CN102229980B - Molecular breeding method for improving micronaire value of cotton by using chromosome segment introgression lines of island cotton - Google Patents

Abstract

The invention discloses a molecular breeding method for improving the micronaire value of cotton by using chromosome segment introgression lines of island cotton, which is specially applied to directionally improving the agronomic traits and breeding new varieties of crops (cotton). By detecting the cotton fiber quality of chromosome segment introgression lines of island cotton, an introgression line IL056-A5-7 is screened, the micronaire value of which is significantly lower than the reference control TM-1. The introgression line which is used as the non-recurrent parent is hybridized with the early maturing upland cotton No.41 from the Xinjiang cotton-planting area which is used as the recurrent parent, then back-crossed in two generations and self-crossed in three generations, so as to screen a cotton new line which is excellent in micronaire value through the auxiliary selection by using molecular marking. By use of the method provided by the invention, the high-quality high-yield cotton new line 'island cotton No.4 of Nanjing agricultural university' has been bred.

Description

A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire value

(1) Technical field: a kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire value of the present invention is exclusively used in the quickly and efficiently seed selection New cotton line (new variety) good with producing mic value.

(2) technical background:

Cotton is global Important Economic crop.China is the big producing country of cotton, consumption big country and weaving big country.As Cotton Production big country, China main product cotton region covers 16 provinces, city (autonomous region), plants 7000-8,000 ten thousand mu of cotton areas throughout the year, and approximately 6,000,000 tons of gross outputs account for 1/4th of world's gross output.Along with the progress of textile technology, textile product also develops into high grade cotton yarn even reaches 100 fine sand from coarse yarn, and processing object also has general medium staple cotton to develop into middle long stapled cotton, long stapled cotton and super long stapled cotton.(the Wang Yanqin such as Wang Yanqin, Yang Wei China, Xu Hongxia, Zhou Dayun, Feng Xinai, Kuang Meng. Main Problems and suggestion in the China's Cotton Production. Chinese agronomy circular, 2009,25 (14): 86-90) chose 546 basic points in three large main product cotton regions in 2003-2007 years continuous 5 years, 2201 parts of cotton samples carry out fiber quality and detect average 28.8 mm of staple length that find China's upland cotton sample, luffing 24.0 ~ 34.7 mm mainly are in medium staple (28.0 ~ 31.0 mm) scope of medium staple cotton, namely in long scope; Average 28.3 cN/tex of strength, luffing 19.7-38.3 cN/tex, that majority is in is medium (26.0 ~ 29.0cN/tex) scopes, namely in to strong scope; Mic value is average 4.2, and luffing 2.0 ~ 5.2 is most in (3.7 ~ 4.9) scope.Cotton can satisfy the needs of textile industry substantially, but lacks length more than 31 mm, and strength is more than 34 cN/tex, and the extra best best kind of mic value between 3.7 ~ 4.2 satisfies the needs that spin 60 above high grade cotton yarns.

The genetic analysis of general cotton variety fibrous quality proterties all shows typical amounts character inheritance mode, is subject to environmental influence.In different segregating populations, additivity, dominant or epistasis effect all may be occupied an leading position.Utilizing the high-tenacity proterties of wild species and the fine quality gene recombination of sea island cotton gradually to blend transformation, is the main path that contemporary breeding man obtains high tenacity fibre.Sea island cotton is long breeding time, and in ripe evening, bell is little, and output is lower than upland cotton, but fiber finer is strong, is the high-count yarn spun raw material; And the output of upland cotton is high, wide adaptability, and fibrous quality is medium, but significantly is better than Asiatic cotton and cotton.The F of upland cotton, both hybridization of sea island cotton ₁Can educate, phenotype is normal, and the hybrid vigour of obvious output, quality is arranged, and India, Israel, China successfully cultivate and goes to sea, the spread utilization on producing of land cross-fertilize seed.But the madness of the typical species hybridization of Posterity phenotype of both hybridization is separated, and the cotton breeding man is out for cultivating always both has the high yield of upland cotton, the new variety of sea island cotton high-quality is arranged again, never success.The application of molecular marking technique in fibrous quality improvement breeding greatly reduced the blindness of selecting in the breeding process, realizes that fast the external source elite germplasm permeates to Cultivar, has widened the hereditary basis of kind.Both at home and abroad the researchist has carried out a large amount of QTL Position Research to fibrous quality, and what have is used for the marker assisted selection breeding practice.

