CN103045574A - Cordyceps sinensis hirsutella sinensis uridylic acid synthetase, as well as coding gene and application thereof - Google Patents

Abstract

The invention relates to an enzyme from 'Bailing' producing strain cordyceps sinensis hirsutella sinensis for anabolism of uridylic acid from orotidylic acid, a gene coding the enzyme and application of the enzyme. The enzyme is uridylic acid synthetase and has over 90% of homology to the amino acid sequence shown by SEQ ID No.1, SEQ ID No.3 or SEQ ID No.5; and the coding gene has over 90% of homology to the amino acid sequence shown by SEQ ID No.2, SEQ ID No.4 or SEQ ID No.6. According to the invention, the metabolic pathway for synthesizing uridylic acid from orotidylic acid is studied in details in principle, the cloning DNA (Deoxyribonucleic Acid) comprising the nucleotide sequence provided by the invention can be transferred into engineering bacteria through transduction, transformation and combined transfer, high expressivity of the host uridylic acid is obtained by adjusting the expression of the uridylic acid biosynthesis gene, an effective means of increasing the output of the uridylic acid is provided, and a significant application prospect is realized.

Description

Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme, encoding gene and application thereof

(1) technical field

The present invention relates to the uridylic acid synthetic enzyme (uridine monophosphate synthetase) that a participation orotidylic acid from " hundred make " production bacterium Cordyceps sinensis China pilose spore becomes the metabolism uridylic acid, the gene of this enzyme of encoding and application thereof.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on the larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (the Hepialus armoricanus Oberthur) larva.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various characteristics of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern worldwide enjoys high praise.The traditional Chinese medical science thinks that Cordyceps sinensis enters lung kidney two warps, and is can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc. are unique a kind of simultaneously balances, regulate the Chinese medicine of negative and positive.Modern pharmacology confirms that Cordyceps sinensis has the widely biological activity such as immunomodulatory, antibiotic, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual productions such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph conclusive evidence, activeconstituents compartment analysis and the mechanism of action, the Application and Development.The Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, so its output is very low, price is high.Wild cordyceps restricts scarcity of resources owing to factors such as being subjected to growing environment.Owing to made little progress at artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced the Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is suitable for large-scale industrialization production again.Its composition of the substitute of producing such as mycelium is also similar to natural cs with drug effect, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that the aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, proof is basically identical with natural cs chemical constitution, pharmacological action, can replace natural cs to produce cordyceps product, to remedy the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites all is significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, to progressively turning to deeper functional meta-bolites research by the direct utilization of Chinese caterpillar fungus raw material or crude extract in the worm grass product research and development.The Chinese caterpillar fungus meta-bolites has been done a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative researchs of functional meta-bolites at aspects such as biosynthesizing, pharmacological actions such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL win initial success.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein the miazines nucleosides comprises cytidine(C and uridine.Uridine (uracil riboside) claim again uridine (uIidine), and another name is by snow riboside, dihydro-pyrimidin nucleosides, the 1-β-D-ribosyl uridylic of muttering.Cytidine(C (cytosine riboside) has another name called cytidine (cytidine), cytidine, 1-β-D-furans nucleosides cytosine(Cyt).Pyrimidine nucleoside is multiduty nucleosides, can be used as the additive of healthcare products and food.It also becomes the requisite of people's life gradually as beauty treatment and anti-ultraviolet radiation makeup, as medicine, clinical application is in nervus centralis, uropoiesis, metabolism and many-sided disease such as cardiovascular, in the U.S., the nucleic acid medicine has shown irreplaceable effect at antiviral, anti-tumor aspect in recent years.

Studies show that cytidine mainly for the production of intermediate antitumor, antiviral, along with going deep into of antiviral, antitumor, treatment AIDS-treating medicine development, the demand of natural pyrimidine nucleoside is strengthened.Cytidine is as pyrimidine nucleoside, mainly for the production of intermediate antitumor, antiviral, be to make cytosine arabinoside (Ara-CR), cyclotidine (Cyclo C), cytidine (CTP), the cytidine diphosphate (main raw material of the medicine such as CDP-Choline).

Uridine is a kind of natural nucleosides, is the precursor of every other pyrimidine nucleotide, and uridylic acid is one of 4 kinds of main mononucleotides that consist of the nucleus ribosomal ribonucleic acid, has the pyrimidine ring structure, and it is synthetic that it participates in glycogen, helps to improve the hypoxia-bearing capability of cell.It also is the composition that consists of zooblast nucleic acid, can improve the body antibody horizontal, and uridine and derivative thereof can also be used to block various cancer cells and viral gene synthesizes, treatment cancer and the disease that is caused by virus.

Because the important physiological action of pyrimidine nucleoside and analogue thereof, related microorganism is produced the existing a lot of researchs of miazines nucleosides both at home and abroad.Yet, as the Cordyceps fungus of important anabolism miazines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in the Cordyceps fungus miazines nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism uridylic acid and further investigate, the enzyme (being the uridylic acid synthetic enzyme), encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation orotidylic acid to set out the anabolism uridylic acid.

