent of forest tree species grown over the last 50 years are particularly vulnerable to attack after insufficient water supply. Researchers predict that global drought problems and their impact on forests will be even more severe due to global warming and deforestation of large areas, and most forest ecosystems around the world will face the potential risk of "drought death".

In the long-term evolution and evolution process of forest plants, a set of systems for sensing and transmitting water stress signals are gradually formed, and a series of physiological and developmental mechanisms are formed to deal with water shortage stress in the environment, so that the damage caused by drought is relieved to the maximum extent. The forest is a perennial arbor species with a large trunk and a strong root system, has an extremely complex regulation process for the response and adaptation of drought stress, and comprises a morphological, physiological, biochemical and molecular level multifaceted regulation mechanism. Especially, the strong root system plays an important role in improving the drought resistance of the poplar. In recent years, research on plant response to water stress has made many new discoveries and breakthroughs in gene expression regulation, protein modification and interaction, signal transmission network and the like. Mainly focuses on the regulation and control effects of several large transcription factor gene families such as bZIP, NAC, MYB, WRKY and the like under drought stress, and researches on regulation and control of drought resistance in other transcription factor families are relatively few, particularly the transcription factors for regulating and controlling the growth and development of roots.

Reference to the literature

(1)Jia B,Zhou G,Wang F,et al.Partitioning root and microbial contributions to soil respiration in Leymus chinensis populations[J].Soil Biology&Biochemistry,2006,38(4):653-660.

(2)Sluiter,A.,Hames,B.,Ruiz,R.,Scarlata,C.,Sluiter,J.,Templeton,D.,and Crocker,D.(2008)Determination of structural carbohydrates and lignin in biomass.National Renewable Energy Laboratory,Golden,CO.

(3)Chen T Y,Wang B,Wu Y Y,et al.Structural variations of lignin macromolecule from different growth years of Triploid of Populus tomentosa,Carr[J].International Journal of Biological Macromolecules,2017,101.

(4)Wen,J.-L.；Sun,S.-L.；Xue,B.-L.；Sun,R.-C.Recent advances in characterization of lignin polymer by solution-state nuclear magnetic resonance(NMR)methodology.Materials 2013,6,359-391.

Disclosure of Invention

In order to solve the defects in the prior art, the invention provides a novel poplar drought-resistant gene PdNFY-B21, the growth and development of roots are specifically regulated, and the transgenic poplar can obviously improve the drought resistance of the poplar.

More specifically, the invention provides a poplar protein, and the amino acid sequence of the poplar protein is shown as SEQ ID No. 6.

In a second aspect, the invention provides a poplar gene, wherein the nucleic acid sequence of the gene codes an amino acid sequence shown as SEQ ID NO. 6.

In some embodiments, the nucleic acid sequence of the gene is set forth in SEQ ID No. 5.

In a third aspect of the present invention, there is provided a genetically engineered expression vector, wherein the expression vector comprises the poplar gene according to the second aspect of the present invention, and preferably, the basic vector of the genetically engineered expression vector is PBI121 plasmid.

In a fourth aspect, the invention provides a recombinant agrobacterium comprising the expression vector according to the third aspect of the invention, preferably, the agrobacterium is GV 3101.

In the fifth aspect of the present invention, a method for preparing a transgenic poplar is provided, wherein the method comprises transforming the recombinant agrobacterium of the fourth aspect of the present invention into a poplar to form the transgenic poplar.

In some embodiments, the method comprises the steps of:

(1) bacterial liquid activation: culturing the recombinant agrobacterium solution of the fourth aspect of the invention in YEB liquid containing rifampicin and kanamycin to form a first mixture; centrifuging the first mixture and discarding the supernatant to form a first precipitate; resuspending the first pellet with acetosyringone-supplemented WPM medium to form a second mixture;

(2) infection of agrobacterium: putting tender leaves of the tissue culture seedlings of the sterile poplar into the second mixture for dip dyeing;

(3) co-culturing: sucking liquid components on the impregnated leaves, putting the leaves into a WPM (woody plant medium) co-culture medium, and culturing in dark;

(4) selecting and culturing:

transferring the co-cultured leaves to a WPM selective medium, and culturing under illumination to form resistant adventitious buds;

(5) screening and rooting culture:

and transferring the resistant adventitious bud into a WPM rooting culture medium for culture to form a rooted poplar seedling.

The sixth aspect of the invention provides a PCR primer pair for detecting transgenic poplar, the primer pair comprises a first upstream primer and a first downstream primer,

the first upstream primer sequence is:

5'-AGTGGATTGATGTGATATCTCCACTGA-3', as shown in SEQ ID NO. 9;

the first downstream primer sequence is as follows:

5'-TTATGATAGGGTTGCTAAAAGTTTAGCACTGT-3', as shown in SEQ ID NO. 4.

The seventh aspect of the invention provides a fluorescent PCR primer pair for detecting or monitoring the drought resistance of poplar, the primer pair comprises a second upstream primer and a second downstream primer,

the second upstream primer sequence is as follows:

5'-GATGATTTGCTTTGGGCTATGGCTAC-3', as shown in SEQ ID NO. 1;

the second downstream primer sequence is:

5'-TCCAGTCTTCGCAGATCCCTTGGT-3', as shown in SEQ ID NO. 2.

The eighth aspect of the invention provides a kit for detecting or monitoring drought resistance of poplar, wherein the kit comprises the PCR primer pair according to the seventh aspect of the invention.

In a ninth aspect, the present invention provides a protein according to the first aspect of the present invention, a gene according to the second aspect of the present invention, a genetically engineered expression vector according to the third aspect of the present invention, a recombinant agrobacterium according to the fourth aspect of the present invention, or a method for producing a transgenic poplar according to the fifth aspect of the present invention, for use in improving a poplar trait or improving breeding of the poplar trait, the poplar trait comprising:

(a) drought resistance;

(b) carbon dioxide assimilation rate;

(c) the growth speed;

(d) the respiration rate of the root;

(e) root water conductivity;

(f) growth of roots; (g) the lignin concentration and structure of the roots;

preferably, the poplar is 84K poplar or black poplar NE 19.

