CN102978177A - Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof - Google Patents
Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof Download PDFInfo
- Publication number
- CN102978177A CN102978177A CN2012104473927A CN201210447392A CN102978177A CN 102978177 A CN102978177 A CN 102978177A CN 2012104473927 A CN2012104473927 A CN 2012104473927A CN 201210447392 A CN201210447392 A CN 201210447392A CN 102978177 A CN102978177 A CN 102978177A
- Authority
- CN
- China
- Prior art keywords
- desaturase
- coenzyme
- gene
- unsf
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a delta-5-desaturase from a Corbrin-production bacterium cordyceps sinensis hirsutella sinensis. The delta-5-desaturase participates in eicosapentaenoic coenzyme A anabolism started from eicosatetraenoic coenzyme A. The invention also relates to a gene coding the enzyme, and an application thereof. The amino acid sequence of the delta-5-desaturase has more than 90% homology with a sequence represented by SEQ ID No.1 or SEQ ID No.3. From the principle, the invention carries out detailed researches upon the metabolic pathway of eicosatetraenoic coenzyme A to synthesizing the eicosapentaenoic coenzyme A. A cloned DNA comprising the nucleotide sequence provided by the invention can be transferred to engineering bacteria through methods of transduction, transformation, and combined transferring. Through the regulation upon eicosapentaenoic coenzyme A biosynthetic gene expression, high expression of a host delta-5-desaturase is provided, an effective approach is provided for increasing eicosapentaenoic acid yield. The application has an important application prospect.
Description
(1) technical field
The present invention relates to a kind of participation Eicosatetraenoic coenzyme A of producing bacterium Cordyceps sinensis China pilose spore from " hundred make " △ of anabolism eicosa-pentaenoic coenzyme A-5-desaturase (△-5 desaturase) that sets out, the gene of this enzyme of encoding and application thereof.The eicosa-pentaenoic coenzyme A generates timnodonic acid through hydrolysis again.
(2) background technology
Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on the larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (the Hepialus armoricanus Oberthur) larva.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various characteristics of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern worldwide enjoys high praise.The traditional Chinese medical science thinks that Cordyceps sinensis enters lung kidney two warps, and is can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc. are unique a kind of simultaneously balances, regulate the Chinese medicine of negative and positive.Modern pharmacology confirms that Cordyceps sinensis has the widely biological activity such as immunomodulatory, antibiotic, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.
Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual productions such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph conclusive evidence, activeconstituents compartment analysis and the mechanism of action, the Application and Development.The Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.
Natural cs has strict parasitics and special ecotope, so its output is very low, price is high.Wild cordyceps restricts scarcity of resources owing to factors such as being subjected to growing environment.Owing to made little progress at artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced the Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is suitable for large-scale industrialization production again.Its composition of the substitute of producing such as mycelium is also similar to natural cs with drug effect, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that the aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, proof is basically identical with natural cs chemical constitution, pharmacological action, can replace natural cs to produce cordyceps product, to remedy the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites all is significantly improved.
In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, to progressively turning to deeper functional meta-bolites research by the direct utilization of Chinese caterpillar fungus raw material or crude extract in the worm grass product research and development.The Chinese caterpillar fungus meta-bolites has been done a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative researchs of functional meta-bolites at aspects such as biosynthesizing, pharmacological actions such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL win initial success.
Unsaturated fatty acids refers to contain in the molecule lipid acid of one or more pairs of keys, and its fusing point is low than saturated fatty acid.Unsaturated fatty acids is a kind of lipid acid that consists of body fat, the lipid acid of needed by human, and unsaturated fatty acids is divided into two kinds of monounsaturated fatty acids and polyunsaturated fatty acids according to the difference of two key numbers.Polyunsaturated fatty acid (Polyunsaturated Fatty Acids, PUFAs) relative saturation lipid acid has more effect, it can reduce blood cholesterol and triglyceride level, regulate heart function, reduce blood viscosity, improve blood microcirculation, improve the activity of brain cell, memory and thinking ability, strengthen human defensive system's function etc., it can also get rid of unnecessary " rubbish " in the human body in addition, namely because the superabundant fat that forms of excessive saturated fatty acid of having taken the photograph the people, thereby reaches the purpose of fat-reducing.Therefore, its potential medical pharmaceutical use has been subject to the extensive concern in the world, has caused the great attention of the industries such as food, medicine even makeup.