Chromosome segment introgressive line (Chromosome segment introgression lines, CSIL) be to utilize hybridization, backcross and whole genomic a series of near isogenic lines of nurse crop that molecular marker assisted selection (marker-assisted selection, MAS) makes up.Only from a chromosome segment that isozygotys of donor parents, and genomic rest part is identical with recurrent parent in its genome.It is to carry out genome research, the particularly ideal material of QTL location and Molecular design breeding.Wan Jianmin (Wan Jianmin. Perspectives of Molecular Design Breeding in Crops. Acta Agronomica Sinica, 2006,32(3): 455-462.) utilized the chromosome segment substitution line that is made up by japonica rice Asominori (recurrent parent) and long-grained nonglutinous rice IR24 (nonrecurrent parent) to carry out the practice of molecular breeding.

(3) summary of the invention

Technical problemA kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire value overcomes and alleviates the serious Linkage drag that sea-land hybridization exists, and is conducive in the good genetic resources importing upland cotton of mic value in the sea island cotton.Backcross and can recover the genetic background of recurrent parent, preserved simultaneously the favourable proterties of nonrecurrent parent, binding molecule marker assisted selection objective trait can rapidly and efficiently be cultivated the good New cotton line of mic value.

A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire value of technical scheme, comprising:

1) take the new land of Xinjiang cotton commercial variety early No. 41 as recurrent parent (♀), importing with the IL056-A5-7 chromosome segment is nonrecurrent parent (♂), hybridizes for 1 generation, in 2 generations that backcrossed, obtain BC ₂F ₁, per generation all is the mixed miscegenation of receiving;

2) molecule marker is auxiliary selects for the first time: BC ₂F ₁Plantation is used the CTAB method and is extracted DNA, adopts molecule marker primer pair NAU5347, CIR062, NAU6657, NAU6207, NAU861, NAU3014 on the IL056-A5-7 introgressed segment to carry out pcr amplification, selects simultaneously Contain(molecular weight is respectively 600bp to 6 molecule marker bands; 300bp; 180bp; 300bp; 215bp; Individual plant selfing 210bp) obtains BC ₂F ₂, seed is pressed the individual plant results;

Primer pair	Product size (bp)	Forward primer sequence (5 '-3 ')	Reverse primer sequence (5 '-3 ')
NAU5347	600	AAAGAAGTTCCGTTCAAGG	ACTGCATACTGTTTGCTCCA
				CIR062	300	TTTAGAGGAGAAGTTTAGG	CAGTCTCTTGTAGTTTCATT
NAU6657	180	TGTTAGTGCGCTTCTGTGAT	CAGAGAAGATGGCAATGTGA
				NAU6207	300	AGATATTGTTGGGGTCGAAA	CAGAGAAGATGGCAATGTGA
NAU861	215	CCAAAACTTGTCCCATTAGC	TTCATCTGTTGCCAGATCC
				NAU3014	210	TCGATAGCATCCAAGAAACA	AACTTGCACTCCCCATACAT

3) molecule marker is auxiliary selects for the second time: plantation BC ₂F ₂, after DNA was extracted in every strain, recycling molecule marker primer pair NAU5347, CIR062, NAU6657, NAU6207, NAU861, NAU3014 determined BC ₂F ₂The genotype of individual plant, simultaneously Only have(molecular weight is respectively 600bp to 6 molecule marker bands; 300bp; 180bp; 300bp; 215bp; Individual plant selfing 210bp) obtains BC ₂F ₃, BC ₂F ₃Be The improved line of improvement cotton micronaire value, from the BC of described improvement cotton micronaire value ₂F ₃Middle selection staple length 29.39-30.63 mm, fibre strength 30.2-31.3cN/tex, mic value 3.63-4.14, the heavy 4.68-5.05 g of single bell, the family of ginning outturn 36.9-38.2% is improved line " Nan Nonghai leads No. 4 ".The newer land of this strain mic value early significantly reduces for No. 41, the new land of staple length, fibre strength and output and recurrent parent early No. 41 suitable.