The technical solution used in the present invention is:

The invention provides and a kind ofly produce bacterium Cordyceps sinensis China pilose spore from " hundred make " and participate in the set out Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme of anabolism uridylic acid of orotidylic acid: described enzyme has aminoacid sequence 90% above homology shown in aminoacid sequence shown in aminoacid sequence shown in the SEQ ID No.1, the SEQ ID No.3 or the SEQ ID No.5, and preferred described enzyme amino acid sequence is that pynC1 albumen, the sequence of SEQ ID No.1 is that pynC2 albumen or the sequence of SEQ ID No.3 is the pynC3 albumen of SEQ ID No.5; But this enzyme catalysis orotidylic acid prepares uridylic acid.Because the singularity of aminoacid sequence; any fragment or its variant that contains the peptide protein of aminoacid sequence shown in SEQ ID No.1, SEQ ID No.3 or the SEQ ID No.5; such as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology all belong to the row of protection domain of the present invention more than 90%.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in the aminoacid sequence; Wherein, for the conservative property change of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replacing Isoleucine with leucine, variant also can have non-conservation and change, as replacing glycine with tryptophane.

The invention still further relates to described uridylic acid synthetic enzyme and prepare application in the uridylic acid at the biocatalysis orotidylic acid.

Further, described being applied as: to contain the broken mixed solution of wet thallus after cytoclasis that Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme thalline fermentation culture obtains as catalyzer, take orotidylic acid as substrate, be in the transformation system that consists of of 6.5 ~ 8.5 buffered soln in pH, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition is after reaction finishes, with reacting liquid filtering, get the crude product that filtrate being contains uridylic acid, described crude product separation and purification obtains uridylic acid.

Further, the starting point concentration of described substrate is 10g/L, and the volumetric usage of described catalyzer is the 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

The path that is obtained uridylic acid by the orotidylic acid anabolism is shown below:

The preparation method of described catalyzer is: Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme recombinant bacterium is inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) 37 ℃, 250r/min overnight incubation.Get the 1mL culture, its transfer in the fresh LB liquid nutrient medium that contains the Kan resistance of 50mL 37 ℃, 250r/min are cultured to cell concentration OD600 and are about about 0.6～0.8, the IPTG inducing culture 8h that adds finite concentration (240mg/ml) in the culture, getting inducing culture liquid filters, collect wet thallus, the wet thallus 0.5g that takes by weighing collection suspends with phosphate buffered saline buffer (50mM, pH8.0) 15mL, and the thalline mixed solution that obtains after the ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) is as the catalysis enzyme.

The invention still further relates to the encoding gene of above-mentioned Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme, described gene has the homology of nucleotide sequence more than 90% shown in nucleotide sequence shown in nucleotide sequence shown in the SEQ ID No.2, the SEQ ID No.4 or the SEQ ID No.6, and preferred described gene order is that pynC1 gene, the sequence of SEQ ID No.2 is that pynC2 gene or the sequence of SEQ ID No.4 is the pynC3 gene of SEQ ID No.6.Because the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO:2, SEQ ID No.4 or the SEQ ID No.6 as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide change that has.The variant of these polynucleotide can make living displacement varient or the varient of non-life, comprises replacing varient, deletion mutation body and inserting varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from the function of the peptide protein that changes in fact its coding.

The invention still further relates to the application of described Cordyceps sinensis China pilose spore uridylic acid synthetase-coding gene in making up the genetic engineering bacterium that can the biocatalysis orotidylic acid prepares uridylic acid, to enlarge the output of uridylic acid or derivatives thereof.

Preferred described being applied as: make up the recombinant vectors that contains described Cordyceps sinensis China pilose spore uridylic acid synthase gene, described recombinant vectors is converted in the intestinal bacteria, the recombination engineering bacteria that obtains carries out inducing culture, and the nutrient solution separation and purification obtains to contain the somatic cells of Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme.

The enzyme work of Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme of the present invention is defined as: under optimum condition (30 ℃), can transform the enzyme amount of 1 micromole's orotidylic acid in 1 minute.

The bacterial strain that Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme of the present invention and encoding gene thereof can be provided is China pilose spore (Hirsutella Sinensis) L0106, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.

Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in SEQ ID NO:1, SEQ ID NO:3 or the SEQ ID NO:5 and SEQ ID NO:2, SEQ ID NO:4 or the SEQ ID NO:6, in the situation of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, all be apparent to those skilled in the art.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in great detail the synthetic uridylic acid pathways metabolism of orotidylic acid on principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, changes in the engineering bacteria in conjunction with the method that shifts, by regulating the expression of uridylic acid biosynthesis gene, give the high expression level of host's uridylic acid, for the output that enlarges the uridylic acid or derivatives thereof provides effective way, has the major application prospect.

(4) description of drawings

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is pyrimidine metabolic approach annotated map;

Fig. 3 is uridylic acid synthase gene pcr amplification product gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/pynC physical map;

Fig. 6 is recombinant expression plasmid pET-28a/pynC building process synoptic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/pynC physical map;

Fig. 8 is uridylic acid synthetase albumen SDS-PAGE figure.