Yung-Sheng in 1999 draws △ 6 and △ 12 fatty acid dehydrogenase genes of having cloned Mortierella alpina (Mortiere Uaalpina) and expresses in yeast saccharomyces cerevisiae.2004, the people such as Dyer changed △ 3 desaturases in the tung oil tree over to yeast, had successfully obtained to produce linolenic yeast.The people such as Maali-Amiri in 2007 change △ 12 desaturases of the blue or green bacterium of algae (Cyanobacterium) over to potato, successfully detect the potato fatty acid component considerable change has occured.2008, △ 6 desaturases that the people such as Hao will roll up the branch Mucor turned in people's transgene tobacco, have successfully obtained the bacterial strain of high yield gamma-linolenic acid.In addition, also have the relevant gene of many fatty acid desaturases to be cloned and Transformation Application.Because most of desaturase is embrane-associated protein, its separation and purification is very difficult, and separation and purification and the desaturase of identifying are very few, and most research is carried out around delta 8 desaturase genes and expression regulation thereof.
At present, applied unsaturated fatty acids is produced bacterium take subtilis as main, and as the Cordyceps fungus of important anabolism unsaturated fatty acids, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in the Cordyceps fungus unsaturated fatty acids metabolic pathway of synthesizing.
(3) summary of the invention
The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism timnodonic acid and further investigate, the enzyme, encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation Eicosatetraenoic coenzyme A to set out anabolism eicosa-pentaenoic coenzyme A.
The technical solution used in the present invention is:
A kind of Eicosatetraenoic coenzyme A △ of anabolism eicosa-pentaenoic coenzyme A-5-desaturase that sets out that participates in has 90% above homology with sequence shown in SEQ ID No.1 or the SEQ ID No.3; But this enzyme catalysis Eicosatetraenoic coenzyme A prepares corresponding eicosa-pentaenoic coenzyme A, and the eicosa-pentaenoic coenzyme A generates timnodonic acid through the effect of Perhydrolase again.Because the singularity of aminoacid sequence; any fragment or its variant that contains the peptide protein of aminoacid sequence shown in SEQ ID NO.1 or the SEQ ID No.3; such as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology all belong to the row of protection domain of the present invention more than 90%.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in the aminoacid sequence; Wherein, for the conservative property change of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replacing Isoleucine with leucine, variant also can have non-conservation and change, as replacing glycine with tryptophane.
Preferably, described △-5-desaturase aminoacid sequence such as SEQ ID No.1(are designated as unsF
1Albumen) or shown in the SEQ ID No.3 (be designated as unsF
2Albumen).
The present invention states △-5-desaturase and produces bacterium Cordyceps sinensis China pilose spore from " hundred make ".
The path that is obtained corresponding eicosa-pentaenoic coenzyme A, eicosa-pentaenoic coenzyme A hydrolysis generation timnodonic acid by Eicosatetraenoic coenzyme A anabolism is as follows:
The invention still further relates to described △-5-desaturase and prepare application in the eicosa-pentaenoic coenzyme A at biocatalysis Eicosatetraenoic coenzyme A.
The invention still further relates to the encoding gene of above-mentioned △-5-desaturase, namely △-5-dehydrogenase gene is concrete, and this encoding gene can be the gene order that has 90% above homology with polynucleotide shown in SEQ ID NO:2 or the SEQ ID No.4.Because the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO:2 or the SEQ ID No.4 as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide change that has.The variant of these polynucleotide can make living displacement varient or the varient of non-life, comprises replacing varient, deletion mutation body and inserting varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from the function of the peptide protein that changes in fact its coding.
Preferably, described △-5-dehydrogenase gene nucleotide sequence such as SEQ ID No.2(are designated as unsF
1Gene) or SEQ ID No.4(be designated as unsF
2Gene) shown in.
Described gene can be used for making up the genetic engineering bacterium that can biocatalysis Eicosatetraenoic coenzyme A prepares the eicosa-pentaenoic coenzyme A, to enlarge the output of timnodonic acid or derivatives thereof.
Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in the SEQ ID NO:1 or 3 and SEQ ID NO:2 or 4, in the situation of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, all be apparent to those skilled in the art.
Beneficial effect of the present invention is mainly reflected in: the present invention studies in great detail the synthetic eicosa-pentaenoic coenzyme A pathways metabolism of Eicosatetraenoic coenzyme A on principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, changes in the engineering bacteria in conjunction with the method that shifts, by regulating the expression of eicosa-pentaenoic coenzyme A biosynthesis gene, give the high expression level of host △-5-desaturase, for the output that enlarges the timnodonic acid or derivatives thereof provides effective way, has the major application prospect.