Compared with the prior art, the invention has the following advantages:

the invention firstly discovers the drought resistance function of a PdNFY-B21 sequence of a poplar gene at home and abroad, the PdNFY-B21 sequence is a widely existing nuclear transcription factor, previous researches show that the NF-YB transcription factor has an important effect on improving the drought resistance of plants, and no related report exists on the function of improving the drought resistance of forest plants by over-expression in forest plants at present. The experimental result of the invention shows that the expression level of PdNFY-B21 of the transgenic poplar is greatly improved compared with that of a receptor control (a non-transgenic plant), and the drought resistance of the transgenic poplar is enhanced. Therefore, the invention provides that the drought resistance of plants can be enhanced by using the overexpression of PdNFY-B21 so as to be used for drought-resistant variety breeding of forestry, thereby alleviating the damage of drought stress to the yield and quality of the forestry.

Drawings

FIG. 1 is a histogram of tissue-specific expression of PdNFY-B21 gene in Populus nigra NE19, wherein the value is 1 based on the expression level in leaves;

FIG. 2 is a histogram of the expression of the PdNFY-B21 gene under drought stress in root tissue of Populus nigra NE19, wherein the value is 1 on the basis of 0d expression level;

FIG. 3 is a schematic diagram showing the nucleotide sequence of the PdNFY-B21 gene;

FIG. 4 is a schematic representation of the protein amino acid sequence of the PdNFY-B21 gene;

FIG. 5 is a flow diagram of PBI121-35S PdNFYB21 GUS vector construction;

FIG. 6 is a photograph of a PdNFY-B21 gene transgenic plant screen;

FIG. 7 is the electrophoresis picture of the DNA fragment of the transgenic plant of PdNFY-B21 gene;

FIG. 8 is a photograph of PdNFY-B21 gene transgenic plant and wild type leaf GUS staining;

FIG. 9 is a histogram comparing the expression levels of the PdNFY-B21 gene transgenic plant and wild PdNFY-B21 gene, wherein the expression level of TW is taken as a benchmark, and the value is 1;

FIG. 10 is a photograph showing the comparison of wild plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6, #8 drought-resistant effect;

FIG. 11 is a comparison graph of net carbon dioxide assimilation rates of wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6 and #8 under drought stress environment;

FIG. 12 is a stem height control graph of wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6 and #8 under drought stress environment;

FIG. 13 is a histogram comparing the sizes of roots (root length, root diameter and root volume) of wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6 and #8 under drought stress environment (wild type, #6 and #8 from left to right for each cluster), wherein the WT amount is used as a reference and the number is 1;

FIG. 14 is a histogram of root density control between wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6, #8 under drought stress environment;

FIG. 15 is a histogram of root-crown ratio control between wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6, #8 under drought stress environment (each cluster is wild type, #6, #8 from left to right);

FIG. 16 is a histogram of root conductivity control between wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6, #8 under drought stress;

FIG. 17 is a histogram of biomass control in drought stress environment of wild type plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6, #8 (wild type, #6, #8 in each cluster from left to right);

FIG. 18 is a comparison graph of the root respiration rates of wild plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6 and #8 under drought stress;

FIG. 19 is a comparison graph of root water conductivity of wild plants and PdNFY-B21 transgenic plants oxPdNFY-B21#6 and #8 under drought stress environment;

FIG. 20 is a histogram comparing the root lignin content of wild type plants with that of PdNFY-B21 transgenic plants oxPdNFY-B21#6, #8 under drought stress;

FIG. 21 shows the concentration and structure diagram of root lignin of wild type gene plant and transgenic PdNFY-B21 plant oxPdNFY-B21#6 and #8 under water potential of 0.12 MPa.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

The term "transgenic poplar" as used in the present invention means a poplar which contains an introduced gene and can stably enhance the expression of the introduced gene and produce a specific biological trait.

Molecular cloning is generally performed according to conventional conditions such as Sambrook et al: a Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or Draper et al (Blackwell scientific Press, 1988), or conditions as suggested by reference to the instructions for the reagents used.

The poplar drought-resistant transcription factor protein PdNFY-B21 discovered in the invention specifically regulates the growth and development of poplar roots so as to improve the drought resistance of poplar, and no report of any related function exists in poplar so far, and the poplar drought-resistant transcription factor protein PdNFY-B21 is a protein and gene with unknown functions.

The invention aims to provide a drought-resistant gene PdNFY-B21 of poplar (Populus), and the nucleotide sequence and the protein sequence of the gene are shown in figures 3 and 4. The overexpression of the drought-resistant gene PdNFY-B21 of the poplar in 84K poplar shows that the gene can obviously improve the drought resistance of the poplar, the transgenic poplar can normally grow after 40 days of drought stress, the yield of wood is basically not affected, and the guarantee is provided for improving the yield and the quality of the wood under the drought stress.

The invention also aims to provide the application of the poplar drought-resistant gene PdNFY-B21 in drought-resistant breeding of trees, so that the drought tolerance of the trees is improved, and the wood yield and the material quality of the trees are prevented from or are less adversely affected by drought stress.

In order to achieve the above purpose, the invention adopts the following technical measures:

a poplar drought-resistant gene PdNFY-B21 is prepared by the following steps:

a populus nigra NE19[ P.nigra X (P.deltoides X P.nigra) ] drought-resistant gene PdNFY-B21 is obtained: in order to reveal whether the NFY-B family gene can respond to drought stress in poplar, the inventor designs a pair of fluorescent quantitative PCR primers named as PdNFY-B21 gene aiming at populus tomentosa NE19 as shown in SEQ ID No.1 and SEQ ID No.2 according to the PtNFY-B21(Potri.016G085000.1) gene sequence of populus tomentosa, verifies the root-specific expression and the drought stress high expression of the PdNFY-B21 gene in poplar, and further designs two side primers shown as SEQ ID No.3 and SEQ ID No.4 of the gene coding sequence. The CDS sequence of the target gene is obtained by cloning by using the first chain of cDNA of the root of the black poplar NE19 as a template through a PCR technology and is sequenced to obtain the gene sequence of the poplar PdNFY-B21.

