CN103374610A

CN103374610A - CHRNA3 (cholinergic receptor, nicotinic, alpha 3) gene mutation detection specific primers and liquid chip

Info

Publication number: CN103374610A
Application number: CN2012101072046A
Authority: CN
Inventors: 许嘉森; 吴诗扬
Original assignee: Guangzhou Surexam Bio Tech Co Ltd
Current assignee: Guangzhou Surexam Bio Tech Co Ltd
Priority date: 2012-04-12
Filing date: 2012-04-12
Publication date: 2013-10-30

Abstract

The invention discloses a CHRNA3 (cholinergic receptor, nicotinic, alpha 3) gene mutation detection liquid chip and specific primers. The liquid chip mainly comprises each ASPE (allele specific primer extension) primer formed by tag sequences at 5' terminal and specific primer sequences aiming at target gene mutation sites at 3' terminal, microspheres coated by anti-tag sequences as well as amplification primers, wherein the specific primer sequences are SEQ ID NO.11 and SEQ ID NO.12 aiming at C78T sites, SEQ ID NO.13 and SEQ ID NO.14 aiming at A203G sites, SEQ ID NO.15 and SEQ ID NO.16 aiming at A98G sites, SEQ ID NO.17 and SEQ ID NO.18 aiming at A204G sites and/or SEQ ID NO.19 and SEQ ID NO.20 aiming at A124G sites. The liquid chip has the advantages that the coincidence rate of the detection results of the detection liquid chip provided by the invention and a sequencing method is as high as 100%; and parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.

Description

CHRNA3 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Technical field

The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of CHRNA3 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.

Background technology

CHRNA3 (cholinergic receptor, nicotinic, alpha 3, Nicotine acetylcholine receptor 3), CHRNA3 belongs to the member of nicotine receptor gene family, is positioned on No. 15 karyomit(e) 15q23 of human chromosomal, and its acceptor Addictive Behaviors main and Nicotine that is expressed in the brain nucleus is closely related, the acceptor that is distributed in pulmonary epithelial cells then participates in the interior signal conduction of body of Nicotine and tobacco carcinogens NNK, promotes cell proliferation and cancer metastasis.At present, the generation of CHRNA3 transgenation and lung cancer and development have become the study hotspot of Domestic Medicine circle, and the sudden change situation by this gene instructs clinical application will have positive social effect.

At present, the CHRNA3 detection method of gene mutation mainly contains: fluorescent quantitative PCR technique and direct sequencing, this technology exists sensitivity low, the shortcoming that sample easily pollutes, false positive rate is high take the detection of PCR as the basis.Again, more than these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not satisfy the needs of practical application.

The CHRNA3 gene mutation site of target detect of the present invention, it is as shown in the table:

Sequence number	The content of CHRNA3 gene point mutation	Write a Chinese character in simplified form
			1	C → T sudden change occurs in the 78th Nucleotide of SEQ ID NO.49	C78T
2	A → G sudden change occurs in the 203rd Nucleotide of SEQ ID NO.50	A203G
			3	A → G sudden change occurs in the 98th Nucleotide of SEQ ID NO.51	A98G
4	A → G sudden change occurs in the 204th Nucleotide of SEQ ID NO.52	A204G
			5	A → G sudden change occurs in the 124th Nucleotide of SEQ ID NO.53	A124G