(4) description of drawings
Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;
Fig. 2 is Fatty acid biosynthesis metabolism approach annotated map;
Fig. 3 is fatty acid metabolism approach annotated map;
Fig. 4 is unsaturated fatty acids metabolic pathway of synthesizing annotated map;
Fig. 5 is △-5-dehydrogenase gene pcr amplification product gel electrophoresis figure;
Fig. 6 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;
Fig. 7 is restructuring cloned plasmids pMD18-T/uns F physical map;
Fig. 8 is recombinant expression plasmid pET-28a/uns F building process synoptic diagram;
Fig. 9 is recombinant expression plasmid pET-28a/uns F physical map;
Figure 10 is the SDS-PAGE figure of △-5-apodehydrogenase.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore
Bacterium source: at first gather natural cordyceps from Qinghai, and it is taken back Hangzhou carry out separation screening, obtained the L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.
With this bacterial classification inoculation in the inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards again bevel in following ratio) be glucose 2.0%(w/v, contain 1g in the 1% expression 100mL substratum, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sal epsom 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water, cultivates 25 days at 12 ~ 16 ℃; Then with bacterial classification inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, sal epsom 0.01%, potassium primary phosphate 0.02%, surplus is water, place on the shaking table, 12 ~ 16 ℃ of cultivations of temperature 25 days under aseptic condition, are carried out solid-liquid separation after cultivation finishes, and solid placed aseptic utensil, for subsequent use.
Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore
Extract total RNA with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly adding liquid nitrogen fully is ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mixing leaves standstill 5min on ice, and the nucleic acid-protein mixture is separated fully.2) RNA separates: add the 0.2mL chloroform, firmly shake mixing 15s, leave standstill 2 ~ 3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, the upper strata water is got in layering, about 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol will precipitate and hang, and leave standstill 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Washing step above repeating is washed one time again.5) dissolving RNA: centrifuge tube is placed unlimited dry 5 ~ 10min on ice, add an amount of DEPC water dissolution.
Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample
After extracting the total RNA of sample, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, with the synthetic article one cDNA chain of hexabasic basic random primer (random hexamers), then synthesize second cDNA chain, pass through again QiaQuick PCR test kit purifying and add the EB buffer solution elution and do terminal reparation afterwards, add polyA and connect sequence measuring joints, then carrying out clip size with agarose gel electrophoresis selects, carry out at last pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains the adaptor sequence among the primitive sequencer reads, standby with subsequent analysis.
Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA
Use short reads composite software SOAPdenovo(Li, Zhu et al. De novo assembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) do and transcribe group and from the beginning assemble.The reads that SOAPdenovo at first will have certain-length overlap is linked to be the longer Contig fragment that does not contain N.Then reads is compared back Contig, determine from the different Contig of same transcript and the distance between these Contig by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads that Scaffold is done filling-up hole and process, it is minimum to obtain at last containing N, the Unigene sequence that two ends can not prolong again.At last, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are blastx compare (evalue＜0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between the different sink is contradictory, then press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J]. In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, CA, pp. 1999,138-148.) predict its coding region and determine the direction of sequence.Provide its sequence from 5' to the 3' direction for the Unigene that can determine the sequence direction, provide the sequence that composite software obtains for the Unigene that can't determine the sequence direction.
Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation
Functional annotation information provides protein function note, Pathway note, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.At first, by blastx with the Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue＜0.00001), obtain having the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway note of Unigene according to the KEGG annotation information.Unigene and COG database are compared, and the possible function of prediction Unigene is also done the function statistic of classification to it.According to the nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J]. Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.After obtaining the GO note of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations[J]. Nucleic Acids Research, 2006,34:293-297.) all Unigene are done GO functional classification statistics, from the gene function distribution characteristics of these species of macroscopic view understanding.
Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore timnodonic acid pathways metabolism and analyzed
Fig. 2 is the Fatty acid biosynthesis metabolism (map00061) in the KEGG pathways metabolism note, Fig. 3 is the fatty acid metabolism (map00071) in the KEGG pathways metabolism note, Fig. 4 is the unsaturated fatty acids anabolism (map01040) in the KEGG pathways metabolism note, the enzyme of note is that " hundred make " that has detected produced bacterium Cordyceps sinensis China pilose spore timnodonic acid pathways metabolism relevant enzymes, as can be seen from the figure, detected △ from the synthetic corresponding eicosa-pentaenoic coenzyme A of each Eicosatetraenoic coenzyme A-5-dehydrogenase 2 Unigene.Detect online by the ORF Finder software among the NCBI, found out the open reading frame (SEQ ID No.2, No.4) of this gene and obtained corresponding protein sequence (SEQ ID No.1, No.3).