Beneficial effect:Provided by the present invention A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire valueCompare with traditional pyramiding breeding technology that backcrosses and to have following advantage: traditional pyramiding breeding technology that backcrosses exist the crossing work amount large, select poor reliability, the long defective of breeding cycle.By the molecular marker assisted selection objective trait, can in 2-3, rapidly and efficiently cultivate the New cotton line of the multiple target characters such as high yield, high-quality.

" Nan Nonghai leads No. 4 " major advantage: so that sea island cotton chromosome segment introgressive line---IL056-A5-7 is as donor material, take new land early No. 41 as recurrent parent, by molecular marker assisted selection obtained the new land of cotton fiber length, fibre strength and output and recurrent parent early No. 41 quite, the significantly reduced New cotton line of mic value " Nan Nonghai leads No. 4 ".The mic value 3.63-4.14 of " Nan Nonghai leads No. 4 ".

(4) description of drawings:

The New cotton line that Fig. 1 molecular marker assisted selection mic value is good

(5) biological preservation:

IL056-A5-7 be upland cotton ( Gossypium hirsutum.), on March 15th, 2011 was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, and Institute of Microorganism, Academia Sinica, culture presevation number is CGMCC NO.4683.

(6) embodiment:

Selection parent:Agricultural University Of Nanjing's crop genetic and germplasm innovation National Key Laboratory Cotton Research Institute are take upland cotton Genetic standard line TM-1 as recurrent parent, sea island cotton sea 7124 product disease-resistant, high-quality are donor parents (nonrecurrent parent), at the advanced lines that backcrosses in conjunction with covering complete genomic SSR molecular marker assisted selection, cultivated 174 of the sea island cotton chromosome segment introgressive lines of domestic first cover upland cotton Genetic standard line TM-1 background, its genomic fraction of coverage reaches 83.5%.Detect by sea island cotton chromosome segment introgressive line being carried out continuous 2 years cotton fibre quality, filter out staple length and significantly be better than the introgressive line IL056-A5-7 that contrasts.This introgressive line staple length 28.75-29.4mm, fibre strength 29.9-31.0cN/tex, mic value 3.3-3.5, the heavy 6.7-7.1g of single bell, ginning outturn 37.3-38.2%, individual plant bell count 12-15, plant height 95-105 cm.

The new land of Xinjiang cotton commercial variety early No. 41 be that the Shine Early cotton kind that industry company limited cultivates is planted by the rich brand-new section in Xinjiang, in March, 2009 is by Xinjiang crop varietal approval committee (variety certification number: new examining cotton 2009 No. 57).This kind staple length 30.30-30.33 mm, fibre strength 30.5-31.5cN/tex, mic value 4.31-4.39, the heavy 5.23-5.34 g of single bell, ginning outturn 38.1-43.3%, individual plant bell count 15-20, plant height 100-110 cm.

Breed breeding:Winter in 2007 early was female parent No. 41 at Sanya, Hainan take new land, and IL056-A5-7 is male parent preparing hybrid F ₁Planted respectively the new land of delegation early No. 41 and F in summer in 2008 in testing station, Agricultural University Of Nanjing Jiangpu ₁, take new land early No. 41 as male parent, F ₁Be maternal preparing hybrid combination results BC ₁F ₁, ripe rear all mixed receipts.Winter in 2008 was planted respectively the new land of delegation early No. 41 and BC at Sanya, Hainan ₁F ₁, take new land early No. 41 as male parent, F ₁Be maternal preparing hybrid combination results BC ₂F ₁, ripe rear all mixed receipts.Field management is carried out according to a conventional method.