SEQ ID NO.49 mutational site: C78T

GTCCTGATCGGCTCTTCCATGAACCTCAAGGACTATTGGGAGAGCGGCGAGTGGGCCATCATCAAAGCC

CCAGGCTA AAACACGACATCAAGTACAACTGCTGCGAGGAGATCTACCCCGACATCACATACTCGCTG

TACATCCGGCGCCTGCCCTTGTTCTACACCATCAACCTCATCATCCCCTGCCTGCTCATCTCCTTCCTC

ACTGTGCTCGTCTTCTACCTGCCCTCCGACTGCGGTGAGAAGGTGACCCTGTGCATTTCTGTCCTCCTC

TCCC

SEQ ID NO.50 mutational site: A203G

GGAGGTCAAGGCTGCAGTGAGCTGTGACTGCGCCACTGTACTCCAGTCTGGGTGATAGAGTGAGACCCC

TGTCTCAAAAAACAAACAAACAAATAAAAAATCCCAAAACCACCAACAAAACAAACAAAAAATACGAAA

CAAACAAAAAATATTCCCCTGATTTCCACAAGTCCCCTTAGTTACTATCTGTCAGGGCCTTTCT AACA

GAAAACTTATACCACATTGGGCTCTAACCACTACTCAATCAGAGGACCAATCACCACTTTGATGACGCT

GTAGCTTCTCCCAGCACCGAAAACACAACCACCTCTAAGGGTGTACTATTGAGGTGCTAAAAAATAATA

ACAACCACATCTACACTTGGAATTATGAACCTGCTCT

SEQ ID NO.51 mutational site: A98G

GTCTCTCCTGGGTCTCGGTTGAGCAGGATCATTACCCATGAAGGCTCAATGCCAAAGCCACTAACTATC

TTTCCTCTGGTTGGCTAGTTTGCCCCCA

TGGTGCCCTGCTGAGTTTATACATTCTTAGCCCCAATTTC

ACTCCCACCATGCCCTTAATTCCCTACGAGTATTCCTGCTCCTGGCTCCAGGAAAAAGGGAGAGGTAGG

AGGGTGGGGTGGAGG

SEQ ID NO.52 mutational site: A204G

ACTGCCAAATCCTATGAATCTGGGATCTCCATGTGACTGAGATCTCCATGTGACTCAAAGTTCACTTTA

ACTTGGGTAATTAAAATAGGACCCAGTCAAATTTTAGGAAGGATTTTCCTGCATAGTTAAAAATCAACT

GATGGAATGGATCAATTCTGAATATGACAGAGCACATGAAATCCCTAAGGTCTTCAAGCAATCTC

TGA

CAATTTTTTAAAATTCACAAAAGTACCACAAGCAAGCATATTTTTCTGTGAGTCTTACTTGCCATATCT

ATAAAACACATATAATGATACCATTTTGAAGCAGATAATCTCACAAGATCTATTCCTGCCCTGAGATTA

ATGACTATTTTAATTTTAAAAATAATATATACATATAGATATATTGACATATTTTAAATATCTGGACAT

AACATACTGACCTAGATAACATACTACCAGTTCTATGAAACCTCCTCTGATCTCTC

SEQ ID NO.53 mutational site: A124G

GTGCCTTGACCTTGGACCTCCCAACCTCCAAAACTGAGAAGTTTCTGTTGTTTATAATCCACCCAGTT

TATGGTGTACTAAGACAGTTATATTAACAATGAATAACTAGGCATGATTTCTCAT

GTATAATTTAGA

AGTATGCAAGAGAAGTAGTTGAAGCTCTCTGAAATGGAGGCATAGCCCTTTAGACCCAGTAAAGAACG

AGAAATGCATGGTAAGAAATGGGTAACGATGGGGGATTGCTGAATTAGTATAAACCTTCAAAGAGATT

ATGGGCTAAATAAGAAAAATTACTGGGAGATCTGTAGTGATAACTGAAT。

Summary of the invention

One of purpose of the present invention provides the CHRNA3 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the mutant of parallel detection CHRNA 3 genes five kinds of common genotype C78T, A203G, A98G, A204G and A124G.

Realize that the above-mentioned purpose technical scheme is as follows:

A kind of CHRNA3 gene mutation detection liquid-phase chip includes:

(A). the wild-type that designs respectively for the different mutational sites of CHRNA3 gene and the ASPE primer of mutant pair: every ASPE primer is comprised of the tag sequence of 5 ' end and 3 ' the end specific primer sequence for the goal gene mutational site, and described specific primer sequence is: for SEQ ID NO.11 and the SEQ ID NO.12 in C78T site; SEQ ID NO.13 and SEQ ID NO.14 for the A203G site, SEQ ID NO.15 and SEQ ID NO.16 for the A98G site, for SEQ ID NO.17 and the SEQ ID NO.18 in A204G site, and/or SEQ ID NO.19 and the SEQ ID NO.20 of ordering for A124G; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.10;

(B). anti-tag sequence microballoon coated, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.21～SEQ ID NO.30, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;

(C). be used for amplifying the primer that needs target sequence detection, that have corresponding mutational site.

