CN102993282A - Insecticidal protein and coding gene and application thereof - Google Patents

Abstract

The invention relates to an insecticidal protein and a coding gene and an application thereof. The insecticidal protein contains a protein (a) formed by an amino acid sequence shown as SEQ ID NO:2, or a protein (b) with insecticidal activity, which is derived from the protein (a), and is formed by replacing and/or deleting and/or adding one or more amino acid in the amino acid sequence of the protein (a), or a protein (c) formed by an amino acid sequence with at least 90% of sequence identity with the SEQ ID NO:2. The insecticidal protein has the advantages of high expression quantity, good stability, and high toxicity to insect pests.

Description

Insect-killing protein, its encoding gene and purposes

Technical field

The present invention relates to a kind of insect-killing protein, its encoding gene and purposes, particularly relate to a kind of PIC6-02 insect-killing protein, its encoding gene and purposes of transformation.

Background technology

Insect pest of the plant is the principal element that causes crop loss, causes great financial loss to the peasant, even has influence on the survival state of local population.In order to prevent and treat insect pest of the plant, people use phosphoramidite chemical sterilant and Biocidal preparation usually, but the two all has limitation in actual applications: chemical insecticide can bring the problem of environmental pollution, and causes the appearance of resistance insect; And the easily degraded in environment of Biocidal preparation needs repetitive administration in production, has greatly increased production cost.

In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientists is found the anti insect gene of encoding insecticidal proteins is changed in the plant through research, can obtain some insect-resistant transgenic plants with the control insect pest of the plant.The PIC6 insecticidal proteins is a kind of in numerous insecticidal proteins, is the companion cell crystalline protein that is produced by bacillus thuringiensis.

PIC6 albumen is taken in by insect and is entered middle intestines, and the toxalbumin parent toxin is dissolved under the alkaline PH environment of insect midgut.Albumen N-and C-end are transformed into active fragments by the basic protein enzymic digestion with parent toxin; Receptors bind on active fragments and the insect midgut epithelial cell membrane upper surface, the insertion goldbeater's skin causes cytolemma the perforation focus to occur, destroys the inside and outside osmotic pressure variation of cytolemma and PH balance etc., upsets the digestive process of insect, finally causes its death.

The annual grain loss that causes because of insect pest of the plant is huge, such as small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm, east armyworm or striped rice borer etc.Do not find at present the expression level of PIC6 insecticidal proteins in plant and the report of virulence.

Summary of the invention

The purpose of this invention is to provide a kind of insect-killing protein, its encoding gene and purposes, described PIC6-02 insecticidal proteins (especially is corn) and has higher expression amount and virulence in plant.

For achieving the above object, the invention provides a kind of insect-killing protein, comprising:

(a) has the protein that the aminoacid sequence shown in the SEQ ID NO:2 forms; Or

(b) aminoacid sequence in (a) is through replacing and/or disappearance and/or the protein of being derived by (a) that adds one or several amino acid and have insecticidal activity; Or

(c) has the protein that the aminoacid sequence of at least 90% sequence identity forms with SEQ ID NO:2.

Further, described insect-killing protein is the protein that has the aminoacid sequence composition of at least 95% sequence identity with SEQ ID NO:2.

Further, described insect-killing protein is the protein that has the aminoacid sequence composition of at least 99% sequence identity with SEQ ID NO:2.

For achieving the above object, the invention provides a kind of killing gene, comprising:

(a) nucleotide sequence of each described insect-killing protein of coding claim 1-3; Or

The nucleotide sequence of the protein that (b) under stringent condition, has insecticidal activity with the nucleotide sequence hybridization that (a) limits and coding; Or

(c) has the nucleotide sequence shown in the SEQ ID NO:1.

Described stringent condition can be the Trisodium Citrate at 6 * SSC(), the 0.5%SDS(sodium lauryl sulphate) in the solution, 65 ℃ of lower hybridization, then use 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.

For achieving the above object, the present invention also provides a kind of expression cassette, is included in the described killing gene under the regulating and controlling sequence regulation and control of effective connection.

For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described killing gene or described expression cassette.

For achieving the above object, the present invention also provides a kind of transformed host biology that comprises described killing gene or described expression cassette, comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

Further, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

For achieving the above object, the present invention also provides a kind of method that produces insect-killing protein, comprising:

Obtain the cell of described transformed host biology;

Under the condition that allows the generation insect-killing protein, cultivate the cell of described transformed host biology;

Reclaim described insect-killing protein.

For achieving the above object, the present invention also provides a kind of method for increasing insect target scope, comprising: the insect-killing protein of described insect-killing protein or described expression cassette coding is expressed with at least a the second desinsection Nucleotide that is different from the insect-killing protein of described insect-killing protein or described expression cassette coding in plant.

Further, can encode Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase of described the second desinsection Nucleotide.

Selectively, described the second desinsection Nucleotide is for suppressing the dsRNA of important gene in the targeted insect insect.

In the present invention, the expression of PIC6-02 insecticidal proteins in a kind of transgenic plant can be accompanied by the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein.This a kind of Pesticidal toxins co expression in same strain transgenic plant that surpasses can comprise plant and expresses required gene and realize by genetic engineering.In addition, a kind of plant (the 1st parent) can be expressed the PIC6-02 insect-killing protein by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.Hybridize the progeny plants that obtains to express all genes of introducing the 1st parent and the 2nd parent by the 1st parent and the 2nd parent.

RNA disturbs (RNA interference, RNAi) to refer to the during evolution phenomenon of the efficient specificity degraded of high conservative, that brought out by double-stranded RNA (double-stranded RNA, dsRNA), homologous mRNA.Therefore can use RNAi technology specific depletion or close the expression of specific gene.

For achieving the above object, the present invention also provides a kind of method that produces zoophobous, comprising: with described killing gene or described expression cassette or described recombinant vectors importing plant.

Preferably, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

For achieving the above object; the present invention also provides a kind of method of avoiding the damage that caused by insect pest for the protection of plant; comprise: described killing gene or described expression cassette or described recombinant vectors are imported plant, plant after the importing is produced enough protect it to avoid the insect-killing protein of insect pest infringement amount.

Preferably, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

With described killing gene or described expression cassette or described recombinant vectors importing plant, in the present invention for foreign DNA is imported vegetable cell, conventional method for transformation includes but not limited to that the DNA that protoplastis, electroporation or silicon whisker mediation are bombarded, directly DNA taken in agriculture bacillus mediated conversion, trace emission imports.

For achieving the above object, the present invention also provides a kind of method of controlling insect pest, comprising: insect pest is contacted with the described insect-killing protein of amount of suppression or the insect repressible protein of being encoded by described killing gene.

Preferably, described insect pest is the lepidopterous insects insect.

The genome of the plant described in the present invention, plant tissue or vegetable cell refers to any genetic material in plant, plant tissue or the vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.

Polynucleotide described in the present invention and/or Nucleotide form complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, can place purpose host's regulating and controlling sequence control lower polynucleotide of the present invention and/or Nucleotide.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand that has produced DNA in plant.Like this, the present invention includes use to polynucleotide and the complementary strand thereof of example in the sequence table.Normal " coding strand " that uses in this area refers to the chain of being combined with antisense strand.For marking protein in vivo, the typical case is transcribed into the complementary strand of a mRNA with the chain of DNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes." justice is arranged " or " coding " chain has a series of codons (codon is three Nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form target protein matter or peptide.The present invention comprises that also the DNA with example has RNA and the PNA(peptide nucleic acid(PNA) of suitable function).

Amplifying nucleic acid molecule of the present invention or its fragment are hybridized with killing gene of the present invention under stringent condition.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of killing gene of the present invention.Nucleic acid molecule or its fragment can be carried out specific hybrid with other nucleic acid molecule under a stable condition.Among the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate completely complementarity, claim that then one of them nucleic acid molecule is another nucleic acid molecule " complement ".Among the present invention, when each Nucleotide and the corresponding Nucleotide of another nucleic acid molecule of a nucleic acid molecule are complementary, then claim these two nucleic acid molecule to demonstrate " complete complementary ".If thereby two nucleic acid molecule can make with enough stable phase mutual crosses them anneal and be bonded to each other under conventional at least " low strict " condition, then claim these two nucleic acid molecule to be " minimum level is complementary ".Similarly, if thereby two nucleic acid molecule can make with enough stable phase mutual crosses them anneal under " highly strict " condition of routine and be bonded to each other, and then claim these two nucleic acid molecule to have " complementarity ".From complete complementary, depart from and to allow, as long as this two molecules of incomplete prevention that depart from form duplex structure.In order to make a nucleic acid molecule as primer or probe, only need guarantee that it has sufficient complementarity in sequence, so that under the specific solvent that adopts and salt concn, can form stable duplex structure.

Among the present invention, the sequence of basic homology is one section nucleic acid molecule, this nucleic acid molecule under the height stringent condition can with the complementary strand generation specific hybrid of another section nucleic acid molecule that is complementary.Promote the stringent condition that is fit to of DNA hybridization, for example, under 45 ℃ of conditions, process with 6.0 * sodium chloride/sodium citrate (SSC) greatly that then wash with 2.0 * SSC, these conditions are known to those skilled in the art under 50 ℃ of conditions.For example, the salt concn in washing step can be selected from about 2.0 * SSC, 50 ℃ of low stringent condition to about 0.2 * SSC of height stringent condition, 50 ℃.In addition, the temperature condition in the washing step can be from the room temperature of low stringent condition about 22 ℃, is elevated to about 65 ℃ of height stringent condition.Temperature condition and salt concn can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 * SSC, 0.5%SDS solution, at 65 ℃ of lower and SEQ ID NO:1 generation specific hybrids, then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, has anti-insect activity and under stringent condition, comprising in the present invention with the sequence of sequence of the present invention 1 hybridization.These sequences and sequence of the present invention be the 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even about at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise the part and/fragment (comprise with full length protein and comparing and/or terminal deletion), variant, mutant, substituent (the amino acid whose protein of substituting is arranged), mosaic and fusion rotein of the insecticidal activity feature of the protein of having preserved described particular example.Described " variant " or " variation " refer to encode same albumen or coding has the nucleotide sequence of the albumen of equal value of insecticidal activity.Described " albumen of equal value " refers to have with the albumen of claim the bioactive albumen of identical or essentially identical anti-lepidopterous insects insect.

" fragment " of the dna molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (sequence that for example is fit to expression of plants) of the original DNA that relates to or protein sequence (Nucleotide or amino acid), comprise and close on fragment and compare inside and/or terminal disappearance with full-length molecule, can there be variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is insect toxins.In some cases (the particularly expression in the plant), it may be favourable using the truncated gene of coding truncated protein matter.Preferred truncated gene 40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98 or 99% of the full length protein of generally encoding.

The identical aminoacid sequence because the Feng Yuxing of genetic codon, multiple different dna sequence dna can encode.Produce the alternative dna sequence dna of these encode identical or essentially identical albumen just in those skilled in the art's state of the art.These different dna sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment that keeps insecticidal activity.

The replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art among the present invention, and preferably this seed amino acid is changed to: little characteristic changing, i.e. and the folding and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, usually about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and for example aminoterminal extends a methionine residues; Little connection peptides, for example about 20-25 residue is long.

The conservative example that replaces is the replacement that occurs in following amino acid group: basic aminoacids (such as arginine, Methionin and Histidine), acidic amino acid (such as L-glutamic acid and aspartic acid), polare Aminosaeren (such as glutamine, l-asparagine), hydrophobic amino acid (such as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (such as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (such as glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually those aminoacid replacement that do not change given activity are well-known in this area, and by, for example, N. Neurath and R. L. Hill are described in " Protein " of new york academic press (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their opposite exchanges.

For a person skilled in the art apparently, this replacement can occur outside the zone that molecular function is played an important role, and still produces active polypeptide.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino-acid residue, can be according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science 244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, detects the anti-insect activity of gained mutating molecule, thus definite amino-acid residue that this molecular activity is overstated and wanted.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as de Vos etc., 1992, Science 255:306-312; Smith etc., 1992, J. Mol. Biol 224:899-904; Wlodaver etc., 1992, FEBS Letters 309:59-64).

Therefore, the aminoacid sequence that has certain homology with the aminoacid sequence shown in the sequence 2 is also included among the present invention.These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%, and be preferred greater than 80% preferably greater than 75%, even preferred greater than 90%, and can be greater than 95%.Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotide of the present invention and protein.For example the sequence with example of the present invention has 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, and leader sequence, intron and other are operably connected to the adjusting sequence of described killing gene.

Described promotor is effable promotor in the plant, and described " effable promotor in the plant " refers to the promotor of guaranteeing that connected encoding sequence is expressed in vegetable cell.Effable promotor can be constitutive promoter in the plant.Instruct the example of the promotor of constitutive expression in the plant to include but not limited to, derive from 35S promoter, the ubi promotor of cauliflower mosaic virus, the promotor of paddy rice GOS2 gene etc.Alternatively, effable promotor can be tissue-specific promotor in the plant, namely this promotor is higher than its hetero-organization (can measure by conventional RNA test) of plant such as the expression level that instructs encoding sequence in chlorenchyma in some tissues of plant, such as PEP carboxylase promotor.Alternatively, effable promotor can be the wound-induced promotor in the plant.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws the wound that causes by insect, be significantly increased under the expression compared with normal growth conditions of the encoding sequence under the promoter regulation.The example of wound-induced promotor includes but not limited to, the promotor of the proteolytic enzyme suppressor gene of potato and tomato (pin I and pin II) and zein enzyme suppressor gene (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast(id), perhaps utilize ' KDEL ' reservation queue target endoplasmic reticulum, perhaps utilize the CTPP target vacuole of barley plants agglutinin gene.

Described leader sequence including but not limited to, the picornavirus leader sequence is such as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); The Potyvirus group leader sequence is such as the MDMV(corn mosaic virus that stunts) leader sequence; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.

Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.

For monocotyledons is used, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledons is used, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the suitable polyadenylation signal sequence that works in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene the polyadenylation signal sequence, derive from proteinase inhibitor II (pin II) gene the polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from alpha-tubulin (the polyadenylation signal sequence of gene of α-tubulin).

" effectively connect " connection of expression nucleotide sequence described in the present invention, described connection is so that a sequence can provide the function that needs concerning the sequence that links to each other.Described " effectively connecting " can be for linking to each other promotor, so that transcribing of this interested sequence is subject to this promotor control and regulation and control with interested sequence in the present invention." effectively connect " expression when interested sequence encoding albumen and when going for this protein expression: promotor links to each other with described sequence, continuous mode so that the transcript that obtains efficiently translate.Merge and during the protein expression wanting to realize to encode, make such connection, so that the first translation initiation codon is the initiator codon of encoding sequence in the transcript that obtains if promotor and being connected of encoding sequence are transcripts.Alternatively, if promotor is when translating the protein expression that merges and want to realize to encode with being connected of encoding sequence, make such connection, so that the first translation initiation codon and the promotor that contain in the 5 ' non-translated sequence be connected, and mode of connection is so that the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding are wanted meets reading frame.Nucleotide sequence that can " effectively connect " includes but not limited to: provide the genetic expression function sequence (be gene expression element, promotor for example, 5 ' untranslated zone, intron, the encoding histone zone, 3 ' untranslated zone, poly-putative adenylylation site and/or transcription terminator), it (is the T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, the site-specific recombinase recognition site, the intergrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the marker function of can scoring is provided, sequence external or the interior assistance of body series of operations (is the polylinker sequence, the locus specificity recombination sequence) and the sequence of copy function is provided (is the replication orgin of bacterium, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is insect, such as, but not limited to, most of lepidoptera pest, such as Pyrausta nubilalis (Hubern)., striped rice borer, bollworm, small cabbage moth or east armyworm etc.

Among the present invention, described insect-killing protein is the PIC6-02 aminoacid sequence, shown in SEQ ID NO:2 in the sequence table.Described killing gene is the PIC6-02 nucleotide sequence, shown in SEQ ID NO:1 in the sequence table.Described killing gene is for being used for plant, the dna sequence dna that transforms of corn particularly, except comprising the coding region by the nucleotide sequence coded protein of PIC6-02, also can comprise other elements, the coding region of the protein of the coding region of the transit peptides of for example encoding, codes selection mark or the protein of conferring herbicide resistance.

PIC6-02 insecticidal proteins most of lepidoptera pests of verifying have toxicity among the present invention.Plant among the present invention, particularly corn contain foreign DNA in its genome, described foreign DNA comprises the PIC6-02 nucleotide sequence, protect it to avoid the threat of insect by this albumen of expression inhibiting amount.Amount of suppression refers to dosage that cause death or semilethal.Simultaneously, plant should be normal on form, and can cultivate to be used for consumption and/or the generation of product under ordinary method.In addition, but this plant basically eliminate to the needs of chemistry or biotic pesticide (described chemistry or biotic pesticide are for the sterilant by the insect of the nucleotide sequence coded protein institute target of PIC6-02).

The expression level of insecticidal crystal protein in the vegetable material (ICP) can detect by described several different methods in this area, for example by using special primer the mRNA of the coded insect-killing protein of organizing interior generation is carried out quantitatively, or the direct amount of the insect-killing protein of specific detection generation.

Can use the insecticidal effect of ICP in the different test determination plants.Targeted insect is mainly lepidoptera pest among the present invention, more specifically is Ostrinia furnacalis, east armyworm or striped rice borer etc.

In addition, the expression cassette that comprises insect-killing protein of the present invention (PIC6-02 aminoacid sequence) can also be expressed with the protein of at least a coding herbicide resistance gene in plant, described herbicide resistance gene includes but not limited to, the glufosinates resistant gene is (such as the bar gene, the pat gene), phenmedipham resistant gene (such as the pmph gene), glyphosate resistance gene (such as the EPSPS gene), bromoxynil (bromoxynil) resistant gene, the sulfonylurea resistant gene, resistant gene to weedicide dalapon, to the resistant gene of cyanamide or the resistant gene of glutamine synthetase inhibitor (such as PPT), thereby obtain both to have had high insecticidal activity, the transgenic plant that have again Herbicid resistant.

The invention provides a kind of insect-killing protein, its encoding gene and purposes, have the following advantages:

1, virulence is strong.The insecticidal toxicity of insect-killing protein PIC6-02 of the present invention is strong, especially for the lepidoptera pest that endangers corn.

2, expression amount is high.Killing gene PIC6-02 of the present invention adopts the preference codon of corn, meets the characteristic of corn gene fully, so that killing gene of the present invention is particularly suitable for expressing in monocotyledons, and corn especially, its expression amount height and good stability.

3, insecticidal spectrum is wide.Insect-killing protein PIC6-02 albumen of the present invention not only shows higher resistance to Ostrinia furnacalis, and reported first insect-killing protein PIC6-02 albumen of the present invention east armyworm and striped rice borer are also had higher activity, therefore have a extensive future plant.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Description of drawings

Fig. 1 is that the recombinant cloning vector DBN01-T that contains the PIC6-02 nucleotide sequence of insect-killing protein of the present invention, its encoding gene and purposes makes up schema;

Fig. 2 is that the recombinant expression vector DBN100159 that contains the PIC6-02 nucleotide sequence of insect-killing protein of the present invention, its encoding gene and purposes makes up schema;

Fig. 3 is that the recombinant expression vector DBN100159N that contains native sequences of insect-killing protein of the present invention, its encoding gene and purposes makes up schema;

Fig. 4 is the mRNA relative content figure of PIC6 insect-killing protein of the transgenic corn plant of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 5 is the pest-resistant design sketch of the transgenic corn plant inoculation Ostrinia furnacalis of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 6 is the pest-resistant design sketch of the transgenic corn plant inoculation striped rice borer of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 7 is the pest-resistant design sketch of the transgenic corn plant inoculation east armyworm of insect-killing protein of the present invention, its encoding gene and purposes.

Embodiment

Further specify the technical scheme of insect-killing protein of the present invention, its encoding gene and purposes below by specific embodiment.

The acquisition of the first embodiment, PIC6-02 gene order and synthetic

1, obtains the PIC6-02 gene order

The aminoacid sequence of PIC6-02 insect-killing protein (699 amino acid) is shown in SEQ ID NO:2 in the sequence table; Obtain coding corresponding to the nucleotide sequence (2100 Nucleotide) of the aminoacid sequence (699 amino acid) of described PIC6-02 insect-killing protein, shown in SEQ ID NO:1 in the sequence table according to corn Preference codon.The codon usage bias of corn can be with reference to http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi species=381124.

2, synthetic above-mentioned PIC6-02 nucleotide sequence

Described PIC6-02 nucleotide sequence (shown in SEQ ID NO:1 in the sequence table) is synthetic by Nanjing Jin Sirui biotechnology company; 5 ' end of synthetic described PIC6-02 nucleotide sequence (SEQ ID NO:1) also is connected with the SpeI restriction enzyme site, and 3 ' end of described PIC6-02 nucleotide sequence (SEQ ID NO:1) also is connected with the SwaI restriction enzyme site.

Simultaneously, synthetic PIC6-02 substituted nucleosides acid sequence (shown in SEQ ID NO:3 in the sequence table), it is that the 693rd Met replaces with Asp in the described PIC6-02 aminoacid sequence (shown in SEQ ID NO:2 in the sequence table); 5 ' end of synthetic described PIC6-02 substituted nucleosides acid sequence (SEQ ID NO:3) also is connected with the SpeI restriction enzyme site, and 3 ' end of described PIC6-02 substituted nucleosides acid sequence (SEQ ID NO:3) also is connected with the SwaI restriction enzyme site.

Simultaneously, synthetic PIC6-02 brachymemma nucleotide sequence (shown in SEQ ID NO:4 in the sequence table), it is the 1st to 660 amino acids of described PIC6-02 aminoacid sequence (shown in SEQ ID NO:2 in the sequence table); 5 ' end of synthetic described PIC6-02 brachymemma nucleotide sequence (SEQ ID NO:4) also is connected with the SpeI restriction enzyme site, and 3 ' end of described PIC6-02 brachymemma nucleotide sequence (SEQ ID NO:4) also is connected with the SwaI restriction enzyme site.

Simultaneously, synthetic PIC6-02 adds nucleotide sequence (shown in SEQ ID NO:5 in the sequence table), and it is to add 3 amino acid Arg, Glu, Asn in the described PIC6-02 aminoacid sequence (shown in SEQ ID NO:2 in the sequence table) after the 699th; 5 ' the end that synthetic described PIC6-02 adds nucleotide sequence (SEQ ID NO:5) also is connected with the SpeI restriction enzyme site, and the 3 ' end that described PIC6-02 adds nucleotide sequence (SEQ ID NO:5) also is connected with the SwaI restriction enzyme site.

The structure of the second embodiment, recombinant expression vector and recombinant expression vector transform Agrobacterium

1, makes up the recombinant cloning vector DBN01-T that contains the PIC6-02 nucleotide sequence

Synthetic PIC6-02 nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN01-T, it makes up flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is the LacZ initiator codon; SP6 is SP6 rna polymerase promoter; T7 is T7 RNA polymerase promoter; PIC6-02 is PIC6-02 nucleotide sequence (SEQ ID NO:1); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T is transformed intestinal bacteria T1 competent cell (Transgen, Beijing, China with the heat shock method; Cat. No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (shaking table shakes under the 100rpm rotating speed), scribble X-gal(5-bromo-4-chloro-3-indoles-β-D-galactoside on the surface) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L transfers pH to 7.5 with NaOH) upper grow overnight.The picking white colony, in LB liquid nutrient medium (NaCl 10g/L, penbritin 100mg/L transfers pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: with bacterium liquid centrifugal 1min under the 12000rpm rotating speed, remove supernatant liquor, the precipitation thalline is with the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precooling, 50mM glucose, pH8.0) suspension; The solution II (0.2M NaOH, 1% SDS(sodium lauryl sulphate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the ice-cold solution III of 150 μ l (4M Potassium ethanoate, 2M acetic acid), abundant mixing is placed 5-10min on ice immediately; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, room temperature is placed 5min behind the mixing; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition abandons supernatant liquor, and precipitation is to dry after 70% the washing with alcohol with mass concentration; Add 30 μ l and contain Rnase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; In 37 ℃ of lower water-bath 30min of temperature, digestion RNA; ℃ save backup in temperature-20.

The plasmid that extracts is after SpeI and SwaI enzyme are cut evaluation, positive colony is carried out sequence verification, the result shows that the described PIC6-02 nucleotides sequence that inserts among the recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in the SEQ ID NO:1 in the sequence table as, and namely the PIC6-02 nucleotide sequence correctly inserts.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC6-02 substituted nucleosides acid sequence is connected on the cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, miPIC6-02 is PIC6-02 substituted nucleosides acid sequence (SEQ ID NO:3).Enzyme is cut with PIC6-02 substituted nucleosides acid sequence described in the sequence verification recombinant cloning vector DBN02-T and is correctly inserted.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC6-02 brachymemma nucleotide sequence is connected on the cloning vector pGEM-T, obtain recombinant cloning vector DBN03-T, wherein, mtPIC6-02 is PIC6-02 brachymemma nucleotide sequence (SEQ ID NO:4).Enzyme is cut with PIC6-02 brachymemma nucleotide sequence described in the sequence verification recombinant cloning vector DBN03-T and is correctly inserted.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC6-02 is added nucleotide sequence to be connected on the cloning vector pGEM-T, obtain recombinant cloning vector DBN04-T, wherein, maPIC6-02 is that PIC6-02 adds nucleotide sequence (SEQ ID NO:5).Enzyme is cut with the interpolation of PIC6-02 described in sequence verification recombinant cloning vector DBN04-T nucleotide sequence and is correctly inserted.

2, make up the recombinant expression vector DBN100159 that contains the PIC6-02 nucleotide sequence

With restriction enzyme SpeI and SwaI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the PIC6-02 nucleotide sequence fragment that downcuts is inserted between the SpeI and SwaI site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, SpeI among the expression vector DBNBC-01 and SwaI restriction enzyme site also are to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100159, it makes up as shown in Figure 2 (Kan: kanamycin gene of flow process; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:6); PIC6-02:PIC6-02 nucleotide sequence (SEQ ID NO:1); Nos: the terminator of rouge alkali synthetase (SEQ ID NO:7); PMI: Phophomannose isomerase gene (SEQ ID NO:8); LB: left margin).

Recombinant expression vector DBN100159 is transformed intestinal bacteria T1 competent cell with the heat shock method, and its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100159), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (shaking table shakes under the 100rpm rotating speed); Then containing LB solid plate (the Tryptones 10g/L of 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L transfers pH to 7.5 with NaOH) upward under 37 ℃ of conditions of temperature, cultivated 12 hours, the picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L transfers pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid that extracts is cut rear evaluation with restriction enzyme SpeI and SwaI enzyme, and with the positive colony evaluation of checking order, the result shows that the nucleotides sequence of recombinant expression vector DBN100159 between SpeI and SwaI site classify nucleotide sequence, i.e. PIC6-02 nucleotide sequence shown in the SEQ ID NO:1 in the sequence table as.

According to the method for above-mentioned structure recombinant expression vector DBN100159, SpeI and SwaI enzyme are cut the described PIC6-02 substituted nucleosides acid sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN02-T downcuts, obtain recombinant expression vector DBN100159-i.Enzyme is cut and sequence verification recombinant expression vector DBN100159-i is described PIC6-02 substituted nucleosides acid sequence between SpeI and SwaI site.

According to the method for above-mentioned structure recombinant expression vector DBN100159, SpeI and SwaI enzyme are cut the described PIC6-02 brachymemma nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN03-T downcuts, obtain recombinant expression vector DBN100159-t.Enzyme is cut and sequence verification recombinant expression vector DBN100159-t is described PIC6-02 brachymemma nucleotide sequence between SpeI and SwaI site.

According to the method for above-mentioned structure recombinant expression vector DBN100159, SpeI and SwaI enzyme are cut the described PIC6-02 interpolation nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN04-T downcuts, obtain recombinant expression vector DBN100159-a.Enzyme is cut and sequence verification recombinant expression vector DBN100159-a is described PIC6-02 interpolation nucleotide sequence between SpeI and SwaI site.

3, make up the recombinant expression vector DBN100159N(positive control that contains native sequences)

Contain the method for the recombinant cloning vector DBN01-T of PIC6-02 nucleotide sequence according to 1 described structure in the second embodiment of the invention, utilize native sequences (SEQ ID NO:9) to make up the recombinant cloning vector DBN01R-T that contains native sequences.Positive colony is carried out sequence verification, and the result shows that the native sequences of inserting among the recombinant cloning vector DBN01R-T is the nucleotide sequence shown in the SEQ ID NO:9 in the sequence table, and namely native sequences is correctly inserted.

The method that contains the recombinant expression vector DBN100159 of PIC6-02 nucleotide sequence according to 2 described structures in the second embodiment of the invention, utilize native sequences to make up the recombinant expression vector DBN100159N that contains native sequences, it makes up flow process as shown in Figure 3 (carrier framework: pCAMBIA2301(CAMBIA mechanism can provide); Kan: kanamycin gene; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:6); MN: native sequences (SEQ ID NO:9); Nos: the terminator of rouge alkali synthetase (SEQ ID NO:7); PMI: Phophomannose isomerase gene (SEQ ID NO:8); LB: left margin).Positive colony is carried out sequence verification, and the result shows that the native sequences of inserting among the recombinant expression vector DBN100159N is the nucleotide sequence shown in the SEQ ID NO:9 in the sequence table, and namely native sequences is correctly inserted.

4, recombinant expression vector transforms Agrobacterium

To oneself through making up correct recombinant expression vector DBN100159, DBN100159-i, DBN100159-t, DBN100159-a and DBN100159N(native sequences) be transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with the liquid nitrogen method; Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector); Placed liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes; Agrobacterium LBA4404 after transforming is inoculated in the LB test tube in 28 ℃ of temperature, rotating speed is to cultivate 2 hours under the 200rpm condition, be applied on the LB flat board of kantlex (Kanamycin) of the Rifampin (Rifampicin) that contains 50mg/L and 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to the picking mono-clonal, carry out enzyme after cutting with restriction enzyme StyI and EcoRV enzyme and cut checking, the result shows recombinant expression vector DBN100159, DBN100159-i, DBN100159-t, DBN100159-a and DBN100159N(native sequences) structure is entirely true.

The 3rd embodiment, change acquisition and the checking of the milpa of PIC6-02 nucleotide sequence over to

1, obtains to change over to the milpa of PIC6-02 nucleotide sequence

Agrobacterium infestation method according to the routine employing, the corn variety of sterile culture is combined 31(Z31) rataria and the second embodiment in 4 described Agrobacteriums cultivate altogether, with the recombinant expression vector DBN100159 with 2 and 3 structures among the second embodiment, DBN100159-i, DBN100159-t, DBN100159-a and DBN100159N(native sequences) in T-DNA(comprise the promoter sequence of corn Ubiquitin gene, the PIC6-02 nucleotide sequence, PIC6-02 substituted nucleosides acid sequence, PIC6-02 brachymemma nucleotide sequence, PIC6-02 adds nucleotide sequence, native sequences, PMI gene and Nos terminator sequence) be transferred in the maize chromosome group, obtained to change over to the milpa of PIC6-02 nucleotide sequence, change the milpa of PIC6-02 substituted nucleosides acid sequence over to, change the milpa of PIC6-02 brachymemma nucleotide sequence over to, change the milpa (positive control) that PIC6-02 adds the milpa of nucleotide sequence and changes native sequences over to over to; Contrast as negative with the wild-type milpa simultaneously.

Transform for agriculture bacillus mediated corn, briefly, separate immature rataria from corn, contact rataria with agrobacterium suspension, wherein Agrobacterium can be passed to the PIC6-02 nucleotide sequence at least one cell (step 1: infect step) of one of rataria.In this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) inoculates to start in.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to culturing step) altogether.Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.Behind this common cultivation stage, optionally " recovery " step can be arranged.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) exist at least in a kind of oneself know the microbiotic (cephamycin) that suppresses the Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is having microbiotic but does not have the solid medium of selective agent to cultivate, to eliminate Agrobacterium and to provide decubation as infected cell.Then, the rataria of the inoculation transformed calli (step 4: select step) cultivating and select growing at the substratum that contains selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) the upper cultivation causes the cell selective growth that transforms.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, cultivate with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus that the substratum that contains selective agent is grown.

The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) on, 25 ℃ of lower cultivations are broken up.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, it is high to be cultured to about 10cm under 25 ℃, moves to hot-house culture to solid.In the greenhouse, every day is in 28 ℃ of lower cultivations 16 hours, again in 20 ℃ of lower cultivations 8 hours.

2, change the milpa of PIC6-02 nucleotide sequence over to the TaqMan checking

Get respectively milpa, the milpa that changes PIC6-02 substituted nucleosides acid sequence over to, the milpa that changes PIC6-02 brachymemma nucleotide sequence over to that change the PIC6-02 nucleotide sequence over to, change the about 100mg of blade of milpa that PIC6-02 adds the milpa of nucleotide sequence and change native sequences over to over to as sample, DNeasy Plant Maxi Kit with Qiagen extracts its genomic dna, detects the copy number of PIC6 gene by the Taqman fluorescence probe quantitative PCR method.Contrast as negative with the wild-type milpa simultaneously, detect according to the method described above analysis.3 repetitions are established in experiment, average.

The concrete grammar that detects the PIC6 gene copy number is as follows:

Step 11, respectively get milpa, the milpa that changes PIC6-02 substituted nucleosides acid sequence over to, the milpa that changes PIC6-02 brachymemma nucleotide sequence over to that change the PIC6-02 nucleotide sequence over to, change each 100mg of blade that PIC6-02 adds milpa, the milpa that changes native sequences over to and the wild-type milpa of nucleotide sequence over to, be ground into homogenate with liquid nitrogen respectively in mortar, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, with NanoDrop 2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;

The genomic dna concentration of step 14, the above-mentioned sample of adjustment is to the same concentration value, and the scope of described concentration value is 80-100ng/ μ l;

Step 15, adopt the Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, with through the sample of identifying the known copy number as standard substance, with the sample of wild-type milpa in contrast, its mean value is got in 3 repetitions of each sample; Fluorescence quantification PCR primer and probe sequence are respectively:

Following primer and probe are used for detecting PIC6-02 nucleotide sequence, PIC6-02 substituted nucleosides acid sequence, PIC6-02 brachymemma nucleotide sequence and PIC6-02 and add nucleotide sequence:

Primer 1(CF1): CTCGCTGTGTACCATGACTCG is shown in SEQ ID NO:10 in the sequence table;

Primer 2 (CR1): GTACTGGGACTTGACCACTGAGC is shown in SEQ ID NO:11 in the sequence table;

Probe 1(CP1): CCTGTTGCCGACCCAAGACTCCAG is shown in SEQ ID NO:12 in the sequence table;

Following primer and probe are used for detecting native sequences:

Primer 3(CF2): CAAACAGGTATTGGTATTGCGG is shown in SEQ ID NO:13 in the sequence table;

Primer 4(CR2): CCCTTAGGCCATAGCTCACCT is shown in SEQ ID NO:14 in the sequence table;

Probe 2(CP2): CTTGGTACCCTAGGCGTTCCTTTTGCAG is shown in SEQ ID NO:15 in the sequence table;

The PCR reaction system is:

Described 50 * primer/probe mixture comprises each 45 μ l of every kind of primer of 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l, 1 * TE damping fluid, and at 4 ℃, be housed in the amber test tube.

The PCR reaction conditions is:

Utilize SDS2. 3 softwares (Applied Biosystems) analytical data.

Experimental result shows, the PIC6-02 nucleotide sequence, PIC6-02 substituted nucleosides acid sequence, PIC6-02 brachymemma nucleotide sequence, all oneself is incorporated in the genome of the milpa that detects for PIC6-02 interpolation nucleotide sequence and native sequences, and changes the milpa of PIC6-02 nucleotide sequence over to, change the milpa of PIC6-02 substituted nucleosides acid sequence over to, change the milpa of PIC6-02 brachymemma nucleotide sequence over to, the milpa that changes PIC6-02 interpolation nucleotide sequence over to has all obtained to contain the transgenic corn plant that list copies the PIC6 gene with the milpa that changes native sequences over to.

The RT-PCR of the 4th embodiment, transgenic corn plant detects

1, the mRNA content detection of the insect-killing protein of transgenic corn plant (PIC6 albumen)

Get respectively 0.2g change over to the PIC6-02 nucleotide sequence milpa, change over to PIC6-02 substituted nucleosides acid sequence milpa, change over to PIC6-02 brachymemma nucleotide sequence milpa, change the fresh blade (lobus cardiacus) of milpa that PIC6-02 adds the milpa of nucleotide sequence and change native sequences over to over to as sample, liquid nitrogen grinding is collected the 100-200mg tissue, the described TRIZOL extracting solution of rear adding 1ml, vortex makes the abundant cracking of sample, and room temperature is placed 5min; Add 0.2ml chloroform (chloroform) thermal agitation mixing 15s, room temperature is placed 10min; Under 4 ℃, centrifugal 10min under the rotating speed of 12000rpm gets that supernatant liquor adds 0.5ml(or 0.5X begins volume) RNase-Free water, add again the Virahol (1:1 volume) of 1ml, abundant mixing, room temperature is placed 10min, precipitation; Under 4 ℃, centrifugal 10min under the rotating speed of 12000rpm, getting precipitation, to add the 1ml massfraction be 75% washing with alcohol RNA precipitation; Under 4 ℃, centrifugal 10min removes supernatant under the rotating speed of 8000rpm, and RNA slightly dries about 10-15min, and the RNase-Free water that adds 100 μ l volumes fully dissolves; RNA sample DAaseI enzyme is cut,

As: 20 μ l RNA samples (≤5 μ g, water-soluble or TE Buffer)

Mixing, 37 ℃ of temperature are bathed 30min, DNaseI deactivation (DNaseI specification sheets)

The 3M NaOAc(RNase free, the pH5.2 that add 1/10 volume) and the ethanol precipitated rna of 3V; Under-80 ℃, place 2 h, under 2-8 ℃, centrifugal 10min under the rotating speed of 12000rpm; Add 500 μ l massfractions and be 75% washing with alcohol, under 2-8 ℃, centrifugal 5min under the rotating speed of 10000 rpm; Add massfraction and be 75% ethanol and wash again once, centrifugal after, sky gets rid of once again, blots the ethanol on the centrifugal tube wall.Drying at room temperature 10-15 min; Add 100 μ l RNase free water and fully dissolve, centrifugal decon, supernatant are total RNA of preparation; Optical densitometric method is measured concentration and the purity (OD of total RNA ₂₆₀/ OD ₂₈₀) (Gene Quant); Total RNA electrophoresis detects total RNA whether degrade (can be placed on-80 ℃ of preservations).Add the total RNA of 2 μ g, 1 μ l primer, 1 μ l 10mM dNTPs, moisturizing (RNase-free water) is to 13 μ l; Ice bath 2min immediately behind 65 ℃ of sex change 10min, annealing; Add 4 μ l, 5 * M-MLV buffer, 1 μ l 20mM DTT, 1 μ l RNase Inhibitor and 1 μ l M-MLV(Invitrigen); After 42 ℃ of temperature are bathed 1-2h, take out in-20 ℃ and save backup.Every duplicate samples is got 0.1 μ g and is used for Real-time PCR(RT-PCR) detect, primer is as follows:

Method of calculation are with reference to Livak et al. " Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 ^{-Δ Δ CT}Method ", Method(2001) 25(4): 402-408.

Simultaneously be accredited as not genetically modified milpa in contrast with the wild-type milpa with through quantitative fluorescent PCR, detect according to the method described above analysis.Change totally 3 strains (S1, S2 and S3) of PIC6-02 nucleotide sequence over to, change totally 2 strains (S4 and S5) of PIC6-02 substituted nucleosides acid sequence over to, change totally 2 strains (S6 and S7) of PIC6-02 brachymemma nucleotide sequence over to, change totally 2 strains (S8 and S9) that PIC6-02 adds nucleotide sequence over to, change totally 2 strains (S10 and S11) of native sequences over to, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.

The average experimental result of the mRNA content of the PIC6 insect-killing protein of transgenic corn plant as shown in Figure 4.The result shows, the mRNA relative content that changes the PIC6 insect-killing protein in the milpa of PIC6-02 nucleotide sequence over to is 20 times of milpa that change native sequences over to.Well known to those skilled in the art, the RT-PCR technology is sensitive and of many uses, can be directly used in the transcriptional level that detects gene in the cell, and then expression level and expressing quantity and the stability of this gene are described indirectly.Therefore, this result shows according to the codon optimized PIC6-02 nucleotide sequence of the preference of corn has increased stability and expression amount that PIC6-02 albumen is expressed significantly in corn.With comparing of the milpa that changes the PIC6-02 nucleotide sequence over to, change the milpa of PIC6-02 substituted nucleosides acid sequence, the mRNA content that changes the milpa of PIC6-02 brachymemma nucleotide sequence over to and change PIC6 insect-killing protein in the milpa that PIC6-02 adds nucleotide sequence over to over to without significant difference.

2, the pest-resistant effect detection of transgenic corn plant

With change over to the PIC6-02 nucleotide sequence milpa, change over to PIC6-02 substituted nucleosides acid sequence milpa, change over to PIC6-02 brachymemma nucleotide sequence milpa, change PIC6-02 over to and add milpa, the milpa that changes native sequences over to, the wild-type milpa of nucleotide sequence and be accredited as not genetically modified milpa (V3-V4 period) through quantitative fluorescent PCR and respectively Ostrinia furnacalis, east armyworm and striped rice borer are carried out pest-resistant effect detection.

(1) Ostrinia furnacalis: get respectively the milpa that changes the PIC6-02 nucleotide sequence over to, change the milpa of PIC6-02 substituted nucleosides acid sequence over to, change the milpa of PIC6-02 brachymemma nucleotide sequence over to, change the milpa that PIC6-02 adds nucleotide sequence over to, change the milpa of native sequences over to, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, totally and with gauze the water on the blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into simultaneously the strip of about 1cm * 2cm, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, put the Ostrinia furnacalis (newly hatched larvae) that 10 tribal chief workers raise in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8 and add up the larva death condition, calculate the average mortality of each continent, sample Central Asia Pyrausta nubilalis (Hubern)..Change totally 3 strains (S1, S2 and S3) of PIC6-02 nucleotide sequence over to, change totally 2 strains (S4 and S5) of PIC6-02 substituted nucleosides acid sequence over to, change totally 2 strains (S6 and S7) of PIC6-02 brachymemma nucleotide sequence over to, change totally 2 strains (S8 and S9) that PIC6-02 adds nucleotide sequence over to, change totally 2 strains (S10 and S11) of native sequences over to, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.Result such as table 1 and shown in Figure 5.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation Ostrinia furnacalis

The result of table 1 shows: change the milpa of PIC6-02 nucleotide sequence over to and change in the milpa of native sequences and can choose the plant that Ostrinia furnacalis is had certain resistance, but the examination worm mortality ratio that changes the milpa of PIC6-02 nucleotide sequence over to is significantly higher than the milpa that changes native sequences over to.Change the examination worm mortality ratio of milpa of PIC6-02 nucleotide sequence over to more than 70%, and the examination worm mortality ratio of milpa that changes native sequences over to is about 13%.The result of Fig. 5 shows: although change the mortality that the milpa of PIC6-02 nucleotide sequence can not caused newly hatched larvae over to, but but the larvae development progress is caused great inhibition, after 3 days larva substantially still be in the state of just incubating or between just incubate-the negative control state between, and its blade injury rate is also less.

(2) striped rice borer: get respectively the milpa that changes the PIC6-02 nucleotide sequence over to, change the milpa of PIC6-02 substituted nucleosides acid sequence over to, change the milpa of PIC6-02 brachymemma nucleotide sequence over to, change the milpa that PIC6-02 adds nucleotide sequence over to, change the milpa of native sequences over to, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, totally and with gauze the water on the blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into simultaneously the strip of about 1cm * 2cm, getting 3 strip blades after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, put the striped rice borer (newly hatched larvae) that 10 tribal chief workers raise in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to the Chilo spp larvae development progress, three indexs of mortality ratio and blade injury rate obtain the resistance total points: total points=100 * mortality ratio+[100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubating-the negative control borer population/connect the worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Change totally 3 strains (S1, S2 and S3) of PIC6-02 nucleotide sequence over to, change totally 2 strains (S4 and S5) of PIC6-02 substituted nucleosides acid sequence over to, change totally 2 strains (S6 and S7) of PIC6-02 brachymemma nucleotide sequence over to, change totally 2 strains (S8 and S9) that PIC6-02 adds nucleotide sequence over to, change totally 2 strains (S10 and S11) of native sequences over to, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.Result such as table 2 and shown in Figure 6.

The result of table 2 shows: change the milpa of PIC6-02 nucleotide sequence over to and change in the milpa of native sequences and can choose the plant that striped rice borer is had certain resistance, but the giving birth to of milpa that changes the PIC6-02 nucleotide sequence over to surveyed total points and be significantly higher than the milpa that changes native sequences over to.Change over to the PIC6-02 nucleotide sequence milpa give birth to survey total points all more than 180 minutes, and the giving birth to of milpa that changes native sequences over to surveyed total points about 80 minutes.The result of Fig. 6 shows: although change the mortality that the milpa of PIC6-02 nucleotide sequence can not caused newly hatched larvae over to, but but the larvae development progress is caused great inhibition, after 3 days larva substantially still be in the state of just incubating or between just incubate-the negative control state between, and its blade injury rate is below 30%.

The pest-resistant experimental result of table 2, transgenic corn plant inoculation striped rice borer

(3) east armyworm: get respectively the milpa that changes the PIC6-02 nucleotide sequence over to, change the milpa of PIC6-02 substituted nucleosides acid sequence over to, change the milpa of PIC6-02 brachymemma nucleotide sequence over to, change the milpa that PIC6-02 adds nucleotide sequence over to, change the milpa of native sequences over to, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, totally and with gauze the water on the blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into simultaneously the strip of about 1cm * 2cm, getting 3 strip blades after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, put the east armyworm (newly hatched larvae) that 10 tribal chief workers raise in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to east armyworm larvae development progress, three indexs of mortality ratio and blade injury rate obtain the resistance total points: total points=100 * mortality ratio+[100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubating-the negative control borer population/connect the worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Change totally 3 strains (S1, S2 and S3) of PIC6-02 nucleotide sequence over to, change totally 2 strains (S4 and S5) of PIC6-02 substituted nucleosides acid sequence over to, change totally 2 strains (S6 and S7) of PIC6-02 brachymemma nucleotide sequence over to, change totally 2 strains (S8 and S9) that PIC6-02 adds nucleotide sequence over to, change totally 2 strains (S10 and S11) of native sequences over to, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.Result such as table 3 and shown in Figure 7.

The result of table 3 shows: change the milpa of PIC6-02 nucleotide sequence over to and change in the milpa of native sequences and can choose the plant that the east armyworm is had certain resistance, but the giving birth to of milpa that changes the PIC6-02 nucleotide sequence over to surveyed total points and be significantly higher than the milpa that changes native sequences over to.Change over to the PIC6-02 nucleotide sequence milpa give birth to survey total points all more than 120 minutes, and the giving birth to of milpa that changes native sequences over to surveyed total points about 35 minutes.The result of Fig. 7 shows: although change the mortality that the milpa of PIC6-02 nucleotide sequence can not caused newly hatched larvae over to, but but the larvae development progress is caused great inhibition, after 3 days larva substantially still be in the state of just incubating or between just incubate-the negative control state between, and its blade injury rate is about 50%.

Prove that thus the milpa that changes the PIC6-02 nucleotide sequence over to has higher insect resistance capacity, namely express the high milpa that changes the PIC6-02 nucleotide sequence over to of PIC6-02 protein level and also have higher virulence, therefore increased significantly the virulence that PIC6-02 albumen is expressed according to the codon optimized PIC6-02 nucleotide sequence of the preference of corn in corn.In addition, with comparing of the milpa that changes the PIC6-02 nucleotide sequence over to, change the milpa of PIC6-02 substituted nucleosides acid sequence, the virulence that changes the milpa of PIC6-02 brachymemma nucleotide sequence over to and change PIC6-02 albumen in the milpa that PIC6-02 adds nucleotide sequence over to over to without significant difference.

In sum, PIC6-02 killing gene of the present invention adopts the preference codon of corn, the characteristic that meets corn gene fully, so that killing gene of the present invention is particularly suitable for expressing in monocotyledons, especially corn, PIC6-02 insect-killing protein of the present invention is expression amount height and good stability not only, and is strong to the virulence of insect pest, especially the lepidopterous insects insect.

The pest-resistant experimental result of table 3, transgenic corn plant inoculation east armyworm

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although with reference to preferred embodiment the present invention is had been described in detail, those of ordinary skill in the art is to be understood that, can make amendment or be equal to replacement technical scheme of the present invention, and not break away from the spirit and scope of technical solution of the present invention.

Claims (18)

1. an insect-killing protein is characterized in that, comprising:

(a) has the protein that the aminoacid sequence shown in the SEQ ID NO:2 forms; Or

(b) aminoacid sequence in (a) is through replacing and/or disappearance and/or the protein of being derived by (a) that adds one or several amino acid and have insecticidal activity; Or

(c) has the protein that the aminoacid sequence of at least 90% sequence identity forms with SEQ ID NO:2.

2. described insect-killing protein according to claim 1 is characterized in that, described insect-killing protein is for having the protein that the aminoacid sequence of at least 95% sequence identity forms with SEQ ID NO:2.

3. described insect-killing protein according to claim 1 is characterized in that, described insect-killing protein is for having the protein that the aminoacid sequence of at least 99% sequence identity forms with SEQ ID NO:2.

4. a killing gene is characterized in that, comprising:

(a) nucleotide sequence of each described insect-killing protein of coding claim 1-3; Or

The nucleotide sequence of the protein that (b) under stringent condition, has insecticidal activity with the nucleotide sequence hybridization that (a) limits and coding; Or

(c) has the nucleotide sequence shown in the SEQ ID NO:1.

5. an expression cassette is characterized in that, is included in the described killing gene of claim 4 under the regulating and controlling sequence regulation and control of effective connection.

6. recombinant vectors that comprises the described killing gene of claim 4 or the described expression cassette of claim 5.

7. a transformed host that comprises the described killing gene of claim 4 or the described expression cassette of claim 5 is biological, it is characterized in that, comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

8. described transformed host is biological according to claim 7, it is characterized in that described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

9. a method that produces insect-killing protein is characterized in that, comprising:

Obtain the cell of claim 7 or 8 described transformed host biologies;

Under the condition that allows the generation insect-killing protein, cultivate the cell of described transformed host biology;

Reclaim described insect-killing protein.

10. method for increasing insect target scope, it is characterized in that, comprising: the insect-killing protein of each described insect-killing protein of claim 1-3 or the described expression cassette coding of claim 5 is expressed with at least a the second desinsection Nucleotide that is different from the insect-killing protein of each described insect-killing protein of claim 1-3 or the described expression cassette coding of claim 5 in plant.

11. described method for increasing insect target scope according to claim 10, it is characterized in that described the second desinsection Nucleotide can encode Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

12. described method for increasing insect target scope is characterized in that according to claim 10, described the second desinsection Nucleotide is for suppressing the dsRNA of important gene in the targeted insect insect.

13. a method that produces zoophobous is characterized in that, comprising: with the described killing gene of claim 4 or the described expression cassette of claim 5 or the described recombinant vectors importing of claim 6 plant.

14. the method for described generation zoophobous is characterized in that according to claim 13, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

15. method of avoiding the damage that caused by insect pest for the protection of plant; it is characterized in that; comprise: the described killing gene of claim 4 or the described expression cassette of claim 5 or the described recombinant vectors of claim 6 are imported plant, plant after the importing is produced enough protect it to avoid the insect-killing protein of insect pest infringement amount.

16. the described method of avoiding the damage that caused by insect pest for the protection of plant is characterized in that described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane according to claim 15.

17. a method of controlling insect pest is characterized in that, comprising: insect pest is contacted with each described insect-killing protein of claim 1-3 of amount of suppression or the insect repressible protein matter of being encoded by the described killing gene of claim 4.

18. the method for described control insect pest is characterized in that according to claim 17, described insect pest is the lepidopterous insects insect.

Images