Embodiment 7: " hundred make " produces bacterium Cordyceps sinensis China pilose spore △-5-dehydrogenase gene design of primers
Each the gene open reading frame dna sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, be used for cloning " hundred make " and produce the △ of bacterium China pilose spore anabolism timnodonic acid-5-dehydrogenase gene, primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, and primer sequence is following listed:
UnsF
1Gene: forward primer 5 ' ACAGAATTCATGCCTGAATGCGCCCGTTC 3 '
Reverse primer 5 ' ATAAAGCTTTCACGTCGCAAGCTGGCGATG 3 '
UnsF
1Mrna length is 363bp.
UnsF
2Gene: forward primer 5 ' ACGGAATTCATGTGGCTTGAGATTAAGCAG 3 '
Reverse primer 5 ' AGCAAGCTTTCAGTAGATGAGAGGGTGATGG 3 '
UnsF
2Mrna length is 225bp.
Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain
After the method that provides according to embodiment 1 is first turned out sutella sinensis fermented mycelium, the method that provides according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following behind total RNA, be used for follow-up each gene clone experiment.
Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:
1) the following mixed solution of preparation in the Microtube pipe.
2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, can improve reverse transcription reaction efficient, so carry out sex change, annealing reaction at the PCR instrument, condition setting is as follows:
65℃，5 min
3) the centrifugal several seconds made the mixed solution of template ribonucleic acid/primer etc. be gathered in Microtube pipe bottom after annealing finished.
4) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.
5) on the PCR instrument, carry out reverse transcription reaction by following condition.
42℃ 15～30 min
70℃ 15 min
Generalized case, at eukaryote mRNA 3 ' end a PolyA structure is arranged, the quantity of A base does not wait to hundreds of is individual ten, utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain take mRNA as template, the present invention adopts the sequence (providing among the PrimeScript 1st Strand cDNA Synthesis Kit) in the dT zone of being developed alone by TaKaRa to be primer, if the mRNA integrity that obtains is better, can obtain so cDNA first chain of all zymoprotein encoding genes in the species by the reverse transcription process.
Embodiment 9: " hundred make " produces the detection of bacterium Cordyceps sinensis China pilose spore anabolism timnodonic acid functional gene △-5-desaturase unsF gene cloning, expression and protein vigor
1, the pcr amplification of △-5-desaturase unsF gene
CDNA the first chain that obtains in the embodiment 8 is as template, with unsF synthetic among the embodiment 7
1Gene primer: 5 ' ACA GAA TTC ATG CCT GAA TGC GCC CGT TC3 ' and 5 ' ATA AAG CTT TCA CGT CGC AAG CTG GCG ATG3 ', unsF
2Gene primer: 5 ' ACG GAA TTC ATG TGG CTT GAG ATT AAG CAG3 ' and 5 ' AGC AAG CTT TCA GTA GAT GAG AGG GTG ATG G3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:
Pfu pcr amplification reaction system:
Pfu DNA Ploymerase pcr amplification condition:
2, △-5-desaturase unsF gene PCR product gel electrophoresis detection
Concrete detection method is: 0.9% the sepharose that 1) will prepare makes its dissolving evenly with microwave-oven-heating; 2) get the 15mL gel, when treating that gel is cooled to 50 ℃ of left and right sides, add 1 μ L staining fluid Gold view, pour on the treatments of Electrophoretic Slab Gels after mixing, remove and insert the point sample comb behind the bubble; 3) after gel solidifies, carefully take out the point sample comb, offset plate is put into electrophoresis chamber (point sample hole one end is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add the TAE electrophoretic buffer; 4) get 5 μ L samples and then add 6 * Loading Buffer, 1.5 μ L and ddH
2Using liquid-transfering gun loading, applied sample amount after O 4 μ L mix is 10 μ L; 5) supply lead between connection electrophoresis chamber and the electrophoresis apparatus, just very red, negative pole is black; 6) power-on, the beginning electrophoresis, maximum voltage is no more than 5 V/cm; 7) when sample ran offset plate 2/3 the time can stop electrophoresis; 8) cut off the electricity supply after, gel taken out puts into the gel imaging instrument and observe, take pictures.
Transcribe group order-checking prediction △-5-desaturase unsF
1The size of gene is 363bp, unsF
2The size of gene is 225bp, and the agarose gel electrophoresis result shows and successfully amplified △-5-desaturase unsF
1Gene, size is about 360bp, unsF
2Gene, size is about 220bp.Fig. 5 is that " hundred make " produces bacterium China pilose spore anabolism eicosa-pentaenoic coenzyme A functional gene PCR product gel electrophorogram.