An application of a poplar drought-resistant gene PdNFY-B21 in poplar drought-resistant breeding is disclosed, which comprises the following steps:

(1) xba I and Sma I enzymes are used for carrying out double enzyme digestion on the empty vector PBI121 plasmid, primers (shown in SEQ ID NO.7 and SEQ ID NO. 8) with Xba I and Sma I enzyme digestion sites are additionally designed, and a drought-resistant gene PdNFY-B21 of the poplar is constructed on the PBI121 expression vector through PCR reaction and is named as PBI121-PdNF-YB 21.

(2) Transferring the vector PBI121-PdNF-YB21 prepared in the step (1) into agrobacterium tumefaciens GV3101(invitrogen), and then transforming the gene PdNFY-B21 into 84K poplar by an agrobacterium-mediated leaf disc transformation method.

(3) And (4) screening positive plants.

We infect the leaves of the 84K poplar by a leaf disc transformation method, obtain 16 positive plants which are possibly transformed with PdNFY-B21 gene under the screening pressure of kanamycin, and further carry out PCR identification after extracting the DNA of the leaves of the positive plants to find that 9 strains have specific bands with the size of about 600bp, but not non-transgenic strains. GUS staining revealed that the leaves of the 9 lines identified by PCR were all blue. Finally, the 9 plants were confirmed as positive plants with the genes inserted. The expression level of the inserted PdNFY-B21 gene is detected by fluorescent quantitative PCR, and 9 positive strains are different, wherein the expression levels of the oxPdNFY-B21#6 and the oxPdNFY-B21#8 are the highest, so that the two strains are selected as experimental materials in subsequent experiments.

The method for cloning the drought-resistant protein gene PdNFY-B21 is a method commonly adopted in the field. The extraction of poplar leaf DNA is a common molecular biology technology, the method for extracting mRNA also has various mature technologies, a kit (TRIzol Reagent) is commercially available (Invitrogen company), and the construction of a cDNA library is also a common molecular biology technology. The methods of enzyme digestion, ligation, leaf disc transformation and the like used for constructing the vector construction and transfecting genes into poplar are also common techniques in the field. The plasmids referred to therein, transfection media (e.g.Agrobacterium tumefaciens GV3101 and reagent components used such as sucrose, phytohormones, etc.) are commercially available.

Example 1: screening a poplar drought-resistant gene PdNFY-B21:

in recent years, the research of plants responding to drought stress makes many new discoveries and breakthroughs in aspects of gene expression regulation, protein modification and interaction, signal transmission network and the like. Mainly focuses on the regulation and control effects of several large transcription factor gene families such as bZIP, NAC, MYB, WRKY and the like under drought stress, and researches on regulation and control of drought resistance in other transcription factor families are relatively few, particularly the transcription factors for regulating and controlling the growth and development of roots. The poplar drought-resistant transcription factor protein PdNFY-B21 discovered in the invention specifically regulates the growth and development of poplar roots so as to improve the drought resistance of poplar, and no report of any related function exists in poplar so far, and the poplar drought-resistant transcription factor protein PdNFY-B21 is a protein and gene with unknown functions.

Transcription factors play an important role in plant response and regulation of water stress. In order to reveal whether the NFY-B family gene can respond to drought stress in poplar, the inventors of the present application designed a pair of fluorescent quantitative PCR primers named PdNFY-B21 gene for populus nigra NE19 as shown below according to the PtNFY-B21(Potri.016G085000.1) gene sequence of populus trichocarpa. The following two tests were performed.

The sequence of the upstream primer is as follows:

5'-GATGATTTGCTTTGGGCTATGGCTAC-3', as shown in SEQ ID NO. 1;

the sequence of the downstream primer is as follows:

5'-TCCAGTCTTCGCAGATCCCTTGGT-3', as shown in SEQ ID NO. 2.

1. Tissue specificity test

The annual black poplar NE19 stem segments (about 15cm) with consistent growth vigor are inserted into a pot in a skewering manner, 1L of water is watered into the pot every 10 days, after the stem segments grow for 3 months, the stem segments are pulled out of the pot, the soil of roots is washed clean by water, the roots, stems and leaves are taken out and immediately put into liquid nitrogen, and then the liquid nitrogen is put into a refrigerator at the temperature of 80 ℃ below zero for the fluorescent quantitative analysis of the PdNFY-21 gene for later use.

Then, fluorescence quantitative expression analysis is carried out on PdNFY-B21 in roots, stems and leaves by using a primer pair shown in SEQ ID NO.1 and SEQ ID NO.2, and PdNFY-B21 is specifically expressed in the roots, and the result is shown in figure 1.

2. Time-specific assay

In order to eliminate the influence of growth period and growth environment factors on the drought stress effect, five groups of poplar seedlings are taken, added with Hoagland's nutrient solution (without PEG6000) for culture and then added with Hoagland's nutrient solution containing 30% PEG6000(w/v) (Sigma) for culture, and the test is carried out on 20 days in total.

