CN102690800A - Enzyme for synthesizing and metabolizing xanthine of Cordyceps sinensis(Berk.)Sacc. Hirsutella sinensis, and gene and application of enzyme - Google Patents

Abstract

The invention relates to a guanine deaminase for synthesizing and metabolizing an xanthine from guanine of Cordyceps sinensis(Berk.)Sacc. Hirsutella sinensis from 'Bailing' production strain, a gene coding the enzyme and application of the guanine deaminase. The guanine deaminase comprises the proteins shown in SEQ ID No. 1 and SEQ ID No. 2, and the coding gene of the guanine deaminase corresponds to the nucleotide sequence shown in SEQ ID No. 3 and SEQ ID No.4. According to the invention, the metabolizing way for synthesizing the xanthine from the guanine is researched in detail from the principle, comprising: the cloned DNA of the nucleotide sequence provided by the invention can be transferred to an engineering strain by transduction, transformation, and combined transfer; the expression of the gene is biologically synthesized by regulating the xanthine, the host xanthine is given high expressivity, an effective way is provided to increase the yield of the xanthine, and the invention has a great application prospect.

Description

The xanthic enzyme of entomophyte China pilose spore anabolism, gene and application thereof

(1) technical field

The present invention relates to a participation guanine of producing bacterium entomophyte China pilose spore from " hundred make " the xanthic guanase of anabolism that sets out, the gene of this enzyme of encoding and application thereof.

(2) background technology

Entomophyte (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on the larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (the Hepialus armoricanus Oberthur) larva.Entomophyte is one type of traditional fungi herb resource of treasuring, has the various characteristics of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Entomophyte with its multiple medicinal efficacy extensively, obviously receive much concern worldwide enjoys high praise.The traditional Chinese medical science thinks that entomophyte is gone into lung kidney two warps, and is can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc. are unique a kind of balances simultaneously, regulate the Chinese medicine of negative and positive.Modern pharmacology confirms that entomophyte has wide biological activity such as immunomodulatory, antibiotic, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, in its life history, has conidium stage (anamorph) and thecaspore stage (teleomorph).And what in actual productions such as artificial culture, liquid fermenting, use is the Cordyceps fungus in imperfect stage, thereby the evaluation of entomophyte anamorph is extremely important.Chinese scholars is being done a lot of work aspect entomophyte resource exploration, anamorph conclusive evidence, activeconstituents compartment analysis and the mechanism of action, the Application and Development.The entomophyte China pilose spore has been proved to be the anamorph existence form of entomophyte, has activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, so its output is very low, and expensive.Wild cordyceps restricts scarcity of resources owing to factors such as receiving growing environment.Owing on artificial culture, made little progress in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves entomophyte medicine source.Chinese caterpillar fungus fermentation is produced the Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, does not receive weather, geographical environment and Chinese caterpillar fungus parasitic conditions strict restriction again, is suitable for large-scale industrialization production.Its composition of substitute of producing such as mycelium is also similar with natural cs with drug effect, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that the aweto cultured by artificial fermentation China pilose spore obtains; Through toxicity, pharmacology, plant research; Proof and natural cs chemical constitution, pharmacological action basically identical can replace natural cs to produce cordyceps product, to remedy the shortage of natural resources; Through to Optimizing Conditions of Fermentation, the amount of mycelial biomass and meta-bolites all is significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, to progressively turning to deeper functional meta-bolites research in the worm grass product research and development by the direct utilization of Chinese caterpillar fungus raw material or crude extract.The Chinese caterpillar fungus meta-bolites has been done a large amount of research both at home and abroad; Meta-bolites mainly comprises several big compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative researchs of functional meta-bolites at aspects such as biosynthesizing, pharmacological actions such as purine class nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL win initial success.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein purine class nucleosides comprises adenosine and guanosine and their precursor species material inosine (inosine) and xanthosine-etc.Research shows that adenosine can be used as the disease treatment medicine, also can be used for diagnosis of coronary heart disease, and its analogue has antiviral activity and antitumor action; Inosine can be used for treatment of diseases such as heart trouble, hepatopathy, leukopenia, thrombocytopenia, optic atrophy and central serous chorioretinopathy, can prevent and remove by the drug-induced spinoff to heart or liver of the prevention and cure of schistosomiasis; Guanosine then can be used as the synthesis material of many antiviral such as ribavirin, acycloguanosine.