3, the base A that adds of △-5-desaturase unsF gene PCR product processes and purifying
Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier after after glue reclaims, also need adding base A processing, purifying.It is as follows that glue recovery product adds base A system:
72 ℃ add A base 20 min in the PCR instrument, use at last AxyPrep PCR cleaning agents box purifying.
4, △-5-desaturase unsF gene is connected with cloning vector
Cloning vector pMD18-T Vector is available from TaKaRa company (TaKaRa code D101A), and its physical map is seen Fig. 6, with △-5-desaturase unsF
1, unsF
2Gene is connected construction recombination plasmid pMD18-T/unsF with cloning vector
1, pMD18-T/unsF
2, physical map is seen Fig. 7, linked system and condition of contact are as follows.
Linked system:
Condition of contact: 16 ℃, 16h; Deactivation: 65 ℃, 15min.
5, the conversion of △-5-desaturase recombinant plasmid pMD18-T/unsF
Recombinant plasmid pMD18-T/unsF changed among the intestinal bacteria E. coli JM109 make up the recombinant bacterium E. coli JM109/pMD18-T/unsF that carries △-5-desaturase unsF gene, concrete steps are: 1) 10 μ L reaction systems are gone among the competent cell E. coli JM109 ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 ℃, 250rpm, 1h; 5) spread plate (containing the Amp resistance); 6) 37 ℃ of incubator overnight incubation.
6, the positive restructuring of △-5-desaturase E. coli JM109/pMD18-T/unsF screening
Bacterium colony PCR can extract genomic dna, and the DNA that directly exposes after the thalline pyrolysis carries out pcr amplification as template, the method is easy and simple to handle, quick, can the Rapid identification bacterium colony whether be the positive bacterium colony that contains the purpose plasmid, transform in identifying comparatively common.In the experiment, carry out bacterium colony PCR with being inoculated into single bacterium colony corresponding in the liquid nutrient medium, whether change goal gene over to checking.At first, add with toothpick picking list bacterium colony and to contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters, boiling water bath 30min, then centrifugal with supernatant as template, carry out pcr amplification, the PCR program setting is Taq enzymatic amplification general procedure.Adopt at last 0.9% agarose gel electrophoresis detection bacterium colony PCR product.
7, △-5-desaturase recombinant plasmid pMD18-T/unsF
1And pMD18-T/unsF
2Order-checking
After the detected positive recombinant bacterium liquid LB culture medium culturing of bacterium colony PCR spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is finished by Shanghai Sani's bio tech ltd.Through sequence verification, sequence SEQ ID No.2 and SEQ ID No.4 are to recombinate to pMD18-T/unsF respectively
1And pMD18-T/unsF
2In
8, △-5-desaturase recombinant expression plasmid pET-28a/unsF
1And pET-28a/unsF
2Structure
The experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and △-5-desaturase unsF gene restriction enzyme site comparison situation, determined EcoR I and Hind III double enzyme site, and to recombination bacillus coli E. coli JM109/pMD18-T/unsF
1With E. coli JM109/pMD18-T/unsF
2Carry out the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.
The recombinant plasmid pMD18-T/unsF of △-5-desaturase unsF gene
1And pMD18-T/unsF
2And expression vector pET-28a use respectively EcoR I/Hind III restriction enzyme 37 ℃ respectively enzyme cut and process 6h, it is as follows that enzyme is cut system:
EcoR I/Hind III double digestion system:
Enzyme is cut and is finished rear 65 ℃ of deactivation 15min, then respectively with Axygen dna gel recovery test kit reclaim, purifying.
△-5-desaturase unsF gene and expression vector pET-28a spend the night with 16 ℃ of connections of T4 ligase enzyme behind double digestion, purifying again, make up recombinant expression plasmid pET-28a/unsF
1And pMD18-T/unsF
2, its building process is seen Fig. 8, makes up the recombinant expression plasmid pET-28a/unsF that obtains
1, pET-28a/unsF
2Collection of illustrative plates is seen Fig. 9.Linked system is composed as follows:
Linked system:
9, the △-conversion of 5-desaturase recombinant expression plasmid and the screening of positive monoclonal
The expression plasmid heat shock that builds is converted in the E. coli BL21 Host Strains, then is applied on the LB agar plate that contains kantlex (Kan) resistance 37 ℃ of overnight incubation.Random choose list bacterium colony from the flat board carries out pcr amplification with the primer of each functional gene, selects positive colony.