The specific scheme is as follows: the method comprises the steps of inserting annual poplar NE19 stem segments (about 15cm) with consistent growth into a pot, starting the test after growing for 3 months, dividing test poplar seedlings into 5 groups, pulling the poplar seedlings out of the pot, slightly cleaning root soil with water, putting the poplar seedlings into nutrient solution (without PEG6000) added with Hoagland's (Hoagland's) for culturing for 20 days, 15 days, 10 days, 5 days and 0 days, and then putting the poplar seedlings into nutrient solution (Hoagland's) added with 30% PEG6000(w/v) (Sigma) for culturing for 0 day, 5 days, 10 days, 15 days and 20 days. After 20 days, the roots of five groups of poplar seedlings were quickly taken down (PEG6000 simulates drought stress, the first group is equivalent to a control group without drought stress), immediately placed in liquid nitrogen, and then placed in a refrigerator at-80 ℃ for fluorescent quantitative analysis for later use.

The relative expression of PdNFY-B21 was analyzed by quantitative fluorescent expression using primers shown in SEQ ID NO.1 and SEQ ID NO.2, and the results are shown in FIG. 2. As can be seen from FIG. 2, the expression of PdNFY-B21 in PdNFY-B21 is gradually increased in 5-15 days of drought stress treatment, and the expression level of PdNFY-B21 is fallen back after 20 days of drought stress treatment and is still slightly higher than that in the control group without drought stress.

The results shown in FIG. 2 can indicate that PdNFY-B21 is expressed in a drought stress-induced increase to some extent, and the mechanism is used for self-protection of poplar when encountering drought stress. The expression is reduced after the stress exceeds 20 days, which is probably because the experiment detects that the expression of RNA and the expression of protein have time accumulation, at the moment, the accumulation of the protein of PdNFY-B21 has reached the effect of effectively resisting drought, or the signal pathway and/or the metabolic regulation network involved by the protein of PdNFY-B21 has been adapted to the drought stress through mechanisms such as compensation and the like. It is also possible that the damage of drought stress is repaired by the expression of PdNFY-B21 gene.

Based on the above findings, the present invention has been studied in many ways next with respect to the PdNFY-B21 gene.

Example 2: cloning of a poplar drought-resistant gene PdNFY-B21:

searching a hairy poplar gene sequence PtNFY-B21(Potri.016G085000.1) which is homologous with the PdNFY-B21 sequence of the black poplar NE19 according to published hairy poplar genome data, and designing primers at two sides of a gene coding sequence, wherein the primers comprise a forward primer: 5'-ATGGCGGCAGAGGCACCGGC-3' (SEQ ID NO. 3); reverse primer: 5'-TTATGATAGGGTTGCTAAAAGTTTAGCACTGT-3' (SEQ ID NO. 4).

1. Extraction of poplar mRNA

Extraction of RNA (RNA extraction Using TRIZOL TM Kit).

The 100mg of black poplar NE19 root, stem and leaf (weight ratio 1:1:1) mixed sample is ground by liquid nitrogen.

A. Adding 1ml TRIZOL, and standing at room temperature (22-25 deg.C, the same below) for 5 min.

B. 200 μ l of chloroform was added thereto, followed by vigorous shaking for 30 seconds and standing at room temperature for 2 min.

C.13000rpm, centrifugation for 15min, 4 ℃, taking supernatant and transferring to a new tube, adding 500 mul isopropanol, mixing evenly and standing for 15min at room temperature.

D.13000rpm, centrifugating for 15min, removing supernatant at 4 deg.C, adding 1ml of 70% (anhydrous alcohol and H)₂Volume ratio of O) ethanol.

E.7500rpm, centrifugation for 7min, 4 deg.C, removing supernatant, and air drying.

F. Dissolving RNA with DEPC treated deionized water, and storing in a-80 deg.C ultra-low temperature refrigerator.

2. Reverse transcription of the first strand cDNA was performed using the TIANTEN TIANCcript II cDNA kit, and the procedures were performed according to the kit instructions.

3. PCR amplification is carried out by taking cDNA as a template, a PCR amplification product is sequenced to obtain a poplar drought-resistant gene PdNFY-B21 (sequenced by biological engineering (Shanghai) Co., Ltd.), the nucleotide coding sequence is shown as figure 3 (SEQ ID NO.5), and the protein sequence coded by the nucleotide sequence is shown as figure 4(SEQ ID NO. 6).

A50-microliter reaction system for PCR amplification of the poplar gene PdNFY-B21 is as follows:

the reaction time and temperature were as follows:

94℃3min

94℃30s

59℃30s

72℃1min，34cycles

72℃10min

example 3: construction of PdNFY-B21 expression vector and agrobacterium transformation:

the other PCR steps were the same as example 2 except that the PCR primers contained Xba I and Sma I enzymatic cleavage sites, specifically:

a forward primer:

5′-TCTAGAATGGCGGCAGAGGCACCGGC(SEQ ID NO.7)；

reverse primer:

5′-CCCGGGTTATGATAGGGTTGCTAAAAGTTTAGCACTGT-3′(SEQ ID NO.8)。

using sequences shown in SEQ ID NO.7 and SEQ ID NO.8 as primers, carrying out PCR amplification to obtain an amplification product of the poplar drought-resistant gene PdNFY-B21, and carrying out double enzyme digestion on the PCR amplification product and an empty vector PBI121 plasmid (see figure 5) by using Xba I and Sma I enzymes; the poplar drought-resistant gene PdNFY-B21 is constructed on a PBI121 expression vector through DNA ligase ligation reaction to obtain a recombinant vector pBI121-PdNF-YB21, the recombinant vector is transformed into a competent agrobacterium cell GV3101 to obtain a recombinant agrobacterium containing the gene PdNFY-B21 (refer to Sambrook et al, molecular cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), kanamycin screening, and after an insert fragment is identified by a vector primer (35S promoter sequence primer) and a poplar PdNFY-B21 gene downstream primer through PCR, the poplar is transformed by the agrobacterium correctly recombined PdNFY-B21.