Because the important physiological effect of purine nucleoside and analogue thereof, related microorganism is produced the existing a lot of researchs of purine class nucleosides both at home and abroad.(Matsui such as Matsui; Sato et al.Mutation of an inosine-producing strain of Bacillus subtilis to DL-methionine sulfoxide resistance for guanosine production [J] .Applied and Environmental Microbiology; 1997,34 (4): 337-341.) inosine production bacterium B.subtilis1411 is carried out mutagenic treatment and obtain guanosine high yield bacterium AG169.In order further to improve production level; The domestic researchist of having has carried out studying (Qian to the genetic background of producing purine nucleoside route of synthesis in the bacterium; Cai et al.Analysis of three nucleotide sequences involved in purine nucleotides biosynthesis in inosine and guanosine-producing bacilus subtilis.Acta Microbiologica Sinica; 2003,43 (2): 200-205.).This research has disclosed the part hereditary property of producing bacterium from molecular level, helps to understand product at gene level and is producing the accumulation in the bacterium.

At present; It is main with subtilis that applied purine class nucleosides is produced bacterium; And as the Cordyceps fungus of important anabolism purine class nucleosides; Also only rest in the research of meta-bolites composition analysis and effect, also rarely found to genes involved and proteic research in the Cordyceps fungus purine class nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is the deficiency and the technical issues that need to address to above existence; " hundred make " produced bacterium entomophyte xanthic enzyme of China pilose spore anabolism and encoding sox is furtherd investigate, provide " hundred makes " to produce bacterium entomophyte China pilose spore participation guanine the set out xanthic enzyme of anabolism, encoding sox and application thereof.

The technical scheme that the present invention adopts is:

Produce bacterium entomophyte China pilose spore from " hundred make " for one and participate in the guanine xanthic guanase of anabolism that sets out: sequence is that punG1 albumen and the sequence of SEQ ID No.1 is the punG2 albumen of SEQ ID No.2; But this enzyme catalysis guanine prepares xanthine.

It is following to obtain xanthic path by the guanine anabolism:

The invention still further relates to described guanase enzyme and prepare the application in the xanthine at the biocatalysis guanine.

The invention still further relates to the encoding sox of above-mentioned guanase enzyme, i.e. the guanase gene: sequence is that punG1 gene and the sequence of SEQ ID No.3 is the punG2 gene of SEQ ID No.4.

Described gene can be used for making up and can prepare xanthic genetic engineering bacterium by the biocatalysis guanine, to enlarge the output of xanthine or derivatives thereof.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in great detail the synthetic xanthine pathways metabolism of guanine on principle; The cloned DNA that comprises nucleotide sequence provided by the present invention can be used for through transduction, transform, combines the method for transfer to change in the engineering bacteria; Through regulating the expression of xanthine biosynthesis gene; Give the host xanthic high expression level property,, have the major application prospect for the output that enlarges the xanthine or derivatives thereof provides effective way.

(4) description of drawings

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produced the total RNA of bacterium entomophyte China pilose spore;

Fig. 2 is a purine metabolism approach annotated map;

Fig. 3 is a guanase gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28b physical map;

Fig. 5 is reorganization cloned plasmids pMD18-T/punC physical map;

Fig. 6 is a recombinant expression plasmid pET-28b/punC building process synoptic diagram;

Fig. 7 is a recombinant expression plasmid pET-28b/punC physical map;

Fig. 8 is guanase protein SDS-PAGE figure.

(5) embodiment

Below in conjunction with specific embodiment the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produced the cultivation of bacterium entomophyte China pilose spore

Bacterium source: at first gather natural cordyceps from Qinghai; And it is taken back Hangzhou carry out separation screening; Obtained the L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at China typical culture collection center; Deposit number is CCTCC No:M 2011278, is formerly disclosing among the patented claim CN102373190A.