(5) embodiment

The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: at first gather natural cordyceps from Qinghai, and it is taken back Hangzhou carry out separation screening, obtained the L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.

With this bacterial classification inoculation in the inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards again bevel in following ratio) be glucose 2.0%(w/v, contain 1g in the 1% expression 100mL substratum, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sal epsom 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water, cultivates 25 days at 12 ~ 16 ℃; Then with bacterial classification inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, sal epsom 0.01%, potassium primary phosphate 0.02%, surplus is water, place on the shaking table, 12 ~ 16 ℃ of cultivations of temperature 25 days under aseptic condition, are carried out solid-liquid separation after cultivation finishes, and solid (being wet thallus) placed aseptic utensil, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

Extract total RNA with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly adding liquid nitrogen fully is ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mixing leaves standstill 5min on ice, and the nucleic acid-protein mixture is separated fully.2) RNA separates: add the 0.2mL chloroform, firmly shake mixing 15s, leave standstill 2 ~ 3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, the upper strata water is got in layering, about 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol will precipitate and hang, and leave standstill 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Washing step above repeating is washed one time again.5) dissolving RNA: centrifuge tube is placed unlimited dry 5 ~ 10min on ice, add an amount of DEPC water dissolution, obtain " hundred make " and produce the total RNA of bacterium Cordyceps sinensis China pilose spore.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

After extracting the total RNA of sample, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, with the synthetic article one cDNA chain of hexabasic basic random primer (random hexamers), then synthesize second cDNA chain, pass through again QiaQuick PCR test kit purifying and add the EB buffer solution elution and do terminal reparation afterwards, add polyA and connect sequence measuring joints, then carrying out clip size with agarose gel electrophoresis selects, carry out at last pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains the adaptor sequence among the primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo(Li, Zhu et al. De novo assembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) do and transcribe group and from the beginning assemble.The reads that SOAPdenovo at first will have certain-length overlap is linked to be the longer Contig fragment that does not contain N.Then reads is compared back Contig, determine from the different Contig of same transcript and the distance between these Contig by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads that Scaffold is done filling-up hole and process, it is minimum to obtain at last containing N, the Unigene sequence that two ends can not prolong again.At last, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are blastx compare (evalue＜0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between the different sink is contradictory, then press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J]. In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, CA, pp. 1999,138-148.) predict its coding region and determine the direction of sequence.Provide its sequence from 5' to the 3' direction for the Unigene that can determine the sequence direction, provide the sequence that composite software obtains for the Unigene that can't determine the sequence direction.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function note, Pathway note, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.At first, by blastx with the Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue＜0.00001), obtain having the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway note of Unigene according to the KEGG annotation information.Unigene and COG database are compared, and the possible function of prediction Unigene is also done the function statistic of classification to it.According to the nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J]. Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.After obtaining the GO note of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations[J]. Nucleic Acids Research, 2006,34:293-297.) all Unigene are done GO functional classification statistics, from the gene function distribution characteristics of these species of macroscopic view understanding.

Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore uridylic acid pathways metabolism and analyzed

Fig. 2 is the pyrimidine metabolic (map00240) in the KEGG pathways metabolism note, the enzyme of note is that " hundred make " that has detected produced bacterium Cordyceps sinensis China pilose spore pyrimidine metabolic approach relevant enzymes, as can be seen from the figure, detected from 3 Unigene of uridylic acid synthetic enzyme of the synthetic uridylic acid of orotidylic acid.Detect online by the ORF Finder software among the NCBI, found out the open reading frame (SEQ ID No.2, SEQ ID No.4 and SEQ ID No.6) of this gene and obtained corresponding protein sequence (SEQ ID No.1, SEQ ID No.3 and SEQ ID No.5).

Embodiment 7: " hundred make " produces bacterium Cordyceps sinensis China pilose spore uridylic acid synthase gene design of primers

The gene open reading frame dna sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, be used for the uridylic acid synthase gene that clone's " hundred make " produces bacterium China pilose spore anabolism uridylic acid, primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, and primer sequence is following listed:

PynC1 gene: forward primer 5 ' AGAGAATTCATGTTGGCTGACGCTAGGGTC3 '

Reverse primer 5 ' ATAAAGCTTTCACCCTCTGCCGCACCAACTTG3 '

The pynC1 mrna length is 414bp

PynC2 gene: forward primer 5 ' ATTGGATCCATGCAGTACACTGGCGGCTC3 '

Reverse primer 5 ' ATTGAGCTCTCAGCGAACTCTCTCGAGGTATG3 '

The pynC2 mrna length is 768bp

PynC3 gene: forward primer 5 ' ATAGAATTCATGGCGTCTCAGCTGCCCGCG3 '

Reverse primer 5 ' AGCAAGCTTTCACTTAGTTGGCGGGTACTTG3 '

The pynC3 mrna length is 738bp

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

After the method that provides according to embodiment 1 is first turned out sutella sinensis fermented mycelium, the method that provides according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following behind total RNA, be used for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) the following mixed solution of preparation in the Microtube pipe.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, can improve reverse transcription reaction efficient, so carry out sex change, annealing reaction at the PCR instrument, condition setting is as follows:

65℃，5 min。

3) the centrifugal several seconds made the mixed solution of template ribonucleic acid/primer etc. be gathered in Microtube pipe bottom after annealing finished.

4) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.

5) on the PCR instrument, carry out reverse transcription reaction by following condition.

42℃ 15～30 min

70℃ 15 min

Generalized case, at eukaryote mRNA 3 ' end a PolyA structure is arranged, the quantity of A base does not wait to hundreds of is individual ten, utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain take mRNA as template, the present invention adopts the sequence (providing among the PrimeScript 1st Strand cDNA Synthesis Kit) in the dT zone of being developed alone by TaKaRa to be primer, if the mRNA integrity that obtains is better, can obtain so cDNA first chain of all zymoprotein encoding genes in the species by the reverse transcription process.

Embodiment 9: " hundred make " produces the detection of bacterium Cordyceps sinensis China pilose spore anabolism uridylic acid functional gene uridylic acid synthetic enzyme pynC gene cloning, expression and protein vigor

1, the pcr amplification of uridylic acid synthetic enzyme pynC1/C2/C3 gene

CDNA the first chain that obtains in the embodiment 8 is as template, with pyn C1 gene primer synthetic among the embodiment 7: 5 ' AGA GAA TTC ATG TTG GCT GAC GCT AGG GTC 3 ', 5 ' ATA AAG CTT TCA CCC TCT GCC GCA CCA ACT TG 3 ', pyn C2 gene primer: 5 ' ATT GGA TCC ATG CAG TAC ACT GGC GGC TC 3 ', 5 ' ATT GAG CTC TCA GCG AAC TCT CTC GAG GTA TG 3 ', pyn C3 gene primer: 5 ' ATA GAA TTC ATG GCG TCT CAG CTG CCC GCG 3 ', 5 ' AGCAAGCTTTCACTTAGTTGGCGGGTACTTG 3 ' carries out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, uridylic acid synthetic enzyme pynC1, pynC2, pynC3 gene PCR product gel electrophoresis detection

Concrete detection method is: 0.9% the sepharose that 1) will prepare makes its dissolving evenly with microwave-oven-heating; 2) get the 15mL gel, when treating that gel is cooled to 50 ℃ of left and right sides, add 1 μ L staining fluid Gold view, pour on the treatments of Electrophoretic Slab Gels after mixing, remove and insert the point sample comb behind the bubble; 3) after gel solidifies, carefully take out the point sample comb, offset plate is put into electrophoresis chamber (point sample hole one end is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add the TAE electrophoretic buffer; 4) get 5 μ L samples and then add 6 * Loading Buffer, 1.5 μ L and ddH ₂Using liquid-transfering gun loading, applied sample amount after O 4 μ L mix is 10 μ L; 5) supply lead between connection electrophoresis chamber and the electrophoresis apparatus, just very red, negative pole is black; 6) power-on, the beginning electrophoresis, maximum voltage is no more than 5 V/cm; 7) when sample ran offset plate 2/3 the time can stop electrophoresis; 8) cut off the electricity supply after, gel taken out puts into the gel imaging instrument and observe, take pictures.

The size of transcribing group order-checking prediction uridylic acid synthetic enzyme pynC1, pynC2 and pynC3 gene is 414bp, 768bp, 738bp, and agarose gel electrophoresis result (Fig. 3) shows and successfully amplified uridylic acid synthetic enzyme pynC1, pynC2 and pynC3 gene.

3, the base A that adds of uridylic acid synthetic enzyme pynC1, pynC2 and pynC3 gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier after after glue reclaims, also need adding base A processing, purifying.It is as follows that glue recovery product adds base A system:

72 ℃ add A base 20 min in the PCR instrument, use at last AxyPrep PCR cleaning agents box purifying.

4, uridylic acid synthetic enzyme pynC1, pynC2 and pynC3 gene and cloning vector is connected

Cloning vector pMD18-T Vector is available from TaKaRa company (TaKaRa code D101A), its physical map is seen Fig. 4, uridylic acid synthetic enzyme pynC1, pynC2 be connected with the pynC3 gene be connected construction recombination plasmid pMD18-T/pynC1, pMD18-T/pynC2 and pMD18-T/pynC3 with cloning vector, physical map is seen Fig. 5, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 ℃, 16h; Deactivation: 65 ℃, 15min.

5, the conversion of uridylic acid synthetic enzyme recombinant plasmid pMD18-T/pynC1, pMD18-T/pynC2, pMD18-T/pynC3

Respectively recombinant plasmid pMD18-T/pynC1, pMD18-T/pynC2, pMD18-T/pynC3 are changed over to and make up recombinant bacterium E.coliJM109/pMD18-T/pynC1, E.coliJM109/pMD18-T/pynC2, the E.coli JM109/pMD18-T/pynC3 that carries uridylic acid synthetic enzyme pynC1, pynC2 and pynC3 gene among the intestinal bacteria E. coli JM109.Concrete steps are: 1) 10 μ L reaction systems are gone among the competent cell E. coli JM109 ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 ℃, 250rpm, 1h; 5) spread plate (containing the Amp resistance); 6) 37 ℃ of incubator overnight incubation.