Example 4: 84k drought-resistant gene PdNFY-B21 of poplar

Preparation of poplar culture medium

WPM heavy suspension: WPM +30g/L sucrose +100 mol/LAs;

WPM co-medium: WPM +30g/L sucrose + 100. mu. mol/LAs +2.0mg/L6-BA +0.3mg/L NAA +5.5-6.0g/L agar;

WPM selection medium: WPM +30g/L sucrose +100mg/L Kana +2.0mg/L6-BA +0.3mg/L NAA +400mg/L Cef +5.5-6.0g/L agar;

WPM screening rooting culture medium: WPM +30g/L sucrose +150mg/L Kana +0.05mg/L IBA +0.05mg/L NAA +400mg/L Cef +5.5-6.0g/L agar; mixing the components except agar, adjusting pH to 5.80-5.85 with acidimeter, adding agar, and sterilizing with high temperature and high pressure steam at 121 deg.C for 20 min.

Wherein, WPM is: (wood plant medium); as is: acetosyringone; 6-BA is: 6-benzylamino adenine; NAA is: naphthylacetic acid; kana is: kanamycin; cef is cefamycin; IBA is indolebutyric acid.

Second, a transformation step

(1) Bacterial liquid activation: the recombinant agrobacterium containing the gene PdNFY-B21 was removed from a-80 ℃ refrigerator, 200. mu.L of the bacterial liquid was inoculated into 20mL of YEB liquid medium (containing 100mg/L rifampicin +100mg/L kanamycin), and cultured on a shaker at 28 ℃ for 48 h. When the bacterial liquid is golden yellow, 5ml of the bacterial liquid is inoculated into 500ml of YEB liquid culture medium (containing 100mg/L rifampicin and 100mg/L kanamycin), and the bacterial liquid is cultured in a shaking table at 28 ℃ until the bacterial liquid OD is reached₆₀₀0.6 to 0.8. The bacterial solution was centrifuged at 18 ℃ at 12,000 rpm for 2min and the supernatant was discarded. The suspension is resuspended in WPM liquid medium (WPM resuspension) supplemented with acetosyringone (100. mu. mol/L) and then used for transformation.

(2) Infection with Agrobacterium

Selecting young leaves of sterile 84K poplar tissue culture seedlings, and placing the young leaves on a sterile stripCutting into 0.5 × 0.5cm pieces²The small blocks are placed into a bacterial solution which is resuspended in WPM heavy suspension for dip-dyeing for 10-15min, and the small blocks are slowly shaken in the soaking process.

(3) Co-cultivation

And (3) sucking the bacterial liquid on the surface of the impregnated leaf blade by using sterile filter paper, paving the leaf blade back on the WPM co-culture medium, and carrying out dark culture at the temperature of 25 +/-2 ℃ for 2d to form a co-cultured explant.

(4) Selection culture

The co-cultured explants were transferred to WPM selection medium and cultured at 25 ℃ under the illumination of 2000-10000Lux for 2-3 weeks while changing the medium every 10 d.

(5) Screening for rooting culture

When the resistant adventitious bud grows to about 2cm, the bud is cut off and transferred into a WPM rooting culture medium, and the bud grows to root after about 10 days.

See fig. 6.

(6) Transplantation of transgenic 84K poplars

Taking out the seedling when the rooted seedling grows to about 8cm (about 30 days), slightly washing root agar, transplanting the seedling into greenhouse soil for culturing, covering the seedling with a preservative film, artificially simulating natural conditions for illumination (illumination is 16 hours and darkness is 8 hours), and removing the film after 10 days. Greenhouse conditions: the relative humidity is 45 percent, the constant temperature is 20 to 24 ℃, and the illumination period is 8h, dark and 16 h. 9 transgenic strains, designated #1, #2, #3, #4, #5, #6, #8, #12 and #16, were prepared according to the above-described method.

Example 5: identification of transgenic poplar

(1) PCR identification

I. Extraction of wild 84K poplar and transgenic PdNFY-B21 gene 84K poplar total DNA for PCR

The poplar DNA was extracted by the modified CTAB method (Saghaimamoof et al 1984) as follows:

A. taking 0.6g of fresh leaves in a 10ml centrifuge tube, and grinding the fresh leaves into powder in liquid nitrogen; immediately adding 3ml of 1% CTAB and 90 μ l of beta-mercaptoethanol (pre-heated), carrying out water bath at 65 ℃ for 45min (uniformly mixing every 10min for the first 30 min), taking out, and placing at room temperature;

B. chloroform was added in equal volume to CTAB: isoamyl alcohol (V/V is 24:1), and keeping flat for 10min after violent shaking; centrifuging at 16 deg.C and 10000r/min for 10 min; taking the supernatant, placing in another centrifuge tube, and repeating for 8 times;

C. taking 2ml of the supernatant into a 10ml centrifugal tube, adding precooled isopropanol with the same volume, and gently shaking until flocculent precipitates appear; carefully sucking out the flocculent precipitate by using a gun head, putting the flocculent precipitate into a 1.5ml centrifugal tube, and rinsing the flocculent precipitate twice by using a 75% ethanol aqueous solution; rinsing with 100% ethanol once, and drying in a 37 deg.C oven; add 50. mu.l ddH₂O,1 mul RNase, and treating for 1.5h at 37 ℃; storing at-20 deg.C.

II, using the genome DNA of the transgenic PdNFY-B21 gene 84K poplar and non-transgenic plants as a template, designing primers on a 35S promoter sequence and a PdNFY-B21 gene sequence, and carrying out PCR reaction, wherein the size of a target fragment is about 600 bp. Primers were designed as follows:

primer name primer sequences

35S upstream primer 5 'AGTGGATTGATGTGATATCTCCACTGA 3' (SEQ ID NO.9)

PdNFY-B21 downstream primer 5'-TTATGATAGGGTTGCTAAAAGTTTAGCACTGT-3' (SEQ ID NO.4)

The detection results show that the transformed poplar can amplify electrophoresis bands with expected sizes, the electrophoresis bands are consistent with the sizes of the electrophoresis bands of the recombinant plasmid used as the positive, but the negative control non-transgenic plant DNA does not exist, and the result that the transgenic poplar genome already contains the exogenous gene DNA fragment is shown in figure 7.