With this bacterial classification inoculation in the inclined-plane; (this is the liquid formulations before solidifying to culture medium prescription; Prepare afterwards bevel again in following ratio) be glucose 2.0% (w/v contains 1g in the 1% expression 100mL substratum, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sal epsom 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%; Surplus is a water, cultivates 25 days at 12 ~ 16 ℃; Then with bacterial classification inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, sal epsom 0.01%, potassium primary phosphate 0.02%, surplus is a water; Place on the shaking table; Temperature was cultivated 25 days for 12 ~ 16 ℃, cultivated and finished the back under aseptic condition, carried out solid-liquid separation; And solid placed aseptic utensil, subsequent use.

Embodiment 2: " hundred make " produced the extraction of the total RNA of bacterium entomophyte China pilose spore

Extract total RNA with TRIzol reagent; Step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, add liquid nitrogen repeatedly and fully be ground to Powderedly, divide to install in the 1.5mL centrifuge tube of precooling; Add 1mLTRIzol reagent; Mixing leaves standstill 5min on ice, and the nucleic acid-protein mixture is separated fully.2) RNA separates: add the 0.2mL chloroform, firmly shake mixing 15s, leave standstill 2 ~ 3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, the upper strata water is got in layering, about 600 μ L.3) RNA deposition: add 500 μ L Virahols, leave standstill 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm abandon supernatant.4) RNA washing: add 1mL 75% (v/v) ethanol, will precipitate and hang, leave standstill 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Washing step above repeating is washed one time again.5) dissolving RNA: centrifuge tube is placed unlimited dry 5 ~ 10min on ice, add an amount of DEPC water dissolution.

Embodiment 3: " hundred make " produced the order-checking of bacterium entomophyte China pilose spore RNA sample

After extracting the total RNA of sample, with the enrichment with magnetic bead mRNA that has Oligo (dT).Add fragmentation buffer mRNA is broken into short segments (200 ~ 700bp); With mRNA is template; With the synthetic article one cDNA chain of hexabasic basic random primer (random hexamers); Synthetic then second cDNA chain is done terminal repair, adds polyA and is connected sequence measuring joints through QiaQuick PCR test kit purifying and after adding the EB buffer solution elution again, carries out clip size with agarose gel electrophoresis then and selects; Carrying out pcr amplification at last, checks order with Illumina GA IIx in the order-checking library of building up.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains the adaptor sequence among the primitive sequencer reads, be equipped with subsequent analysis.

Embodiment 4: " hundred make " produced the short sequence assembling of reading of bacterium entomophyte China pilose spore RNA

Use short reads composite software SOAPdenovo (Li; Zhu et al.De novo assembly of human genomes with massively parallel short read sequencing [J] .Genome Res; 2010,20:265-272.) do and transcribe group and from the beginning assemble.The reads that SOAPdenovo at first will have certain-length overlap is linked to be the longer Contig fragment that does not contain N.Then reads is compared back Contig; Confirm from the different Contig of same transcript and the distance between these Contig through paired-end reads; SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence is represented with N, so just obtains Scaffold.Further utilize paired-end reads that Scaffold is done filling-up hole and handle, it is minimum to obtain containing N at last, the Unigene sequence that two ends can not prolong again.At last, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done blastx comparison (evalue < 0.00001), get the sequence direction that the best albumen of comparison result is confirmed Unigene.If the comparison result between the different sink is contradictory; Then confirm the sequence direction of Unigene by the priority of nr, Swiss-Prot, KEGG and COG; With above four storehouses all to less than Unigene with software ESTScan (Iseli; Jongeneel et al.ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences [J] .In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology.AAAIPress; Menlo Park; CA, pp.1999 138-148.) predicts its coding region and confirm the direction of sequence.For the Unigene that can confirm the sequence direction provide its from 5 ' to the sequence of 3 ' direction, provide the sequence that composite software obtains for the Unigene that can't confirm the sequence direction.