6, uridylic acid synthetic enzyme E. coli JM109/pMD18-T/pynC1, E. coli JM109/pMD18-T/pynC2, the positive restructuring of E. coli JM109/pMD18-T/pynC3 screening

Bacterium colony PCR can extract genomic dna, and the DNA that directly exposes after the thalline pyrolysis carries out pcr amplification as template, and whether the method is easy and simple to handle, quick, can the Rapid identification bacterium colony be the positive bacterium colony that contains the purpose plasmid.Bacterium colony at first adds with toothpick picking list bacterium colony and to contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters, boiling water bath 30min, then centrifugal with supernatant as template, carry out pcr amplification, the PCR program setting is Taq enzymatic amplification general procedure.Adopt at last 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of uridylic acid synthetic enzyme recombinant plasmid pMD18-T/pynC1, pMD18-T/pynC2, pMD18-T/pynC3

After the detected positive recombinant bacterium liquid LB culture medium culturing of bacterium colony PCR spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is finished by Shanghai Sani's bio tech ltd.Through sequence verification, sequence SEQ ID No.2, SEQ ID No.4 and SEQ ID No.6 recombinate respectively to recombinant plasmid pMD18-T/pynC1, pMD18-T/pynC2 and pMD18-T/pynC3.

8, the structure of uridylic acid synthetic enzyme recombinant expression plasmid pET-28a/pynC1, pET-28a/pynC2, pET-28a/pynC3

The experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and uridylic acid synthetic enzyme pynC1, pynC2, pynC3 gene restriction enzyme site comparison situation, determined that pynC1 and pynC3 are EcoR I and Hind III double enzyme site, pynC2 is the BamHI/SacI restriction enzyme site, and recombination bacillus coli E. coli JM109/pMD18-T/pynC1, E. coli JM109/pMD18-T/pynC2 and E. coli JM109/pMD18-T/pynC3 are carried out the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

The recombinant plasmid pMD18-T/pynC1 of uridylic acid synthetic enzyme pynC1 and pynC3 gene and pMD18-T/pynC3 and expression vector pET-28a respectively with BamHI/SacI III restriction enzyme 37 ℃ respectively enzyme cut and process 6h, the recombinant plasmid pMD18-T/pynC2 of pynC2 gene and expression vector pET-28a process 6h with the BamHI/SacI restriction enzyme at 37 ℃, and it is as follows that enzyme is cut system:

BamH I/SacI double digestion system:

Enzyme is cut and is finished rear 65 ℃ of deactivation 15min, then respectively with Axygen dna gel recovery test kit reclaim, purifying.

Uridylic acid synthetic enzyme pynC1, pynC2, pynC3 gene and expression vector pET-28a spend the night with 16 ℃ of connections of T4 ligase enzyme behind double digestion, purifying again, make up recombinant expression plasmid pET-28a/pynC1, pET-28a/pynC2, pET-28a/pynC3, its building process is seen Fig. 6, makes up recombinant expression plasmid pET-28a/pynC1, the pET-28a/pynC2, the pET-28a/pynC3 collection of illustrative plates that obtain and sees Fig. 7.Linked system is composed as follows:

Linked system:

9, the conversion of uridylic acid synthetic enzyme recombinant expression plasmid pET-28a/pynC1, pET-28a/pynC2, pET-28a/pynC3 and the screening of positive monoclonal

The expression plasmid heat shock that builds is converted in the E. coli BL21 Host Strains, then is applied on the LB agar plate that contains (50mg/L) kantlex (Kan) resistance 37 ℃ of overnight incubation.Random choose list bacterium colony from the flat board carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of uridylic acid synthetic enzyme recombinant bacterium E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2 and E. coli BL21/pET-28a/pynC3

Be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) 37 ℃, 250r/min overnight incubation with being accredited as positive mono-clonal.Get the 1mL culture, its transfer in the LB liquid nutrient medium of the fresh Kan of the containing resistance of 50mL (50mg/L) 37 ℃, 250r/min are cultured to cell concentration OD600 and are about about 0.6～0.8.The IPTG inducing culture 8h that adds respectively finite concentration (240mg/mL) in the culture.Collecting wet thallus surveys for electrophoresis analysis and enzyme biopsy.

11, uridylic acid synthetic enzyme recombinant bacterium E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2 and E. coli BL21/pET-28a/pynC3 expression product SDS-PAGE analyze

With the E. coli BL21 bacterium that changes empty carrier over to and the recombinant bacterium that do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium behind IPTG inducing culture 8h, get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in the 50 μ L distilled water, add 50 μ L sample-loading buffers, boil 10min behind the mixing, carry out the SDS-PAGE electrophoretic analysis, " C1 " among Fig. 8, " C2 ", " C3 " swimming lane namely is respectively recombinant bacterium E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2, E. the uridylic acid synthetase albumen pynC1(of coli BL21/pET-28a/pynC3 expression is shown in the SEQ ID No.1 through its aminoacid sequence of sequence verification), pynC2(is shown in the SEQ ID No.3 through its aminoacid sequence of sequence verification), pynC3(is shown in the SEQ ID No.5 through its aminoacid sequence of sequence verification) SDS-PAGE figure.