Wherein M represents DNA markers; PC represents a positive control carrying the plasmid pBI121-PdNF-YB21 (the recombinant plasmid PBI121 in example 3); WT represents wild-type 84K poplar specimen; #1, #2, #3, #4, #5, #6, #8, #12, #16 represent the corresponding transgenic plants, respectively.

(2) GUS staining detection

X-Gluc is a substrate for detecting GUS genes, GUS (beta-glucosidase) can hydrolyze the X-Gluc into a blue substance, and the substance is insoluble in plant cell tissues, so that the GUS active site can display blue, and the rapid detection of plant GUS fusion protein can be realized.

The expression vector constructed in the experiment designs PdNFY-B21 gene and GUS sequence on the vector as fusion protein, so that GUS staining can be used for indirectly reflecting the expression condition of PdNFY-B21 gene of transgenic plant. The specific operation of the experiment was as follows:

preparing a GUS dye solution:

50mM sodium phosphate buffer +10mM Na₂EDTA,0.5mM K₄[Fe(CN)₆]·3H₂O+0.5mM K₃[Fe(CN)₆]0.1% Triton X-100, and 1mg/mLX-Gluc, pH 7.0 (the concentrations refer to the concentration of the respective ingredients in the whole solution).

B. Cutting poplar leaf, putting the cut poplar leaf into a clean tube, adding GUS staining solution to ensure that the poplar leaf is completely immersed in the GUS staining solution, staining for 12 hours at 37 ℃ in the dark, and then decoloring for 20 minutes by using 75% alcohol. And finally, transferring the mixture into a fixing solution (chloral hydrate: water: glycerol; 8:3: 1; w/v/v) for fixing for 2 hours, and then observing and photographing.

GUS staining results show that the leaves of the transgenic poplar appeared blue, while the wild-type poplar material after alcohol decolorization was colorless and transparent, and the results are shown in FIG. 8.

Wherein WT represents a wild type; #1, #2, #3, #4, #5, #6, #8, #12, #16 represent the corresponding transgenic plants, respectively.

(3) Fluorescent quantitative detection

Extracting leaf RNA of the PdNFY-B21 gene 84K poplar and non-transgenic plants, and detecting the expression difference of NFY-B21 genes among strains.

A. Fluorescent quantitative detection of target genes

Fluorescent quantitative primers were designed using primer 5 software according to the coding sequence (SEQ ID NO.5) of the PdNFY-B21 gene sequenced as described in example 2.

Each set of samples was diluted to 100 ng/. mu.l of reverse transcribed cDNA as template. The fluorescent quantitation reaction was performed using the FastFire qPCRPreMix (SYBR Green) kit from the skyngen corporation. A20. mu.l reaction system included:

the fluorescent quantitative PCR reaction conditions are 95 ℃ for 15min, 95 ℃ for 10s, 60 ℃ for 30s and 40 cycles. Repeating the technique of each sample 4 times by using the Actin gene as an internal reference gene and using 2^-ΔΔCTThe results of fluorescence quantification were calculated.

The fluorescent quantitative PCR result shows that the expression levels of PdNFY-B21 of 9 positive strains are different, wherein the expression levels of oxPdNFY-B21#6 and oxPdNFY-B21#8 are the highest, so that the two strains are selected as experimental materials in subsequent experiments. The results are shown in FIG. 9. WT represents a wild type; #1, #2, #3, #4, #5, #6, #8, #12, #16 represent the corresponding transgenic plants, respectively.

Example 6 transgenic poplar Performance testing

Drought resistance experiment of poplar plants

Long term drought treatment conditions

After the tissue culture seedlings are transplanted into soil and cultured for 1 month, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the soil water content is controlled to be-1.82 MPa to be used as a drought environment, and long-term drought treatment is carried out for 40 days. The Water Potential of the soil in the soil pot was measured using the PSYPRO Water functional System (WESCOR, Utah, USA). Watering at 4:00-5:00 in the afternoon every day to maintain the soil water potential at-1.82 MPa (simulating water shortage condition, drought state), and keeping each pot under the corresponding soil water potential condition for 40 days. As can be seen from FIG. 10 (wherein three poplar seedlings represent wild type, #6, #8 in turn from left to right, respectively, and a portion of the plastic pot is reserved to indicate the relative size of the photograph), the wild type 84K poplar leaves mostly begin to yellow after 40 days of drought, while the transformed plants oxPdNFY-B21#6, #8 have developed root systems with no obvious effect. Therefore, the drought resistance of the transgenic poplar is obviously enhanced.

Second, carbon dioxide assimilation test of poplar

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parent strain), oxPdNFY-B21#6 and #8 are respectively taken, the soil Water Potential is controlled to be-1.82 MPa for 40 days, the soil Water Potential is measured by adopting a PSYPRO Water functional System (WESCOR, Utah, USA), carbon dioxide assimilation tests are carried out every 5 days, and the carbon dioxide assimilation rate is measured by adopting a photosynthesis apparatus LI-COR 6400(Lincoln, NE, USA). See figure 11 for the same results.

As can be seen from FIG. 11, the carbon dioxide assimilation rates of oxPdNFY-B21#6 and #8 are almost the same, and both plants are significantly faster than the wild-type parental control plant.

This shows that after the poplar is transferred into PdNFY-B21 gene, the speed of assimilation of carbon dioxide can be increased obviously, which can make the transgenic poplar grow faster and the poplar seedling can grow into wood faster. The transgenic poplar has the advantage of accelerating the growth, and is favorable for reducing the greenhouse effect of carbon dioxide in the atmosphere more quickly.

Third, poplar stem height test

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the soil water potential is controlled to be-1.82 MPa for 40 days, and stem height tests are carried out every 10 days. The results are shown in FIG. 12.