Embodiment 5: " hundred make " produced bacterium entomophyte China pilose spore Unigene functional annotation

Functional annotation information provides protein function note, Pathway note, COG functional annotation and Gene Ontology (GO) functional annotation of Unigene.At first; Through blastx with the Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG (evalue < 0.00001); Obtain having the albumen of highest serial similarity, thereby obtain the protein function annotation information of this Unigene with given Unigene.Can further obtain the Pathway note of Unigene according to the KEGG annotation information.Unigene and COG DB are compared, and the possible function of prediction Unigene is also done the function statistic of classification to it.According to the nr annotation information; Use Blast2GO software (Conesa; Gotz et al.Blast2GO:a universal tool for annotation; Visualization and analysis in functional genomics research [J] .Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.After obtaining the GO note of each Unigene; With WEGO software (Ye; Fang et al.WEGO:a web tool for plotting GO annotations [J] .Nucleic Acids Research; 2006,34:293-297.) all Unigene are done GO functional classification statistics, from the gene function distribution characteristics of these species of macroscopic view understanding.

Embodiment 6: " hundred make " produced bacterium entomophyte China pilose spore xanthine pathways metabolism and analyzed

Fig. 2 is the purine metabolism (map00230) in the KEGG pathways metabolism note; The enzyme of note is that detected " hundred make " produced bacterium entomophyte China pilose spore purine metabolism approach relevant enzymes; As can be seen from the figure, detected from synthetic 2 Unigene of xanthic guanase of guanine.Through the online detection of ORF Finder software among the NCBI, found out the ORFs (SEQ ID No.3 and SEQ ID No.4) of these genes and obtained corresponding proteins matter sequence (SEQ ID No.1 and SEQ ID No.2).

Embodiment 7: " hundred make " produced the design of bacterium entomophyte China pilose spore guanase gene primer

The gene ORFs dna sequence dna design primer that utilization GENE RUNNER primer-design software obtains according to prediction; Be used for clone's " hundred make " and produce the xanthic guanase gene of bacterium China pilose spore anabolism; Primer is given birth to worker's biotechnology ltd by Shanghai and is synthesized, and primer sequence is listed as follows:

PunG1 gene: forward primer 5 ' ATTGAATTCATGAAGCCCGGGAAGAAAAAC3 '

Reverse primer 5 ' ATTAAGCTTCTAGGTCTCGGGGACGCG3 '

The punG1 mrna length is 327bp

PunG2 gene: forward primer 5 ' GCCGAATTCATGCTGCAAAAGTACACGTTC3 '

Reverse primer 5 ' ATTAAGCTTTTACGGGGGGCCCGCGG3 '

The punG2 mrna length is 753bp

Embodiment 8: " hundred make " produced the preparation of bacterium entomophyte China pilose spore cDNA first chain

After the method that provides according to embodiment 1 is earlier turned out sutella sinensis fermented mycelium; The method that is provided according to embodiment 2 is again carried out the extraction of total RNA to China by the hair spore; Obtain being undertaken synthesizing of " hundred make " production bacterium entomophyte China pilose spore cDNA first chain by following behind total RNA, be used for follow-up each gene clone experiment.

Adopt synthetic cDNA first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is following:

1) the following mixed solution of preparation in the Microtube pipe.

2) sex change, annealing operation help the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, can improve reverse transcription reaction efficient, so on the PCR appearance, carry out sex change, annealing reaction, condition setting is following:

65℃，5min

4℃

3) annealing finishes the centrifugal several seconds of back and makes the mixed solution of template ribonucleic acid/primer etc. be gathered in Microtube pipe bottom.

4) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.

5) on the PCR appearance, carry out reverse transcription reaction by following condition.

42℃ 15～30min

70℃ 15min

4℃

Generalized case; At eukaryote mRNA 3 ' end a PolyA structure is arranged all; The quantity of A base does not wait to hundreds of is individual ten, utilizes this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II; With mRNA is synthetic cDNA first chain of template; The present invention adopts the sequence (providing among the PrimeScript 1st Strand cDNA Synthesis Kit) in the dT zone of being developed alone by TaKaRa to be primer, if the mRNA integrity that obtains is better, can obtain cDNA first chain of all zymoprotein encoding soxs in the species so through the rt process.

Embodiment 9: " hundred make " produced the detection of clone, expression and the protein vigor of bacterium entomophyte China pilose spore anabolism purine class nucleosides functional gene guanase punG1 and punG2 gene

1, the pcr amplification of guanase punG1 and punG2 gene

CDNA first chain to obtain among the embodiment 8 is a template, and with synthetic punG1 gene primer among the embodiment 7: 5 ' ATT GAA TTC ATG AAG CCC GGG AAG AAA AAC3 ' and 5 ' ATT AAG CTT CTA GGT CTC GGG GAC GCG3 ' and punG2 gene primer: 5 ' GCC GAA TTC ATG CTG CAA AAG TAC ACG TTC3 ' and 5 ' ATT AAG CTT TTA CGG GGG GCC CGC GG3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction.

2, guanase punG1 and punG2 gene PCR product gel electrophoresis detection

The size of transcribing group order-checking prediction guanase punG1 and punG2 gene is respectively 327bp and 753bp, and the agarose gel electrophoresis result shows and successfully amplified guanase punG1 and punG2 gene.

3, the base A that adds of guanase punG1 and punG2 gene PCR product handles and purifying

Because Pfu archaeal dna polymerase PCR product end is a flush end, so just can be used for the connection of T carrier after after glue reclaims, also need adding base A processing, purifying.

4, guanase punG1 and punG2 gene and cloning vector is connected

Cloning vector pMD18-T Vector is available from TaKaRa company (TaKaRa code D101A); Its physical map is seen Fig. 4; Respectively guanase punG1 is connected construction recombination plasmid pMD18-T/punG1 and pMD18-T/punG2 with the punG2 gene with cloning vector, physical map is seen Fig. 5.

5, the conversion of guanase recombinant plasmid pMD18-T/punG1 and pMD18-T/punG2

Respectively recombinant plasmid pMD18-T/punG1 and pMD18-T/punG2 are changed over to and make up reorganization bacterium E.coli JM109/pMD18-T/punG1 and the E.coli JM109/pMD18-T/punG2 that carries guanase punG1 and punG2 gene among the intestinal bacteria E.coli JM109; Concrete steps are: 1) 10 μ L reaction systems are gone among the competent cell E.coli JM109 ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 ℃, 250rpm, 1h; 5) spread plate (containing the Amp resistance); 6) 37 ℃ of incubator overnight cultures.

6, the screening of the positive reorganization of guanase E.coli JM109/pMD18-T/punG1 and E.coli JM109/pMD18-T/punG2 bacterium

Bacterium colony PCR can extract genomic dna, and is that template is carried out pcr amplification with the DNA that exposes after the thalline pyrolysis directly, and whether this method is easy and simple to handle, quick, can the Rapid identification bacterium colony be the positive bacterium colony that contains the purpose plasmid.Carry out bacterium colony PCR with being inoculated into single bacterium colony corresponding in the liquid nutrient medium, whether change goal gene over to checking.Adopt 0.9% agarose gel electrophoresis detection bacterium colony PCR product at last.

7, the order-checking of guanase recombinant plasmid pMD18-T/punG1 and pMD18-T/punG2

After the detected positive reorganization bacteria liquid LB culture medium culturing of bacterium colony PCR spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep DNA small volume of reagent box.Order-checking is accomplished by Shanghai Sani's bio tech ltd.

8, the structure of guanase recombinant expression plasmid pET-28b/punG1 and pMD18-T/punG2

The experimental basis foreign gene is in the principle of expression in escherichia coli; And expression vector pET-28b and guanase punG1 and punG2 gene restriction enzyme site comparison situation; Confirmed EcoR I and Hind III double enzyme site, and recombination bacillus coli E.coli JM109/pMD18-T/punG1 and E.coli JM109/pMD18-T/punG2 have been carried out the cultivation of liquid LB test tube shaking table, recombinant plasmid extraction.

With the recombinant plasmid pMD18-T/punG1 of guanase punG1 and punG2 gene and pMD18-T/punG2 and expression vector pET-28b respectively with EcoR I/Hind III restriction enzyme 37 ℃ respectively enzyme cut and handle 6h; Enzyme is cut and is finished back 65 ℃ of deactivation 15min, then respectively with Axygen dna gel recovery test kit reclaim, purifying.

Guanase punG1 and punG2 gene and expression vector pET-28b are connected for 16 ℃ with the T4 ligase enzyme behind double digestion, purifying again and spend the night; Make up recombinant expression plasmid pET-28b/punG1 and pET-28b/punG2 respectively; Its building process is seen Fig. 6, makes up the recombinant expression plasmid pET-28b/punG1 and the pET-28b/punG2 collection of illustrative plates that obtain and sees Fig. 7.