12, the protein-active of uridylic acid synthetic enzyme recombinant bacterium E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2 and E. coli BL21/pET-28a/pynC3 detects

Enzyme liquid preparation: take by weighing recombinant bacterium E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2 and each 0.5g(dry weight 0.1g of E. coli BL21/pET-28a/pynC3 wet thallus that method 10 is collected), use respectively phosphate buffered saline buffer (50mM, pH8.0) 15mL to suspend, be used as the catalysis enzyme after the ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).

Uridylic acid synthetic enzyme pynC transformation system: in 50mL conversion bottle, add respectively E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2 and E. coli BL21/pET-28a/pynC3 ultrasonication thalline mixed solution 10mL, 0.1g orotidylic acid, 30 ℃, 150r/min conversion reaction 2 ~ 3h, after transforming end, conversion fluid is centrifugal, and it is standby with subsequent detection to get respectively supernatant.

Detection method: the conversion situation of high performance liquid chromatography detection by quantitative uridylic acid.Pre-treatment: after conversion fluid was centrifugal, supernatant liquor was crossed 0.22 μ m microporous membrane and is used for the high performance liquid chromatography detection.Condition: chromatographic column: Agilent C18 post (4.6mm * 250mm i.d.5 μ m); Column temperature: 35 ℃; Sampling volume: 20 μ L; Flow velocity 1mL/min; Detect wavelength 260nm; Moving phase: A: ultrapure water; B: methyl alcohol.Gradient elution: 0min, 15%B keeps 3min; 3.0-3.5min, 15-24%B; 3.5min 24% keeps 5min; 8.5-9.0min, 24-35%B; 35%B keeps 6min; 15.0-16.0min, 35-85%B; 85%B keeps 6min; 22.0-22.5min, 85%-15%B; 15%B keeps 5min.

The making of typical curve: accurately take by weighing the uridylic acid standard substance, about 1.00mg-2.00mg, ultrapure water constant volume.Standard substance preparation 6 gradients (1 μ g/mL, 30 μ g/mL, 60 μ g/mL, 90 μ g/mL, 120 μ g/mL, 150 μ g/mL).Then loading successively, each concentration repeats for 5 times.After the reference liquid of getting the certain volume maximum concentration mixes, constant volume, then HPLC analyzes the optimal conditions that uridylic acid detects.

Detect and calculate through above-mentioned chromatographic condition, we draw to draw a conclusion: the expressed oxidasic high specific enzyme of uridylic acid synthetic enzyme (Specific Activity) alive of uridylic acid synthetic enzyme recombinant bacterium E. coli BL21/pET-28a/pynC1, E. coli BL21/pET-28a/pynC2 and E. coli BL21/pET-28a/pynC3 is respectively 65mol/min/mg, 63mol/min/mg, 59mol/min/mg, and substrate conversion efficiency is respectively 76%, 72% and 69%.

SEQUENCE LISTING

＜110〉Zhejiang Polytechnical University, Zhongmei Huadong Pharmaceutical Co., Ltd. Hangzhou

＜120〉Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme, encoding gene and application thereof