Molecular marker assisted selection:Summer in 2009 was planted 3 row BC in testing station, Agricultural University Of Nanjing Jiangpu ₂F ₁Every row 10-12 strain, the blade that every strain collection 3-4 sheet does not launch is put into the eppendorf pipe of 1.5ml, and the freshly prepared Extraction buffer 600 μ l of adding precooling, electric drill grinds, application CTAB method (Paterson AH, Brubaker CL, Wendel JF. A rapid method for extraction of cotton ( GossypiumSpp.) genomic DNA suitable for RFLP or PCR analysis [J]. Plant Mol Biol Rep, 1993,11,2:122-127) extract DNA, adopt the molecule marker (table 1) on the IL056-A5-7 introgressed segment to carry out pcr amplification, amplification system 10 μL, dna profiling 1 μL, 94 ℃ of denaturation 5min, 94 ℃ of sex change 0.5min, 57 ℃ of renaturation 0.5min, 72 ℃ are extended 1min, and after 30 circulations, 72 ℃ are extended 10 min again, amplified production is through native polyacrylamide gel electrophoresis: gel strength is 8%, and electrophoretic buffer is 0.5 times of TBE, 170V constant voltage electrophoresis 1.5 hours.5 individual plant selfing that selection contains 6 molecule markers obtain BC ₂F ₂, seed is pressed the individual plant results.

Winter in 2009 is at each BC of Sanya, Hainan ₂F ₂Plant 3 row, every row 10-12 strain amounts to 15 row, the 150-180 strain, and every strain gathers blade, and behind the extraction DNA, the molecule marker that utilizes table 1 to provide is determined BC ₂F ₂The genotype of individual plant, selecting 6 marks all is that the individual plant selfing of isozygotying obtains 10 strain BC ₂F ₃

Field test:Summer in 2010, each BC ₂F ₃Plant 2 row in Xinjiang, every row 15-20 strain, twice repetition.After spending by the mixed cotton receiving of row after ripe, every row is got 12 gram gined cotton samples, repeats 2 times, send Henan cotton quality inspection center detection gined cotton quality.The BC of above-described improvement cotton micronaire value ₂F ₃Middle selection staple length 29.39-30.63 mm, fibre strength 30.2-31.3cN/tex, mic value 3.63-4.14, the heavy 4.68-5.05 g of single bell, the family of ginning outturn 36.9-38.2% is improved line " Nan Nonghai leads No. 4 ".The newer land of this strain mic value early significantly reduces for No. 41, the new land of staple length, fibre strength and output and recurrent parent early No. 41 suitable.

Annotate: CIR is from (Nguyen T B such as Nguyen, G iband M, Brottier P, Risterucci A M, Lacape J M. Wide coverage of the tetraploid cotton genome using newly developed microsatellite markers. Theor Appl Genet, 2004, the sequence of 109:167-175) announcing; The primer of NAU numbering is developed (Han Z G, Guo W Z, Song X L, et al. Genetic mapping of EST-derived microsatellites from the diploid by this laboratory from the EST-SSR sequence Gossypium arboreumIn allotetraploid cotton. Mol Gen Genomics, 2004,272:308-327; Han Z G, Wang C B, Song X L, et al. Characteristics, development and mapping of Gossypium hirsutumDerived EST-SSRs in allotetraploid cotton. Theor Appl Genet, 2006,112:430-439; Wangzhen Guo, Caiping Cai, Changbiao Wang, et al. A preliminary analysis of genome structure and composition in Gossypium hirsutum. BMC Genomics, 2008,9:314-331.). all primer information can be downloaded from website www.cottonmarkers.org.