As can be seen from FIG. 12, the difference in stem height between the oxPdNFY-B21#6 and #8 lines is not obvious, and both lines are obviously higher than the wild-type parental control plant. Transgenic poplar was always growing under drought stress conditions for forty days, while wild type growth was retarded at day 10. This indicates that the transgenic poplar can continue to grow under this drought stress environment. This also corresponds to the above-described carbon dioxide assimilation effect. Has the advantages.

Size test of root of poplar

The roots are often located beneath the surface of the earth, absorb water from the soil and dissolve inorganic salts therein, and have the function of supporting, reproducing, and storing synthetic organic matter. Under drought stress, root water uptake and transport play an important role.

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the soil water potential is controlled to be-1.82 MPa for 40 days, and the root size (root length, root diameter and root volume) and the number of roots of each strain are measured after 40 days. See figure 13 (fold of #6, #8 recorded on wild type) and 14 for results.

As can be seen from FIGS. 13 and 14, the size of roots of the oxPdNFY-B21#6 and #8 and the number of roots of each line are almost the same, and both are significantly higher than those of the wild-type parental control plant, indicating that the transgenic line has a larger root system under drought conditions, and therefore the transgenic line can grow normally under drought conditions.

Root-crown ratio test of poplar

The root-cap ratio refers to the ratio of the fresh or dry weight of the underground part to the aerial part of the plant. The size of the drought-resistant gene reflects the relevance of the underground part and the overground part of the plant, and is also an important index for measuring the drought resistance of the plant.

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the soil water potential is controlled to be-1.82 MPa for 40 days, and a root-crown ratio test is carried out every 10 days. The results are shown in FIG. 15.

As can be seen from FIG. 15, the root-crown ratio of the oxPdNFY-B21#6 and #8 is almost not different, and both are significantly higher than that of the wild-type parental control plant, which indicates that the transgenic plant line has a larger root-crown ratio and a larger root-root ratio under drought conditions, so that the transgenic plant line can normally grow under drought conditions.

Sixthly, testing the conductivity of the poplar root

The plasma membrane of a plant is an interface between a living cell and the environment, and the plasma membrane is damaged to different degrees due to the adverse environments such as drought barrier and the like. The most common method for measuring the permeability change of the plasma membrane is to measure the conductivity change of tissue extravasation fluid, and is one of important indexes for measuring the stress resistance of plants.

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the soil water potential is controlled to be-1.82 MPa for 40 days, and a conductivity meter of roots is adopted to measure every 10 days by a DDS-307 (thunder magnetic-DDS-307A, Shanghai). See figure 16 for the same results.

As can be seen from FIG. 16, there was almost no difference in the conductivity of the roots of the two oxPdNFY-B21#6 and #8 lines, both of which were significantly lower than the wild-type parental control plants, indicating that the transgenic lines were affected less by the stress of drought than the control plants under drought conditions.

Test of biomass of Qigong poplar

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the water containing potential of the soil is controlled to be-1.82 MPa, and a biomass test is carried out. The results are shown in FIG. 17.

As can be seen from FIG. 17, there was little difference in biomass between the oxPdNFY-B21#6 and #8 lines, both significantly more than the wild-type parental control plant.

Eighthly, testing the respiration rate of the root system of the poplar

The respiration of the root is closely related to the absorption of mineral elements and the growth and differentiation of the root, and the respiration rate is positively related to anabolism and growth speed.

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, soil water potential is controlled to be-1.82 MPa for 40 days, root respiration rate tests are carried out every 5 days, a photosynthetic apparatus LI-8100A (Lincoln, NE, USA) is adopted to measure the respiration rate of the soil, and the respiration rate of the root system is calculated by an exclusion method (document 1). See figure 18 for the same results.

As can be seen from FIG. 18, there was little difference in the respiration rates of the roots of the two lines oxPdNFY-B21#6, #8, both of which were significantly higher than the wild-type parental control plant.

This shows that after the poplar is transferred into PdNFY-B21 gene, the respiration rate of root can be obviously increased, which will make the transgenic poplar grow faster and have more developed root system, thus improving drought resistance.

Jiu Yangshen root hydraulic conductivity test

The hydraulic conductivity of the root system of the plant determines the biology and the development of the plant to a certain extent, and particularly under the condition of water shortage, the hydraulic conductivity of the root system directly determines the growth state of the plant.

After the tissue culture seedlings are transplanted into soil and cultured for 30 days, a plurality of strains of wild type (parents), oxPdNFY-B21#6 and #8 are respectively taken, the soil water potential is controlled to be-1.82 MPa for 40 days, a root water conductivity determination test is carried out every 5 days, a high pressure water conductivity meter HPFM-Gen3(Dynamax, USA) is adopted to determine the water conductivity of the roots, and the same result is shown in figure 19.

As can be seen from FIG. 19, there was almost no difference in hydraulic conductivity between roots of the oxPdNFY-B21#6 and #8 lines, both of which were significantly higher than the wild-type parental control plant. This shows that after the poplar is transformed into PdNFY-B21 gene, the hydraulic conductivity of root can be obviously improved, which makes the transgenic poplar have more developed root system, thus improving drought resistance.

Ten, testing lignin concentration and structure of poplar root

The test for lignin concentration of roots was performed according to reference (1) and the lignin structure test was performed according to references (2,3,4), with the results shown in FIGS. 20 and 21.

Root growth and development are closely related to the concentration and structure of lignin.

As can be seen from FIG. 20, after the tissue culture seedlings were cultured in the soil for 30 days, the wild type (parent), oxPdNFY-B21#6 and #8 strains were respectively selected, the soil water potential was controlled to-0.12 MPa (sufficient water) for 40 days, and the roots of the poplar were taken to analyze the lignin concentration and structure. As can be seen from FIG. 21, there is almost no difference in the lignin concentration and structure (S/G) between the roots of the oxPdNFY-B21#6 and #8 lines, and the lignin concentration and the lignin S/G ratio are both significantly higher than those of the wild-type parental control plant.