<130>

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 138

<212> PRT

<213> Hirsutella Sinensis

<400> 1

Met Leu Ala Asp Ala Arg Val Thr Gln Gly Ser Gly Arg Ala Gly Ser

1 5 10 15

Leu Gly Lys Pro Gln Ala Ala Arg Trp Ala Thr Val Lys Ala Arg Gly

20 25 30

Leu Gly Arg Arg Arg Trp Ile Ser Met Asp Val Leu Ser Lys Thr Ser

35 40 45

Val Met Val Asp Gly Arg Leu Gly Gly Leu Arg Thr Ser Pro Ser Asn

50 55 60

Arg Arg Asp Ala Leu Lys Arg Trp Ser Val Pro Ala Glu Ile Lys Asp

65 70 75 80

Glu Glu Glu Glu Ile Asn Ser Arg Asp Val Ser Arg Val Ile Ser Ser

85 90 95

Trp Arg Glu Trp Gln Glu Leu Gly Pro Val Trp Glu Glu Gly Asp Pro

100 105 110

Thr Arg Ser Ala Ala Val Glu Arg Glu Glu Gln Gln Gly Gln Val Ala

115 120 125

Ala Thr Leu Ala Ser Trp Cys Gly Arg Gly

130 135

<210> 2

<211> 414

<212> DNA

<213> Hirsutella Sinensis

<400> 2

atgttggctg acgctagggt cacccaggga tccggacggg cgggttcgct ggggaagccc 60

caagccgcca ggtgggcgac agtcaaggcc cggggcctgg ggagacggcg ttggatatcg 120

atggacgtat taagcaaaac aagcgtgatg gtagacgggc gtttgggagg ccttcggacg 180

agtccctcaa atcgtcgaga cgccttgaag cgttggtcag ttccggccga gatcaaagac 240

gaagaagaag aaataaacag tcgcgacgtg agccgagtga tcagcagttg gagggagtgg 300

caggagctcg ggccagtgtg ggaggagggg gatccgacga gatcagcagc tgtcgagagg 360

gaggaacagc agggtcaggt ggcggcgaca cttgcaagtt ggtgcggcag aggg 414

<210> 3

<211> 255

<212> PRT

<213> Hirsutella Sinensis

<400> 3

Met Gln Tyr Thr Gly Gly Ser Ala Arg Ile Ile Glu Trp Ala His Met

1 5 10 15

Val Asn Val Asn Met Val Pro Gly Lys Ala Ser Val Thr Ser Leu Ala

20 25 30

Asn Ala Ala Ser Arg Trp Phe Glu Arg Tyr Pro Tyr Glu Val Lys Thr

35 40 45

Ser Val Thr Val Gly Thr Pro Thr Ala Asp Asp Ser Asp Asp Pro Asp

50 55 60

Asn Ser Ala Arg Gly Asp Asp Asp Asp Ala Lys Tyr Ile Arg Arg Ala

65 70 75 80

Asp Glu Gly Arg Lys Gly Ser Ile Val Ser Val Thr Thr Val Thr Gln

85 90 95

Gln Tyr Glu Pro Ala Asn Ser Pro Arg Leu Ala Lys Asn Met Thr Gly

100 105 110

Gly Asp Glu Val Leu Phe Ala Gly Ile Asp Glu Ala Pro Ile Thr Arg

115 120 125

Gly Leu Leu Ile Leu Ala Gln Met Ser Ser Gln Gly Asn Phe Met Asn

130 135 140

Arg Glu Tyr Thr Gln Ala Cys Val Glu Ala Ala Arg Glu His Lys Glu

145 150 155 160

Phe Val Met Gly Phe Val Ser Gln Glu Ser Leu Asn Ser Glu Pro Asp

165 170 175

Asp Asp Phe Ile His Met Thr Pro Gly Cys Gln Leu Pro Pro Asp Asp

180 185 190

Glu Asp Arg Asn Gly Ala Val Pro Gly Asp Ser Lys Gly Gln Gln Tyr

195 200 205

Asn Thr Pro Gln Lys Ile Ile Gly Val Cys Gly Thr Asp Ile Val Ile

210 215 220

Val Gly Arg Gly Ile Leu Lys Ala Gly Asp Pro Gln Glu Glu Ala Glu

225 230 235 240

Arg Tyr Arg Ser Lys Ala Trp Lys Ala Tyr Leu Glu Arg Val Arg

245 250 255

<210> 4

<211> 768

<212> DNA

<213> Hirsutella Sinensis

<400> 4

atgcagtaca ctggcggctc ggctcgcatc attgaatggg cgcacatggt caacgtcaac 60

atggtcccgg gcaaggcgtc ggtgacgtcg cttgccaatg ctgcgtcgcg ttggttcgag 120

cggtatccct acgaggtcaa gacgtcggtc acggtgggca ccccgacggc cgacgactcc 180

gacgaccccg acaactcggc ccggggtgac gacgacgacg caaagtatat ccgccgggct 240

gacgaggggc gcaagggtag catcgtttcc gtcaccaccg tcacccagca gtacgagcca 300

gccaactctc cccgcctggc caagaacatg accgggggcg acgaggtgct gtttgccggc 360

atcgacgagg cgcccatcac cagaggcctg ctcatcctgg cgcaaatgtc gagccagggc 420

aacttcatga acagggagta cacacaagct tgcgtcgagg ccgccaggga gcacaaggaa 480

ttcgtcatgg gctttgtctc ccaggagagc ctcaactcgg agcccgacga cgactttatc 540

cacatgacgc cgggctgcca gctgccgccc gatgatgagg atcgcaacgg cgcggtgccg 600

ggagacagca agggtcagca gtataacacg ccgcagaaga tcataggggt ctgcggcacc 660

gacattgtca ttgtcggacg gggcatcctc aaggccggag atccgcaaga ggaagccgag 720

aggtatcgat ccaaggcctg gaaggcatac ctcgagagag ttcgctga 768

<210> 5

<211> 245

<212> PRT

<213> Hirsutella Sinensis

<400> 5

Met Ala Ser Gln Leu Pro Ala Tyr Lys Gln Asp Phe Leu His Ala Ala

1 5 10 15

Ile Ala Gly Gly Ala Leu Lys Phe Gly Ser Phe Glu Leu Lys Ser Gly

20 25 30

Arg Ile Ser Pro Tyr Phe Phe Asn Ala Gly Glu Phe His Thr Ala Arg

35 40 45

Leu Ala Gly Ala Ile Ser Ser Ala Phe Ala Gln Thr Ile Ile Asp Ala

50 55 60

Gln Gln Lys Ser Gly Leu Glu Phe Asp Val Val Phe Gly Pro Ala Tyr

65 70 75 80

Lys Gly Ile Pro Leu Cys Ser Ala Ile Ala Ile Lys Ile Gly Glu Leu

85 90 95

Ala Pro Ser Gln Leu Asp Ala Ile Ala Tyr Ser Phe Asp Arg Lys Glu

100 105 110

Ala Lys Asp His Gly Glu Gly Gly Asn Ile Val Gly Ala Pro Leu Lys

115 120 125