Among some embodiment, described amplimer is, for SEQ ID NO.31 and the SEQ ID NO.32 in C78T site therein; SEQ ID NO.33 and SEQ ID NO.34 for the A203G site, SEQ ID NO.35 and SEQ ID NO.36 for the A98G site, for SEQ ID NO.37 and the SEQ ID NO.38 in A204G site, and/or SEQ ID NO.39 and the SEQ ID NO.40 of ordering for A124G.

Among some embodiment, described ASPE primer is therein: described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.11 for the C78T site reaches the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.12; The sequence that is comprised of SEQ ID NO.3 and SEQ ID NO.13 for the A203G site reaches the sequence that is comprised of SEQ ID NO.4 and SEQ ID NO.14, the sequence that is comprised of SEQ ID NO.5 and SEQ ID NO.15 for the A98G site reaches the sequence that is comprised of SEQ ID NO.6 and SEQ ID NO.16, the sequence that is comprised of SEQ ID NO.7 and SEQ ID NO.17 for the A204G site reaches the sequence that is comprised of SEQ ID NO.8 and SEQ ID NO.18, and/or reaches the sequence that is comprised of SEQ ID NO.10 and SEQ ID NO.20 for the sequence that is comprised of SEQ ID NO.9 and SEQ ID NO.19 in A124G site.

Another object of the present invention provides the Auele Specific Primer for the CHRNA3 detection in Gene Mutation.

Realize that the above-mentioned purpose technical scheme is as follows:

Major advantage of the present invention is:

The Auele Specific Primer that is used for the CHRNA3 detection in Gene Mutation is: for SEQ ID NO.11 and the SEQ ID NO.12 in C78T site; SEQ ID NO.13 and SEQ ID NO.14 for the A203G site, SEQ ID NO.15 and SEQ ID NO.16 for the A98G site, for SEQ ID NO.17 and the SEQ ID NO.18 in A204G site, and/or SEQ ID NO.19 and the SEQ ID NO.20 of ordering for A124G.

1. the identical rate of the detected result of CHRNA 3 gene mutation detection liquid-phase chips provided by the present invention and sequencing is up to 100%.And detect the needed time well below sequencing technologies commonly used, realistic especially application needs.Prepared CHRNA3 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and basically there is not cross reaction between designed probe and the anti-tag sequence, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of mutational sites.

2. the present invention has chosen optimum combination by the design experiences of contriver's long-term accumulation and a large amount of experimental implementation from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention's design can sensitive be identified the mutational site of target detect specifically, accurately distinguishes the genotype of various types; In same reaction system, between the different Auele Specific Primers, basically do not have cross reaction between the pcr amplification product of Auele Specific Primer and non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also sudden change situation in a plurality of mutational sites of simultaneously parallel detection, it is consistent to detect effect.

3. detection method step of the present invention is simple, 5 kinds of mutational sites are detected and can be finished 5 amplifications that contain the target sequence in mutational site by a step PCR, many uncertain factors of existing in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.

4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the defective that the repeatability of detected result is poor is improved existing liquid-phase chip technology simultaneously, so that prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value that detects improves greatly, thereby so that the sensitivity that detects is further enhanced, signal to noise ratio strengthens, and detected result more accurately and reliably.

Embodiment

Embodiment 1CHRNA3 gene mutation detection liquid-phase chip mainly includes:

One, ASPE primer

Wild-type and mutant for CHRNA3 gene 5 kinds of common genotype C78T, A203G, A98G, A204G and A124G design respectively specific primer sequence.The ASPE primer is comprised of " tag sequence+specific primer sequence ".The ASPE primer sequence is as shown in the table:

The ASPE primer sequence (tag sequence+specific primer sequence) of table 1CHRNA3 gene

Every the ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on the corresponding microballoon, and 3 ' end is mutant or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.