Sequence table

＜110〉Agricultural University Of Nanjing

＜120〉a kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire value

＜130〉specification sheets

<140> 00

<141> 2011-04-11

<160> 12

<170> PatentIn version 3.1

<210> 1

<211> 19

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU5347 forward primer sequence

<222> (1)..(19)

<400> 1

aaagaagttc cgttcaagg 19

<210> 2

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU5347 reverse primer sequence

<222> (1)..(20)

<400> 2

actgcatact gtttgctcca 20

<210> 3

<211> 19

<212> DNA

＜213〉synthetic

<220>

＜221〉CIR062 forward primer sequence

<222> (1)..(19)

<400> 3

tttagaggag aagtttagg 19

<210> 4

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉CIR062 reverse primer sequence

<222> (1)..(20)

<400> 4

cagtctcttg tagtttcatt 20

<210> 5

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU6657 forward primer sequence

<222> (1)..(20)

<400> 5

tgttagtgcg cttctgtgat 20

<210> 6

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU6657 reverse primer sequence

<222> (1)..(20)

<400> 6

cagagaagat ggcaatgtga 20

<210> 7

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU6207 forward primer sequence

<222> (1)..(20)

<400> 7

agatattgtt ggggtcgaaa 20

<210> 8

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU6207 reverse primer sequence

<222> (1)..(20)

<400> 8

cagagaagat ggcaatgtga 20

<210> 9

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU861 forward primer sequence

<222> (1)..(20)

<400> 9

ccaaaacttg tcccattagc 20

<210> 10

<211> 19

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU861 reverse primer sequence

<222> (1)..(19)

<400> 10

ttcatctgtt gccagatcc 19

<210> 11

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU3014 forward primer sequence

<222> (1)..(20)

<400> 11

tcgatagcat ccaagaaaca 20

<210> 12

<211> 20

<212> DNA

＜213〉synthetic

<220>

＜221〉NAU3014 reverse primer sequence

<222> (1)..(20)

<400> 12

aacttgcact ccccatacat 20

Claims (1)

1. A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton micronaire value,Comprise:

1) take the new land of Xinjiang cotton commercial variety early No. 41 as recurrent parent ♀, importing with the IL056-A5-7 chromosome segment is nonrecurrent parent ♂, hybridizes for 1 generation, 2 generations acquisition BC backcrosses ₂F ₁, per generation all is the mixed miscegenation of receiving, the deposit number of IL056-A5-7 chromosome segment introgressive line is CGMCC NO.4683;

2) molecule marker is auxiliary selects for the first time: BC ₂F ₁Plantation is used the CTAB method and is extracted DNA, adopts molecule marker primer pair NAU5347, CIR062, NAU6657, NAU6207, NAU861, NAU3014 on the IL056-A5-7 introgressed segment to carry out pcr amplification, selects simultaneously Contain6 molecule marker bands are respectively 600bp; 300bp; 180bp; 300bp; 215bp; The individual plant selfing of 210bp obtains BC ₂F ₂, seed is pressed the individual plant results;

Primer pair Product size bp Forward primer sequence 5 '-3 ' Reverse primer sequence 5 '-3 ' NAU5347 600 AAAGAAGTTCCGTTCAAGG ACTGCATACTGTTTGCTCCA CIR062 300 TTTAGAGGAGAAGTTTAGG CAGTCTCTTGTAGTTTCATT NAU6657 180 TGTTAGTGCGCTTCTGTGAT CAGAGAAGATGGCAATGTGA NAU6207 300 AGATATTGTTGGGGTCGAAA CAGAGAAGATGGCAATGTGA NAU861 215 CCAAAACTTGTCCCATTAGC TTCATCTGTTGCCAGATCC NAU3014 210 TCGATAGCATCCAAGAAACA AACTTGCACTCCCCATACAT

Molecule marker is auxiliary to be selected for the second time: plantation BC ₂F ₂, after DNA was extracted in every strain, recycling molecule marker primer pair NAU5347, CIR062, NAU6657, NAU6207, NAU861, NAU3014 determined BC ₂F ₂The genotype of individual plant, simultaneously Only have6 molecule marker bands are respectively 600bp; 300bp; 180bp; 300bp; 215bp; The individual plant selfing of 210bp obtains BC ₂F ₃, BC ₂F ₃Middle selection staple length 29.39-30.63 mm, fibre strength 30.2-31.3cN/tex, mic value 3.63-4.14, the heavy 4.68-5.05 g of single bell, the family of ginning outturn 36.9-38.2% is the improved line of improveing cotton micronaire value.

Images