Gly Lys Arg Val Leu Ile Val Asp Asp Val Ile Thr Ala Gly Thr Ala

130 135 140

Lys Arg Glu Ala Ile Glu Lys Ile Arg Asn Glu Gly Gly Ile Val Ala

145 150 155 160

Gly Ile Val Val Ala Leu Asp Arg Met Glu Lys Leu Pro Ala Ala Asp

165 170 175

Gly Asp Asp Ile Lys Pro Gly Pro Ser Ala Ile Gly Glu Leu Arg Arg

180 185 190

Glu His Gly Ile Pro Ile Leu Ala Ile Leu Thr Leu Asp Asp Ile Ile

195 200 205

Gln Gly Met Lys Ser Phe Ala Thr Ala Asp Asp Val Arg Arg Thr Glu

210 215 220

Glu Tyr Arg Gln Gln Tyr Lys Ala Thr Asp Gln Glu Ala Arg His Lys

225 230 235 240

Tyr Pro Pro Thr Lys

245

<210> 6

<211> 738

<212> DNA

<213> Hirsutella Sinensis

<400> 6

atggcgtctc agctgcccgc gtacaagcaa gacttcctcc atgccgccat tgccgggggg 60

gctctcaagt ttggcagctt cgagctcaag tcagggagga tatcgcctta ctttttcaac 120

gctggcgagt ttcacactgc gcgccttgcc ggagccatct cctccgcctt tgcccagacc 180

atcatcgacg cccagcagaa gagcggcctc gagtttgacg tcgtctttgg gcctgcgtac 240

aagggaatcc ctctctgctc cgccatcgcc atcaagatag gcgagctggc cccctcgcag 300

ctcgacgcaa tcgcctactc gtttgaccgc aaagaggcca aggaccatgg cgagggcggc 360

aatattgtcg gagcgcccct caagggcaag agagttctca tagtcgacga cgtcatcacc 420

gccggaaccg ccaagagaga ggccatcgaa aagatccgca acgagggcgg catcgtggca 480

ggcattgttg tggcgctgga tcgcatggag aagctccctg ctgcagacgg cgacgatatc 540

aagcccggcc ccagcgccat cggtgaactc agacgagagc acggcattcc gattctcgct 600

atcctgacgt tggacgatat catccaaggc atgaagagct ttgctaccgc cgacgacgtg 660

aggcggaccg aggagtatcg gcagcagtat aaggctacgg accaggaggc acgccacaag 720

tacccgccaa ctaagtga 738

Claims (10)

1. a Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme is characterized in that described enzyme has aminoacid sequence 90% above homology shown in aminoacid sequence shown in aminoacid sequence shown in the SEQ ID No.1, the SEQ ID No.3 or the SEQ ID No.5.

2. Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme as claimed in claim 1, the aminoacid sequence that it is characterized in that described enzyme is shown in the SEQ ID No.1, shown in the SEQ ID No.3 or shown in the SEQ ID No.5.

3. Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme prepares application in the uridylic acid at the biocatalysis orotidylic acid as claimed in claim 1.

4. application as claimed in claim 3, it is characterized in that described being applied as: to contain the broken mixed solution of wet thallus after cytoclasis that Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme thalline fermentation culture obtains as catalyzer, take orotidylic acid as substrate, be in the transformation system that consists of of 6.5 ~ 8.5 buffered soln in pH, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition, after reaction finishes, with reacting liquid filtering, get the crude product that filtrate being contains uridylic acid, described crude product separation and purification obtains uridylic acid.

5. application as claimed in claim 4, the starting point concentration that it is characterized in that described substrate is 10g/L, and the volumetric usage of described catalyzer is the 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

6. gene of the described enzyme of claim 1 of encoding.

7. gene as claimed in claim 6 is characterized in that described gene has the homology of aminoacid sequence more than 90% shown in aminoacid sequence shown in aminoacid sequence shown in the SEQ ID No.2, the SEQ ID No.4 or the SEQ ID No.6.

8. gene as claimed in claim 7 is characterized in that the nucleotides sequence of described gene is classified as shown in SEQ ID No.2, SEQ ID No.4 or the SEQ ID No.6.

9. such as the application of gene as described in one of claim 6 ~ 8 in making up the genetic engineering bacterium that can the biocatalysis orotidylic acid prepares uridylic acid.

10. application as claimed in claim 9, it is characterized in that described being applied as: make up the recombinant vectors that contains described Cordyceps sinensis China pilose spore uridylic acid synthase gene, described recombinant vectors is converted in the intestinal bacteria, the recombination engineering bacteria that obtains carries out inducing culture, and the nutrient solution separation and purification obtains to contain the somatic cells of Cordyceps sinensis China pilose spore uridylic acid synthetic enzyme.

Images