10, the abduction delivering of △-5-desaturase recombinant bacterium
Be inoculated in the LB liquid nutrient medium that 5mL contains the Kan resistance 37 ℃, 250r/min overnight incubation with being accredited as positive mono-clonal.Get the 1mL culture, it is transferred contain in the LB liquid nutrient medium of Kan resistance 37 ℃, 250r/min in 50mL and be cultured to cell concentration OD600 and be about about 0.6～0.8.In culture, add respectively certain density IPTG inducing culture 8h.Collecting thalline surveys for electrophoresis analysis and enzyme biopsy.
11, △-5-desaturase recombinant bacterium expression product SDS-PAGE analyzes
With the E. coli BL21 bacterium that changes empty carrier over to and the recombinant bacterium that do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium behind IPTG inducing culture certain hour, get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in the 50 μ L distilled water, add 50 μ L sample-loading buffers, boil 10min behind the mixing, carry out the SDS-PAGE electrophoretic analysis, " A " swimming lane among Figure 10 is recombinant bacterium E. coli BL21/pET-28a/unsF
1The △ that expresses-5-desaturase unsF
1The SDS-PAGE figure of (through its aminoacid sequence of sequence verification shown in SEQ ID No.1), " B " swimming lane is recombinant bacterium E. coli BL21/pET-28a/unsF
2The △ that expresses-5-desaturase unsF
2The SDS-PAGE figure of (through its aminoacid sequence of sequence verification shown in SEQ ID No.3).
12, the protein-active of △-5-desaturase recombinant bacterium detects
(1) Δ-5-desaturase unsF
1Protein-active detect:
Enzyme liquid preparation: the recombinant bacterium E. coli BL21/pET-28a/unsF that takes by weighing collection
10.5g suspend with phosphate buffered saline buffer (50mM, pH8.0) 15mL, ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).
△-5-desaturase unsF
1Transformation system: transform adding E. coli BL21/pET-28a/unsF in the bottle at 50mL
1Ultrasonication thalline 10mL, 0.1g Eicosatetraenoic coenzyme A, 30 ℃, 150r/min conversion, after conversion finished, the centrifuging and taking supernatant was standby with subsequent detection.
Detection method: GC conditions: 30m * 0.32mm * 0.25mm fused-silica capillary column; 190 ℃ of post initial temperature post initial temperature, insulation 1min is warming up to 230 ℃ with 6 ℃/min, then constant temperature; 250 ℃ of vaporizer temperature; Carrier gas is high-purity He (99.999%); Press 62.6KPa before the post; Flow rate of carrier gas 1.4mL/min; Sample size 1 μ L; Splitting ratio 60:1.The mass spectrum condition: ion source is the EI source; 230 ℃ of ion source temperatures; 150 ℃ of quadrupole temperature; Electron energy 70eV; 260 ℃ of interface temperature; Solvent delay 2min; Mass range 10-550u.
Detect and calculate through above-mentioned chromatographic condition, draw to draw a conclusion: △-5-desaturase recombinant bacterium E. coli BL21/pET-28a/unsF
1Expressed △-5-desaturase unsF
1The high specific enzyme live (Specific Activity) be 8.2 mol/min/mg, substrate conversion efficiency is 83.95%.
(2) Δ-5-desaturase unsF
2Protein-active detect:
Enzyme liquid preparation: the recombinant bacterium E. coli BL21/pET-28a/ unsF that takes by weighing collection
20.5g suspend with phosphate buffered saline buffer (50mM, pH8.0) 15mL, ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).
△-5-desaturase unsF
2Transformation system: transform adding E. coli BL21/pET-28a/ unsF in the bottle at 50mL
2Ultrasonication thalline 10mL, 0.1g Eicosatetraenoic coenzyme A, 30 ℃, 150r/min conversion, after conversion finished, the centrifuging and taking supernatant was standby with subsequent detection.
Detection method: GC conditions: 30m * 0.32mm * 0.25mm fused-silica capillary column; 190 ℃ of post initial temperature post initial temperature, insulation 1min is warming up to 230 ℃ with 6 ℃/min, then constant temperature; 250 ℃ of vaporizer temperature; Carrier gas is high-purity He (99.999%); Press 62.6KPa before the post; Flow rate of carrier gas 1.4mL/min; Sample size 1 μ L; Splitting ratio 60:1.The mass spectrum condition: ion source is the EI source; 230 ℃ of ion source temperatures; 150 ℃ of quadrupole temperature; Electron energy 70eV; 260 ℃ of interface temperature; Solvent delay 2min; Mass range 10-550u.