The control test data show that the PdNFY-B21 gene can obviously enhance the drought resistance of poplar and increase the growth rate of poplar.

The control data in the aspects supplement each other, and can show that when poplar is transformed into PdNFY-B21 gene, the poplar can obviously resist drought stress and can grow normally or nearly normally. This is beneficial to improving the planting of poplar in arid area, improving environment, harvesting tree material and slowing down greenhouse effect.

The gene overexpression can obviously improve the drought resistance of poplar, and the root of PdNFY-B21 poplar has higher lignin concentration and lignin S/G ratio compared with the non-transgenic plant under the condition of normal sufficient water. Compared with a plant without transgenosis, the PdNFY-B21 transgenic poplar can normally grow in 40 days of drought stress, the yield and the material of wood are basically not affected, and the transgenic poplar has higher photosynthesis, higher root respiration rate, higher root water conductivity, higher stem growth rate, higher hairy root system, higher root-cap ratio and higher biomass, and provides guarantee for improving the yield of the poplar under the drought stress.

Sequence listing

<110> Beijing university of forestry

<120> poplar drought-resistant gene and application thereof

<130> M1CNCN181008

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatgatttgc tttgggctat ggctac 26

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tccagtcttc gcagatccct tggt 24

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcggcag aggcaccggc 20

<210> 4

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttatgatagg gttgctaaaa gtttagcact gt 32

<210> 5

<211> 546

<212> DNA

<213> Populus tree (Populus)

<400> 5

atggcggcag aggcaccggc gagtccaggg ggaggaagcc atgagagcgg agaccaaagt 60

cctcgctcta attctaatgt acgtgaacaa gacaggttct taccgatcgc aaatatcagt 120

aggattatga agaaagcgct acctgctaat ggaaagattg ctaaggatgc taaagagact 180

gttcaagaat gtgtttctga gttcattagc tttatcacta gcgaagcaag tgataagtgt 240

cagcgagaaa agaggaagac gataaatggt gatgatttgc tttgggctat ggctacgtta 300

gggtttgagg attatattga tcctcttaag atttacctgt ctcgatacag agagatggag 360

ggtgatacca agggatctgc gaagactgga gatacatctg ctaaaaagga tattcaccct 420

ggtccaaatg cgcaggtgaa atggagcttt atgttgctga gttactgcca tttcttattt 480

ttagtcaatc aacgtacctc cttgtcttta ttttacagtg ctaaactttt agcaacccta 540

tcataa 546

<210> 6

<211> 181

<212> PRT

<213> Populus tree (Populus)

<400> 6

Met Ala Ala Glu Ala Pro Ala Ser Pro Gly Gly Gly Ser His Glu Ser

1 5 10 15

Gly Asp Gln Ser Pro Arg Ser Asn Ser Asn Val Arg Glu Gln Asp Arg

20 25 30

Phe Leu Pro Ile Ala Asn Ile Ser Arg Ile Met Lys Lys Ala Leu Pro

35 40 45

Ala Asn Gly Lys Ile Ala Lys Asp Ala Lys Glu Thr Val Gln Glu Cys

50 55 60

Val Ser Glu Phe Ile Ser Phe Ile Thr Ser Glu Ala Ser Asp Lys Cys

65 70 75 80

Gln Arg Glu Lys Arg Lys Thr Ile Asn Gly Asp Asp Leu Leu Trp Ala

85 90 95

Met Ala Thr Leu Gly Phe Glu Asp Tyr Ile Asp Pro Leu Lys Ile Tyr

100 105 110

Leu Ser Arg Tyr Arg Glu Met Glu Gly Asp Thr Lys Gly Ser Ala Lys

115 120 125

Thr Gly Asp Thr Ser Ala Lys Lys Asp Ile His Pro Gly Pro Asn Ala

130 135 140

Gln Val Lys Trp Ser Phe Met Leu Leu Ser Tyr Cys His Phe Leu Phe

145 150 155 160

Leu Val Asn Gln Arg Thr Ser Leu Ser Leu Phe Tyr Ser Ala Lys Leu

165 170 175

Leu Ala Thr Leu Ser

180

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctagaatgg cggcagaggc accggc 26

<210> 8

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cccgggttat gatagggttg ctaaaagttt agcactgt 38

<210> 9

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agtggattga tgtgatatct ccactga 27

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtcctcttcc agccatctc 19

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttcggtcagc aataccagg 19

Claims

1. A method for improving a poplar trait or for improving breeding of said poplar trait, said poplar trait comprising:

(a) drought resistance;

(b) carbon dioxide assimilation rate;

(c) the growth speed;

(d) root respiration rate;

(e) root water conductivity;

(f) growth of roots;

(g) the lignin concentration and structure of the roots;

the poplar is 84K poplar or black poplar NE 19;

the method comprises the steps of transforming recombinant agrobacterium into a poplar to form the transgenic poplar;

the recombinant agrobacterium comprises an expression vector of poplar gene of a nucleic acid sequence of an amino acid sequence shown as SEQ ID NO. 6.

2. The method of claim 1, wherein the method comprises the steps of:

(1) bacterial liquid activation: culturing the bacterial liquid of the recombinant agrobacterium in YEB culture solution containing rifampicin and kanamycin to form a first mixture; centrifuging the first mixture and discarding the supernatant to form a first precipitate; resuspending the first pellet with acetosyringone-supplemented WPM medium to form a second mixture;

(3) co-culturing: sucking liquid components on the impregnated leaves, putting the leaves into a WPM (woody plant medium) co-culture medium, and performing dark culture;

(4) selecting and culturing:

(5) screening and rooting culture:

3. The method of claim 1,

the agrobacterium is GV 3101.

4. The method of claim 1,

the basic vector of the genetic engineering expression vector is PBI121 plasmid.

5. The method of claim 1,

the nucleic acid sequence is shown as SEQ ID NO. 5.