9, the screening of the conversion of guanase recombinant expression plasmid pET-28b/punG1 and pET-28b/punG2 and positive monoclonal

The expression plasmid heat shock that builds is converted in the E.coli BL21 host bacterium, is applied on the LB agar plate that contains kantlex (Kan) resistance 37 ℃ of overnight cultures then.Random choose list bacterium colony from the flat board carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of guanase reorganization bacterium E.coli BL21/pET-28b/punG1 and E.coli BL21/pET-28b/punG2

Be inoculated in 5mL and contain in the LB liquid nutrient medium of Kan resistance 37 ℃, 250r/min overnight cultures being accredited as the male mono-clonal.Get the 1mL culture, it is transferred contain in the LB liquid nutrient medium of Kan resistance 37 ℃, 250r/min in 50mL and be cultured to cell concentration OD600 and be about about 0.6～0.8.In culture, add certain density IPTG inducing culture 8h respectively.Collecting thalline power supply swimming analyzes and enzyme biopsy survey.

11, guanase reorganization bacterium E.coli BL21/pET-28b/punG1 and E.coli BL21/pET-28b/punG2 expression product SDS-PAGE analyze

With the E.coli BL21 bacterium that changes empty carrier over to and the reorganization bacterium that do not add inductor IPTG as contrast.Be accredited as male reorganization bacterium behind IPTG inducing culture certain hour; Get 0.5mL inducing culture thing, centrifugal collection thalline is resuspended in the 50 μ L zero(ppm) water; Add 50 μ L sample-loading buffers; Boil 10min behind the mixing, carry out the SDS-PAGE electrophoretic analysis, " G1 " among Fig. 8 and " G1 " swimming lane are the SDS-PAGE figure of the guanase albumen punG1 and the punG2 of reorganization bacterium E.coli BL21/pET-28b/punG1 and E.coli BL21/pET-28b/punG2 expression.

12, the protein-active of guanase reorganization bacterium E.coli BL21/pET-28b/punG1 and E.coli BL21/pET-28b/punG2 detects

The preparation of enzyme liquid: reorganization bacterium E.coli BL21/pET-28b/punG1 and each 0.5g of E.coli BL21/pET-28b/punG2 of taking by weighing collection use phosphate buffered saline buffer (50mM, pH8.0) 15mL to suspend respectively, ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).

Guanase punG1 and punG2 transformation system: in 50mL conversion bottle, add E.coli BL21/pET-28b/punG1 and E.coli BL21/pET-28b/punG2 ultrasonication thalline mixed solution 10mL, 1% guanine; 30 ℃, 150r/min conversion; After transforming end, the centrifuging and taking supernatant is equipped with subsequent detection.

Detection method: RPIC detection by quantitative xanthine.Condition: chromatographic column, μ Bondapak C18 10 μ m, 125A, 4.6 * 300mm; Moving phase: water, glacial acetic acid, TBAH and methyl alcohol mix with certain proportion, carry out suction filtration with 0.45 μ m organic phase film before using, and UW degasification 5min; Detect wavelength 254nm; Sampling volume 10 μ L.Prepare the gradient mass concentration of xanthine standard model 1-10000 μ g/mL respectively, the drawing standard curve.

After transforming end, in the centrifugal 25min of 14000rpm, with 0.45 μ m filtering with microporous membrane, filtrating supplies the reversed phase ion pair chromatography analysis with conversion fluid.Recording the xanthine yield at last is 43.5%.

Claims (5)

1. xanthic guanase of participation guanine anabolism of producing bacterium entomophyte China pilose spore from " hundred make ": sequence is that punG1 albumen and the sequence of SEQ ID No.1 is the punG2 albumen of SEQ ID No.2.

2. guanase as claimed in claim 1 prepares the application in the xanthine at the biocatalysis guanine.

3. the gene of coding claim 1 said guanase.

4. gene as claimed in claim 3 is characterized in that said gene is that sequence is that punG1 gene and the sequence of SEQ ID No.3 is the punG2 gene of SEQ ID No.4.

5. making up and to prepare the application in the xanthic genetic engineering bacterium by the biocatalysis guanine like claim 3 or 4 described genes.

Images