Two, the coated microballoon of anti-tag sequence

According to designed ASPE Auele Specific Primer fragment, select the tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, corresponding anti-tag sequence is as shown in table 2 on 10 kinds of microballoons numberings of selection and the microballoon:

Corresponding anti-tag sequence on table 2 microballoon numbering and the microballoon

10 kinds of microballoons selecting are coated in the anti-tag sequence on the microballoon available from U.S. Luminex company.Be connected with the spacerarm sequence of 5-10 T between anti-tag sequence and the microballoon, namely add the spacerarm sequence of the preceding paragraph 5-10 T before each anti-tag sequence, the anti-tag sequence is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.With synthetic anti-tag sequence sterilization ddH ₂O is made into the stock solution of 100nmol/ml.Described spacerarm is for being used for anti-tag and microsphere surface is spaced apart or anti-tag is placed the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are such as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process that microballoon is coated with is as follows:

Get respectively 5 * 10 ⁶The carboxylated microballoon of individual above-mentioned numbering (available from Luminex company) is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (available from the Pierce Chemical company) working fluid of preparation 10ng/ml.The EDC working fluid that adds 2.5ul in the microballoon suspension, constant-temperature incubation 30 minutes adds the EDC working fluid of 2.5ul again, and constant-temperature incubation is 30 minutes again.After reaction finished, the Tween-20 washing with 0.02% was once washed once with 0.1% SDS liquid again.The microballoon that is coated with the anti-tag sequence after the washing is resuspended in the Tris-EDTA solution [10mmol/L Tris (pH8.0)] of 100ul, and among the 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.

One, amplifies the primer of the target sequence that contains the mutational site

For CHRNA3 gene 5 kinds of common genotype C78T, A203G, A98G, A204G and A124G, design of amplification primers amplifies 5 target sequences that contain 5 mutational sites to (seeing Table 3).

Table 3 amplifies the primer of the target sequence with mutational site

All primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.

Embodiment 2 uses embodiment 1 described CHRNA3 gene mutation detection liquid-phase chip to the detection of sample

The prescription of described various solution is as follows:

MES damping fluid (pH5.0) prescription (250ml) of 50mM:

2 * Tm hybridization buffer

Be stored in 4 ℃ after the filtration.

The ExoSAP-IT test kit is available from U.S. USB company.

Biotin labeled dCTP is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

One, the DNA extraction of sample:

With reference to " molecular cloning " methods involving about DNA extraction, obtain DNA to be detected.

Two, the pcr amplification of testing sample

Design 5 pairs of primers, one step of multiplex PCR amplifies 5 target sequences that contain respectively CHRNA3 gene 5 kinds of common genotype C78T, A203G, A98G, A204G, A124G, the product size is respectively 280bp, 382bp, 222bp, 470bp, 321bp, and primer sequence (SEQ ID NO.31-40) is seen shown in the above-mentioned table 3.

At first prepare the multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.31-40 in the 1.5ml Eppendorf tube, mix and be the multiple PCR primer working fluid.The multi-PRC reaction system is as follows:

The pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.

Three, the enzyme of PCR product is cut processing

1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ulExo-I enzyme;

2.37 ℃ hatch 15min, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after the processing is directly used in follow-up ASPE primer extension reaction.

Four, site-specific primer extension reaction (ASPE)

Utilize the ASPE primer (table 1) of design among the embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on the reacted product band.

At first prepare the ASPE primer working fluid that mixes: get respectively the corresponding wild-type of gene to be detected and mutant ASPE primer stock solution 10ul in the 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer and mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:

Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.

Five, hybridization

According to the design the ASPE primer, the corresponding 10 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10 ⁵Individual/ml;

2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;

3. microballoon is in 〉=centrifugal the 1-2min of 10000g;

4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, the vortex mixing;

5. get the above-mentioned microballoon suspension of 25ul in the corresponding hole of 96 hole filter plates, control wells adds the ddH of 25ul ₂O;

6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH ₂O complements to 50ul;

7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;

8. the microballoon after the hybridization is in 〉=centrifugal the 2-5min of 3000g;

9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;

10. microballoon is in 〉=centrifugal the 2-5min of 3000g;

11. microballoon is resuspended in 1 * Tm hybridization buffer of 75ul, adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;

12.37 ℃ hatch 15min, on the Luminex instrument, detect.

Six, the result detects and data analysis

The reaction after product detects by Luminex serial analysis instrument.Detected result is shown in table 4, table 5 and table 6.Fluorescent value (MFI) and data processing there are following requirement:

1. each site need have an allelotrope MFI at least greater than 300 and greater than 10 * PCR negative control MFI;

2.NET MFI=sample MFI-PCR negative control MFI (NET MFI less than 0 with 0 the expression);

3. satisfy the data of above two conditions, calculate sudden change ratio by following formula:

Sudden change ratio=mutant NET MFI ÷ (mutant NET MFI+ wild-type NET MFI)

4. rule of thumb to the sudden change ratio definite threshold (cut-off value) of each detection site, to divide wild-type homozygote, heterozygote and mutant homozygote.

Use present method to detect 20 increments CHRNA3 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: the sudden change ratio range is considered as the wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as the anomaly homozygote.Compare with the liquid-phase chip result with the sequencing detection, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments CHRNA3 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.As seen CHRNA3 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of CHRNA3 exactly, and the result is reliable and stable.

One of table 4 pattern detection result (MFI)

Table 5 sample CHRNA3 transgenation ratio (%)

Table 6 sample CHRNA3 gene mutation type analytical results

The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of CHRNA3 gene SNP site

One, the design (selection of Tag sequence and Anti-Tag sequence) of liquid-phase chip preparation

Detect liquid-phase chip as example take CHRNA3 gene C 78T, A203G, A98G and A204G site mutation, respectively for the wild-type of C78T, A203G, A98G and A204G and the specific primer sequence of mutant design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end then is selected from SEQ ID NO.1-SEQ ID NO.10, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing that is coated on the microballoon is selected from SEQ ID NO.21-SEQ ID NO.30.Specific design is shown in following table (table 7).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.

The design of table 7 liquid-phase chip preparation

One, sample detection

Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 21-40 is detected, detected result is as follows:

Table 8 sample CHRNA3 gene C 78T detected result and Polymorphism Analysis

Table 9 sample CHRNA3 Gene A 203G detected result and Polymorphism Analysis

Table 10 sample CHRNA3 Gene A 98G detected result and Polymorphism Analysis

Table 11 sample CHRNA3 Gene A 204G detected result and Polymorphism Analysis

From above-described embodiment as seen, other is for the liquid-phase chip in different mutational sites, and the ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And the ASPE primer is when selecting among the embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to present embodiment test group 1 and, test group 5, test group 9 and test group 11.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and present embodiment, concrete data are omitted.

The selection of embodiment 4CHRNA3 detection in Gene Mutation specific primer sequence

One, the design (selection of wild-type and mutant specific primer sequence) of liquid-phase chip preparation

Pleomorphism site take CHRNA3 Gene A 98G and A124G detects liquid-phase chip as example, take the forward or backwards complementary sequence of this place, mutational site target sequence as template, respectively for the wild-type of A98G and A124G and the specific primer sequence of mutant design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the invention 1, as shown in table 12.Wherein,

Interior base is pleomorphism site.

Table 12 specific primer sequence

Pleomorphism site take CHRNA3 Gene A 98G and A124G detects liquid-phase chip as example, select different specific primer sequences for A98G and A124G, the tag sequence of ASPE primer 5 ' end then is fixed as the best effect sequence among the embodiment 1, and select with it corresponding anti-tag sequence, specific design is shown in following table (table 13).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.

Two of the design of table 13 liquid-phase chip preparation

Two, sample detection

Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 41-60 is detected, detected result is as follows:

Table 14 sample CHRNA3 Gene A 98G detected result and Polymorphism Analysis

Table 15 sample CHRNA3 Gene A 124G detected result and Polymorphism Analysis

By present embodiment as seen, when the ASPE primer was selected among the embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better) was referring to present embodiment test group 13 and test group 16.Other derives from different specific primer sequences and the collocation of tag sequence of the forward or backwards complementary sequence of place, target detect site sequence, with coming to the same thing of embodiment 2 and present embodiment, namely still be that the specific primer sequence described in the embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.