Detect and calculate through above-mentioned chromatographic condition, draw to draw a conclusion: △-5-desaturase recombinant bacterium E. coli BL21/pET-28a/unsF
2Expressed △-5-desaturase unsF
2The high specific enzyme live (Specific Activity) be 7.8 mol/min/mg, substrate conversion efficiency is 82.83%.
Claims (7)
1. the △ that participates in Eicosatetraenoic coenzyme A anabolism eicosa-pentaenoic coenzyme A-5-desaturase has 90% above homology with sequence shown in SEQ ID No.1 or the SEQ ID No.3.
2. △ as claimed in claim 1-5-desaturase is characterized in that the aminoacid sequence of described △-5-desaturase is shown in SEQ ID No.1 or SEQ ID No.3.
3. △ as claimed in claim 1 or 2-5-desaturase is characterized in that this enzyme is from " hundred make " production bacterium Cordyceps sinensis China pilose spore.
4. △ as claimed in claim 1 or 2-5-desaturase prepares application in the eicosa-pentaenoic coenzyme A at biocatalysis Eicosatetraenoic coenzyme A.
5. the gene of coding claim 1 or 2 described △-5-desaturases.
6. gene as claimed in claim 5 is characterized in that the nucleotide sequence of described gene is shown in SEQ ID No.2 or SEQ ID No.4.
7. the application of gene as claimed in claim 5 in making up the genetic engineering bacterium that can biocatalysis Eicosatetraenoic coenzyme A prepares the eicosa-pentaenoic coenzyme A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210447392.7A CN102978177B (en) | 2012-11-09 | 2012-11-09 | Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210447392.7A CN102978177B (en) | 2012-11-09 | 2012-11-09 | Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102978177A true CN102978177A (en) | 2013-03-20 |
| CN102978177B CN102978177B (en) | 2015-06-03 |
Family
ID=47852516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210447392.7A Active CN102978177B (en) | 2012-11-09 | 2012-11-09 | Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102978177B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104130985A (en) * | 2014-06-30 | 2014-11-05 | 浙江工业大学 | Cordyceps sinensis hirsutella-sinensis malic dehydrogenase A, encoding gene and application of two |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101146911A (en) * | 2005-03-22 | 2008-03-19 | 巴斯福植物科学有限公司 | Method for producing polyunsaturated C20 and C22fatty acids with at least four double bonds in transgenic plants |
| CN101210234A (en) * | 2006-12-27 | 2008-07-02 | 中国海洋大学 | Ocean micro-alga delta5 aliphatic acid desaturase and application thereof |
| CN102197047A (en) * | 2008-09-19 | 2011-09-21 | 纳幕尔杜邦公司 | Mutant delta5 desaturases and their use in making polyunsaturated fatty acids |
| CN102317459A (en) * | 2008-11-18 | 2012-01-11 | 联邦科学技术研究组织 | Enzymes and methods for producing omega-3 fatty acids |
| WO2012027676A1 (en) * | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Mutant delta-9 elongases and their use in making polyunsaturated fatty acids |
| WO2012027698A1 (en) * | 2010-08-26 | 2012-03-01 | E.I. Du Pont De Nemours And Company | Mutant hpgg motif and hdash motif delta-5 desaturases and their use in making polyunsaturated fatty acids |
-
2012
- 2012-11-09 CN CN201210447392.7A patent/CN102978177B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101146911A (en) * | 2005-03-22 | 2008-03-19 | 巴斯福植物科学有限公司 | Method for producing polyunsaturated C20 and C22fatty acids with at least four double bonds in transgenic plants |
| CN101210234A (en) * | 2006-12-27 | 2008-07-02 | 中国海洋大学 | Ocean micro-alga delta5 aliphatic acid desaturase and application thereof |
| CN102197047A (en) * | 2008-09-19 | 2011-09-21 | 纳幕尔杜邦公司 | Mutant delta5 desaturases and their use in making polyunsaturated fatty acids |
| CN102317459A (en) * | 2008-11-18 | 2012-01-11 | 联邦科学技术研究组织 | Enzymes and methods for producing omega-3 fatty acids |
| WO2012027676A1 (en) * | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Mutant delta-9 elongases and their use in making polyunsaturated fatty acids |