Other is for multiple specific primer sequence and the collocation of tag sequence in different SNP sites, and with coming to the same thing of embodiment 2 and present embodiment, namely embodiment 1 selected Auele Specific Primer has better signal to noise ratio, and it is also better to detect effect, and concrete data are omitted.

The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to claim of the present invention.Should be pointed out that for the person of ordinary skill of the art without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims

1. a CHRNA3 gene mutation detection liquid-phase chip is characterized in that, includes:

2. CHRNA3 gene mutation detection liquid-phase chip according to claim 1 is characterized in that, described amplimer is, for SEQ ID NO.31 and the SEQ ID NO.32 in C78T site; SEQ ID NO.33 and SEQ ID NO.34 for the A203G site, SEQ ID NO.35 and SEQ ID NO.36 for the A98G site, for SEQ ID NO.37 and the SEQ ID NO.38 in A204G site, and/or SEQ ID NO.39 and the SEQ ID NO.40 of ordering for A124G.

3. CHRNA3 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.11 for the C78T site reaches the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.12; The sequence that is comprised of SEQ ID NO.3 and SEQ ID NO.13 for the A203G site reaches the sequence that is comprised of SEQ ID NO.4 and SEQ ID NO.14, the sequence that is comprised of SEQ ID NO.5 and SEQ ID NO.15 for the A98G site reaches the sequence that is comprised of SEQ ID NO.6 and SEQ ID NO.16, the sequence that is comprised of SEQ ID NO.7 and SEQ ID NO.17 for the A204G site reaches the sequence that is comprised of SEQ ID NO.8 and SEQ ID NO.18, and/or reaches the sequence that is comprised of SEQ ID NO.10 and SEQ ID NO.20 for the sequence that is comprised of SEQ ID NO.9 and SEQ ID NO.19 in A124G site.

4. CHRNA3 gene mutation detection liquid-phase chip according to claim 1 is characterized in that,

(A). described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.11 for the C78T site reaches the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.12; The sequence that is comprised of SEQ ID NO.3 and SEQ ID NO.13 for the A203G site reaches the sequence that is comprised of SEQ ID NO.4 and SEQ ID NO.14, the sequence that is comprised of SEQ ID NO.5 and SEQ ID NO.15 for the A98G site reaches the sequence that is comprised of SEQ ID NO.6 and SEQ ID NO.16, the sequence that is comprised of SEQ ID NO.7 and SEQ ID NO.17 for the A204G site reaches the sequence that is comprised of SEQ ID NO.8 and SEQ ID NO.18, and reaches the sequence that is comprised of SEQ ID NO.10 and SEQ ID NO.20 for the sequence that is comprised of SEQ ID NO.9 and SEQ ID NO.19 in A124G site;

(C). described amplimer is: for SEQ ID NO.31 and the SEQ ID NO.32 in C78T site; SEQ ID NO.33 and SEQ ID NO.34 for the A203G site, SEQ ID NO.35 and SEQ ID NO.36 for the A98G site, for SEQ ID NO.37 and the SEQ ID NO.38 in A204G site, and SEQ ID NO.39 and the SEQ ID NO.40 of ordering for A124G.

5. each described CHRNA3 gene mutation detection liquid-phase chip is characterized in that according to claim 1-4, and described spacerarm is 5-10 T.

6. be used for the Auele Specific Primer of CHRNA3 detection in Gene Mutation, it is characterized in that described Auele Specific Primer is: for SEQ ID NO.11 and the SEQ ID NO.12 in C78T site; SEQ ID NO.13 and SEQ ID NO.14 for the A203G site, SEQ ID NO.15 and SEQ ID NO.16 for the A98G site, for SEQ ID NO.17 and the SEQ ID NO.18 in A204G site, and/or SEQ ID NO.19 and the SEQ ID NO.20 of ordering for A124G.