| WO2012027698A1 (en) * | 2010-08-26 | 2012-03-01 | E.I. Du Pont De Nemours And Company | Mutant hpgg motif and hdash motif delta-5 desaturases and their use in making polyunsaturated fatty acids |
Non-Patent Citations (5)
| Title |
|---|
| 《中国硕士学位论文全文数据库》 20120415 刘冬梅 三角褐指藻AA和EPA合成的Delta5脂肪酸去饱和酶研究 , * |
| GAO,Q.等: "EFZ03530.1", 《GENBANK》, 8 February 2011 (2011-02-08) * |
| 刘冬梅: "三角褐指藻AA和EPA合成的Δ5脂肪酸去饱和酶研究", 《中国硕士学位论文全文数据库》, 15 April 2012 (2012-04-15) * |
| 曾硕士等: "脂肪酸去饱和酶的研究进展", 《生命科学》, 31 October 2008 (2008-10-31) * |
| 黄建忠等: "微生物高度不饱和脂肪酸生物合成相关酶的研究", 《华东六省一市生物化学与分子生物学会2010年学术交流会》, 31 December 2010 (2010-12-31) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104130985A (en) * | 2014-06-30 | 2014-11-05 | 浙江工业大学 | Cordyceps sinensis hirsutella-sinensis malic dehydrogenase A, encoding gene and application of two |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102978177B (en) | 2015-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102690796A (en) | Enzyme synthesized by Chinese caterpillar fungus hirsutella sinensis to metabolize guanine nucleotide and genes and application of enzyme | |
| CN103087998B (en) | Enzyme for synthesizing cetyl-coenzyme A through cordyceps sinensis, gene and application thereof | |
| CN103031285A (en) | Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof | |
| CN103031295A (en) | Cordyceps cytidine deaminase, coding gene and application thereof | |
| CN102978177B (en) | Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof | |
| CN102747057B (en) | Cordyceps sinensis hirsutella sinensis purine anabolism enzyme, gene thereof, and application thereof | |
| CN102965351B (en) | Cordyceps sinensis omega-6 fatty acid-dehydrogenase, gene and application of gene | |
| CN102965350B (en) | Cordyceps sinensis stearoyl-CoA desaturase, gene and application of gene | |
| CN102690797A (en) | Enzyme for synthesizing and metabolizing adenine of Cordyceps sinensis(Berk.)Sacc. Hirsutella sinensis, and gene and application of enzyme | |
| CN103074308B (en) | Enzyme of Cordyceps hirsutella sinensis for synthesis of 3-hydroxybutyrate, and gene and application thereof | |
| CN102690801A (en) | Enzyme for synthesizing and metabolizing inosine monophosphate of Cordyceps sinensis(Berk.)Sacc. Hirsutella sinensis and application thereof | |
| CN103013946B (en) | Cordyceps sinensis hexadecane coenzyme A hydrolytic enzyme, gene and applications of hydrolytic enzyme and gene | |
| CN103074311B (en) | Enzyme of Cordyceps hirsutella sinensis for synthesis of acetic acid, and gene and application thereof | |
| CN104120112A (en) | Cordyceps sinensis 3-isopropylmalate dehydrogenase B, as well as encoding genes and application thereof | |
| CN104388400B (en) | Enzyme and gene of cordyceps sinensis hirsutella sinensis synthesized acetic acid and application thereof | |
| CN102703396A (en) | Enzyme from Cordyceps sinensis Hirsutella sinensis for participating in anabolism to obtain xanthylic acid and application of enzyme | |
| CN103031281B (en) | Cordyceps Chinese Hirsutella carbamyl phosphate synthetase, coding gene and application thereof | |
| CN103031288A (en) | Cordyceps Chinese Hirsutella 5'-nucleotidase, coding gene and application thereof | |
| CN103031286A (en) | Cordyceps Chinese Hirsutella uridylate-cytidylate kinase, coding gene and application thereof | |
| CN102690800A (en) | Enzyme for synthesizing and metabolizing xanthine of Cordyceps sinensis(Berk.)Sacc. Hirsutella sinensis, and gene and application of enzyme | |
| CN103031284B (en) | Cordyceps thymidylate synthetase, coding gene and application thereof | |
| CN102776162B (en) | Enzyme of cordyceps sinensis hirsutella sinensis anabolic adenylic acid, gene and application of enzyme | |
| CN103031287A (en) | Cordyceps Chinese Hirsutella nucleoside diphosphokinase, coding gene and application thereof | |
| CN103045574A (en) | Cordyceps sinensis hirsutella sinensis uridylic acid synthetase, as well as coding gene and application thereof | |
| CN104120113A (en) | Cordyceps sinensis 3-isopropyl malic dehydrogenase C, encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |